Name: stereotactically-guided ablation of the rat auditory cortex, and localization of the lesion in the brain
Uploaded: 2017-10-11T12:30:00.000+00:00
Duration: 9 min 29 s
Description: Watch this Scientific Journal Video about Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain at JoVE.com

كان يؤيد هذا البحث بمنحه مقدمة من وزارة الاقتصاد و "القدرة التنافسية" (مينيكو) من "حكومة إسبانيا"، SAF2016-78898-C2-2-ر.

هذه الدراسة أجريت في التقيد التام بكل الأنظمة الإسبانية (الملكي المرسوم 53/2013-القانون 32/2007)، ومبادئ الاتحاد الأوروبي التوجيهية (التوجيه 2010/63/الاتحاد الأوروبي) على رعاية واستخدام الحيوانات في البحوث الطبية الحيوية-
 1. إعداد الفئران ملاحظة: أجرينا التجارب في الفئران الذكور لتجنب أي تغيرات هرمونية.
<ol><li>أنيسثيتيزي الحيوان باستخدام مزيج من الكيتامين هيدروكلوريد (30 ملغ/كغ) وإكسيلازيني هيدروكلوريد (5 مغ/كغ) حقن في العضل؛ ومع هذه الجرعة، الفئران يجب أن يكون بالغ تخديره من أجل ه حوالي 1.</li>
	<li>قرصه الفئران &#39; s أخمص القدمين؛ وعدم وجود السحب العاكسة ويشير إلى أن الحيوان فاقد الوعي تماما. إذا الفئران تستجيب لقرصة، إعطاء التخدير التكميلية في ثلث الجرعة الأولى-</li>
	<li>حلق فروة الرأس وتطهير منطقة الجراحي مع بوفيدون-</li>
	<li>وضع الحيوان على منصة تدفئة الحفاظ على درجة حرارة 38 درجة مئوية واستقرار الحيوان &#39; رأسه s في إطار ستيريوتاكسيك باستخدام اثنين من قضبان الإذن وبار لدغة. توخي الحذر لتجنب ثقب غشاء الطبل مع أشرطة الإذن.</li>
	<li>حماية العينين بتطبيق قطره من المحلول الملحي المصل أو هلام العيون لكل عين-</li>
</ol> 2. موقع لجنة التدقيق في العظم الصدغي من الفئران <ol><li>باستخدام مشرط، جعل شق على طول خط الوسط فضح الجمجمة، وسحب السمحاق يغطي سطح الجمجمة.</li>
	<li>استخدام تلميح القطن معقم لإزالة بلطف أي الدم تغطي سطح الجمجمة تصور بريجما وامدا 0 إينتيراورال طبقاً للأطلس أوضح وواطسون الدماغ الفئران 22-</li>
	جعل <li>شق في عضلة الزمانية قرب الإدراج الظهرية في الجمجمة مع مشرط. سحب العضلات باستخدام مادة إبرة وخياطة، وإصلاح مواد خياطة الجروح بالمناظير باستخدام الأشعة الإطار؛ هذا وسوف يعرض العظم الصدغي. في حالة حدوث نزيف، شطف مع المحلول الملحي المعقم الباردة.</li>
	<li>مكان إبرة مستقيمة عقيمة في ميكرومانيبولاتور المناظير باستخدام الأشعة، مع التأكد من أن يتم تأمين كامل-</li>
	<li>انخفاض الإبرة ببطء حتى أنها الحق فوق سطح الجمجمة، حيث أن طرف الإبرة يتم تعيين إلى 0 إينتيراورال. تعيين هذا النقطة الصفر، وتحديد الإحداثيات من هذه النقطة-</li>
	<li>تختلف تبعاً لمجال اهتمام الدماغ، إحداثيات المناظير باستخدام الأشعة. تحديد هذه الإحداثيات باستخدام الأطلس أوضح وواطسون الدماغ الفئران 22. حالما يتم تحديد الإحداثيات، تحريك الإبرة لتطابق تلك الإحداثيات.</li>
	<li>استهداف التيار المتردد باستخدام إحداثيات النقاط الأربع التالية: a: A/ف =-5.80 مم، M/L = +/-6.4 مم؛ باء: A/P =-2.7 مم، M/L = +/-6.4 مم؛ C: A/P =-2.7 مم، M/L = +/-8.67 مم؛ دال: A/P =-5.8 مم، M/L = +/-8.67 مم. انخفاض الإبرة للحق فوق العظم الصدغي لتصور كل نقطة من هذه النقاط الأربع. باستخدام قلم ماركر، وضع علامة على النقاط في العظم الصدغي والاتصال بهم من أجل رسم مستطيل؛ المستطيل الذي سيكون بمثابة دليل لفتح نافذة في العظام ( الشكل 1).</li>
</ol> 3. التعرض الجراحية من AC <ol><li>فتح النافذة باستخدام مثقاب كهربائي وحفر صغيرة بت (0.6 مم Ø). حفر في محيط المستطيل 8,000 لفة في الدقيقة حتى العظم ويعطي بعيداً. بارد على سطح الحفر قبل الشطف مع الباردة المالحة عقيمة لمنع الأضرار بالهياكل سوبكورتيكال. عندما يعطي العظام وسيلة، يمكن الكشف عن هبوط في المقاومة. يجب الحرص على عدم حفر الدماغ.</li>
	<li>عند الحدود فضفاضة، سحب ما يصل العظم الذي يغطي مع الملقط غرامة وتخزينها في المحلول الملحي المعقم الباردة.</li>
</ol> 4. الاجتثاث AC <ol><li>برفق باستخدام مجهر جراحي (10 X)، قطع السحايا بسكين ميكروسورجيكال وإزالتها باستخدام الملقط أشار غرامة اثنين. في حالة حدوث نزيف، شطف مع المحلول الملحي المعقم الباردة.</li>
	<li>برفق نضح التيار المتردد استخدام جهاز شفط جراحي (الضغط-0.24 بار) بالإضافة إلى إبرة معقمة في تلميح كليلة ز 20. هذه النقطة الحرجة ويجب أن تتم بعناية فائقة: نضح الطبقات القشرية ستة فقط وليست المسألة الأبيض الكامنة.</li>
	<li>نضح حتى الشرايين تثقيب وقف النزيف.</li>
	<li>عند الانتهاء من التطلع تغطية المنطقة المتضررة بالعظام المستخرجة وتنطبق شاش مرقئ امتصاص.</li>
	واسمحوا <li>العضلات الزمني استرداد موقفها الأصلي، ومن ثم خياطة الجلد باستخدام مقاطع الجرح (9 ملم). تطبيق مرهم مضاد حيوي (انظر الجدول للمواد). الاستمرار في تطبيق مرهم للجرح مرتين يوميا لمدة ثلاثة أيام- 
	ملاحظة: كل تطبيق يتكون من طبقة رقيقة المطبقة على الجرح.</li>
	<li>إدخال البوبرينورفين تحت الجلد في الجزء الخلفي من الفئران (0.05 مغ/كغ) ح 1 مسكن بعد الجراحة، وثم كل 8 ساعات خلال 72 ه.</li>
	<li>إبقاء الحيوان على لوحة تدفئة حتى أن يستيقظ، وإعادته إلى قفصة الإسكان لاسترداد-</li>
	<li>بيت الحيوانات فردياً للحيلولة دون لمس منطقة ستورد الأصحاب القفص، وتوفير بعض عناصر الإثراء. تغيير نشارة الخشب يوميا للوقاية من العدوى، وفحص دقيق لأن الحيوان يتعافى بشكل صحيح، ولم تظهر أية دلائل على عدم الراحة-</li>
</ol> 5. جمع الأنسجة تنبيه: عند التعامل مع بارافورمالدهيد (منهاج عمل بيجين) والصلبة والمائية على السواء، ارتداء معدات الوقاية الشخصية (معدات الوقاية الشخصية) واستخدام خزانة سلامة.
 ملاحظة: إعداد الحل فورمالدهايد 750 مل بإذابة 4% (w/v) منهاج عمل بيجين إلى 1 × الفوسفات مخزنة الحل (PBS) باستخدام الحرارة (55 درجة مئوية). تصفية الحل فورمالدهايد مع أوراق الترشيح. إعداد المسابقة &#39; s الحل بتذويب 8.5 غرام من كلوريد الصوديوم، ز 0.25 بوكل، وز 0.2 NaHCO 3 مل 1,000 للمياه (pH الحل = 6.9).
واسمحوا <ol><li>الحيوان البقاء على قيد الحياة لطالما أنه مطلوب للدراسة. عند اكتمال البحث المنجز مع الفئران أبلاتيد التيار المتردد، الميؤوس من شفائهم تخدير بالحقن داخل البريتوني 0.1 مل من الصوديوم بينتوباربيتال (60 مغ/كغ). تقييم عمق التخدير عن طريق رشة أخمص القدمين، وغياب منعكس سحب-</li>
	<li>عند الحيوان تخديره من هو بالغ، أداء نضح intracardiac 23 من 125 مل المسابقة &#39; s الحل تليها 750 مل من محلول الفورمالديهايد باستخدام مقياس إبرة 1.8 ملم من داخل القطر.</li>
	<li>عند الانتهاء من نضح قطع رأس الفئران في أول فقرة عنق الرحم.</li>
	استخدام مقص لإزالة الجلد والعضلات من الرأس <li>وفضح الجمجمة. استخدام مقص لقطع وفتح ماغنوم ثقبة وإزالة الجزء الخلفي الجمجمة.</li>
	جعل <li>مستقيمين يقتطع العظم المدارية باستخدام مقص سبنسر، واستخدام رونجيورس لقطع على طول الحواف العلوية من الجمجمة لكشف الدماغ. يجب الحرص على عدم تلف الدماغ.</li>
	بعناية إزالة <li>عندما يتعرض الدماغ، الجافية باستخدام الملقط أشار غرامة. استخدام إصبع لحلج القطن تحت برفق والارتقاء بالدماغ. رفع الدماغ وقص زوايا الأعصابإيل فحر. تزج في الدماغ في حل فورمالدهايد وتخزينها في 4 درجات مئوية عن 24 h.</li>
</ol> 6. التعريب للآفات AC <ol><li>بعد التثبيت فيما بعد، بعناية وضع الدماغ في مصفوفة الدماغ الفئران السهمي تعريض السطح جانبية من الدماغ.</li>
	<li>وضع كاميرا أعلاه 21 سم قشرة السطح باستخدام حامل كاميرا، حدد &#34; إطلاق النار الماكرو سوبر &#34; الوضع، وتأخذ صورة لسطح الدماغ.</li>
	<li>مكان في الدماغ في مصفوفة الدماغ الفئران الاكليلية تعريض سطح الدماغ الظهرية، والتقاط صورة أخرى.</li>
	<li>باستخدام أحد برامج محرر صور، افتح الصور وتقليص منهم 50% لجعلها أسهل للعمل معهم. التعرف بريجما وامدا ومراجع 0 إينتيراورال في الصورة طبقاً لإحداثيات أوضح وواطسون 19، ووضع علامة على موضع في الصور ( الشكل 2). رسم كفاف الاستئصال أكثر من الصورة الجانبية للدماغ. حساب المحيط.</li>
	<li>مخطط الاستيراد التنسيق الابتدائية (A1) والمناطق الثانوية (الظهرية وكورتيسيس البطني) من التيار المتردد فيها تقع 18 إلى ملف برنامج محرر حيث كنت تعمل مع الصور. انقر على الخريطة وقم بسحبه إلى ركب أن الصورة الجانبية للدماغ أبلاتيد-
	<ol><li>تجعل في بريجما ومراجع لامدا لخريطة تنسيق تتزامن مع المراجع بريجما وامدا المحددة في الصورة الجانبية الدماغ.</li>
		<li>استخدام الشق رينال كمرجع لضبط الصورة للدماغ للخريطة، وجعلها تتزامن ( الشكل 2)-</li>
	</ol></li> <li>حساب النسبة المئوية للآفة بالنسبة للمنطقة المحتلة يتراوح</li></ol>

<ol>
	<li>Talwar, S. K., Gerstein, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auditory+frequency+discrimination+in+the+white+rat.">Auditory frequency discrimination in the white rat.</a> Hear Res. 126 (1-2), 135-150 (1999).</li><li>Heffner, H. E., Heffner, R. S., Contos, C., Ott, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Audiogram+of+the+hooded+Norway+rat.">Audiogram of the hooded Norway rat.</a> Hear Res. 73 (2), 244-247 (1994).</li><li>Malmierca, M. S., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auditory+System.">Auditory System.</a> The Rat Nervous System. , 995-1080 (2004).</li><li>Delano, P. H., Elgoyhen, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editorial:+Auditory+Efferent+System:+New+Insights+from+Cortex+to+Cochlea.">Editorial: Auditory Efferent System: New Insights from Cortex to Cochlea.</a> Front Syst Neurosci. 10, 1-2 (2016).</li><li>Dinse, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sound+Case+for+Enrichment.+Focus+on+"Environmental+Enrichment+Improves+Response+Strength,+Threshold,+Selectivity,+and+Latency+of+auditory+cortex+Neurons.".">Sound Case for Enrichment. Focus on "Environmental Enrichment Improves Response Strength, Threshold, Selectivity, and Latency of auditory cortex Neurons.".</a> J Neurophysiol. 92 (1), 36-37 (2004).</li><li>Polley, D. B., Heiser, M. A., Blake, D. T., Schreiner, C. E., Merzenich, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Associative+learning+shapes+the+neural+code+for+stimulus+magnitude+in+primary+auditory+cortex.">Associative learning shapes the neural code for stimulus magnitude in primary auditory cortex.</a> Proc Natl Acad Sci U S A. 101 (46), 16351-16356 (2004).</li><li>Kaur, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracortical+Pathways+Determine+Breadth+of+Subthreshold+Frequency+Receptive+Fields+in+Primary+auditory+cortex.">Intracortical Pathways Determine Breadth of Subthreshold Frequency Receptive Fields in Primary auditory cortex.</a> J Neurophysiol. 91 (6), 2551-2567 (2004).</li><li>Talwar, S. K., Musial, P. G., Gerstein, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+mammalian+auditory+cortex+in+the+perception+of+elementary+sound+properties.">Role of mammalian auditory cortex in the perception of elementary sound properties.</a> J Neurophysiol. 85 (6), 2350-2358 (2001).</li><li>Tan, A. Y. Y., Atencio, C. A., Polley, D. B., Merzenich, M. M., Schreiner, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unbalanced+synaptic+inhibition+can+create+intensity-tuned+auditory+cortex+neurons.">Unbalanced synaptic inhibition can create intensity-tuned auditory cortex neurons.</a> Neuroscience. 146 (1), 449-462 (2007).</li><li>Le&#243;n, A., Elgueda, D., Silva, M. A., Hamam&#233;, C. M., Delano, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auditory+cortex+basal+activity+modulates+cochlear+responses+in+chinchillas.">Auditory cortex basal activity modulates cochlear responses in chinchillas.</a> PLOS ONE. 7 (4), e36203 (2012).</li><li>Jager, K., Kossl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Corticofugal+Modulation+of+DPOAEs+in+Gerbils.">Corticofugal Modulation of DPOAEs in Gerbils.</a> Hear Res. 332, 61-72 (2016).</li><li>Dragicevic, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Olivocochlear+Reflex+Strength+and+Cochlear+Sensitivity+are+Independently+Modulated+by+auditory+cortex+Microstimulation.">The Olivocochlear Reflex Strength and Cochlear Sensitivity are Independently Modulated by auditory cortex Microstimulation.</a> J Assoc Res Otolaryngol. 16 (2), 223-240 (2015).</li><li>Clarkson, C., Herrero-Turri&#243;n, M. J., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortical+Auditory+Deafferentation+Induces+Long-Term+Plasticity+in+the+Inferior+Colliculus+of+Adult+Rats:+Microarray+and+qPCR+Analysis.">Cortical Auditory Deafferentation Induces Long-Term Plasticity in the Inferior Colliculus of Adult Rats: Microarray and qPCR Analysis.</a> Front Neural Circuits. 6, 86 (2012).</li><li>Clarkson, C., Ju&#237;z, J. M., Merch&#769;an, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+regulation+in+calretinin+staining+in+the+rat+inferior+colliculus+after+unilateral+auditory+cortical+ablation.">Long-term regulation in calretinin staining in the rat inferior colliculus after unilateral auditory cortical ablation.</a> J Comp Neurol. 518, 4261-4276 (2010).</li><li>Clarkson, C., Ju&#237;z, J. M., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+down-regulation+of+sound-induced+c-Fos+protein+expression+in+the+inferior+colliculus+after+ablation+of+the+auditory+cortex.">Transient down-regulation of sound-induced c-Fos protein expression in the inferior colliculus after ablation of the auditory cortex.</a> Front Neuroanat. 4, 141 (2010).</li><li>Hunter, K. P., Willott, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+bilateral+lesions+of+auditory+cortex+in+mice+on+the+acoustic+startle+response.">Effects of bilateral lesions of auditory cortex in mice on the acoustic startle response.</a> Physiol Behav. 54 (6), 1133-1139 (1993).</li><li>Lamas, V., Arevalo, J. C., Juiz, J. M., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acoustic+input+and+efferent+activity+regulate+the+expression+of+molecules+involved+in+cochlear+micromechanics.">Acoustic input and efferent activity regulate the expression of molecules involved in cochlear micromechanics.</a> Front Syst Neurosci. 8, 253 (2014).</li><li>Lamas, V., Alvarado, J. C., Carro, J., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+evolution+of+brainstem+electrical+evoked+responses+to+sound+after+restricted+ablation+of+the+auditory+cortex.">Long-term evolution of brainstem electrical evoked responses to sound after restricted ablation of the auditory cortex.</a> PLOS ONE. 8 (9), e73585 (2013).</li><li>Lamas, V., Juiz, J. M., Merch&#225;n, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ablation+of+the+auditory+cortex+results+in+changes+in+the+expression+of+neurotransmission-related+mRNAs+in+the+cochlea.">Ablation of the auditory cortex results in changes in the expression of neurotransmission-related mRNAs in the cochlea.</a> Hear Res. 346, 71-80 (2017).</li><li>Doron, N. N., Ledoux, J. E., Semple, M. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redefining+the+tonotopic+core+of+rat+auditory+cortex:+physiological+evidence+for+a+posterior+field.">Redefining the tonotopic core of rat auditory cortex: physiological evidence for a posterior field.</a> J Comp Neurol. 453 (4), 345-360 (2002).</li><li>Polley, D. B., Read, H. L., Storace, D. a., Merzenich, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiparametric+auditory+receptive+field+organization+across+five+cortical+fields+in+the+albino+rat.">Multiparametric auditory receptive field organization across five cortical fields in the albino rat.</a> J Neurophysiol. 97 (5), 3621-3638 (2007).</li><li>Paxinos, G., Watson, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Rat Brain in Stereotaxic Coordinates. , (2005).</li><li>Gage, G. J., Kipke, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole+Animal+Perfusion+Fixation+for+Rodents.">Whole Animal Perfusion Fixation for Rodents.</a> J Vis Exp. (65), e3564 (2012).</li></ol>

الكتاب يعلن أنه أجرى البحث في غياب أي علاقات تجارية أو مالية يمكن أن يفسر تضارب المصالح محتملة.

عملية جراحية في الدماغ ناجح يتوقف على عاملين هما: حفظ الحيوان على قيد الحياة أثناء وبعد الإجراء، ودقة تحديد مجال الاهتمام. ضمان أن الفئران هو عميق تخديره أثناء الجراحة (اختبار رد الفعل الانسحاب)، وتتلقى المسكنات كافية وينبغي أن يساعد المضادات الحيوية غير السامة البقاء على قيد الحياة. بالإضافة إلى ذلك، ينبغي أن تظل الفئران على وسادة تدفئة حتى أنه يستيقظ من التخدير لتفادي انخفاض درجة حرارة الجسم. خياطة ستنخفض قابلية للإصابة، والأسلوب السليم أمر حيوي: سوف تختار الحيوانات في تلك القصاصات الجرح، حيث ينبغي أن يكون مزروع ضيق ما يكفي لمنع إزالة دون وضع الكثير من التوتر على الجرح.
لتحديد بدقة التيار المتردد (أو أي مجال آخر من مجالات القشرية)، من المهم تحديد موقف بريجما وامدا 0 إينتيراورال لاستخدامها كمراجع لحساب حدود المنطقة المستهدفة. سيؤدي إلى أي خطأ في حساب الإحداثيات الاستئصال الجزئي للتيار المتردد أو التطلع غير مرغوب فيها من غيرها من المناطق المحيطة بها. وهكذا، نصيحة إبرة ينبغي فقط لمس العظام في 0 إينتيراورال، وثم ترجمة إحداثيات أنتيرو الخلفي والجانبي ميديو وفقا لما تم وصفه في هذا البروتوكول.
في هذه المخطوطة، نحن أيضا وصف كيفية كشف جراحيا ويجتذ AC. هناك ثلاث خطوات حاسمة: عملية الحفر، وافتتاح وإزالة في السحايا، والاجتثاث من الطموح. ينبغي إجراء الحفر بسرعة منخفضة مع ضغط الحد الأدنى، كما يولد بسرعة حفر عالية الحرارة التي يمكن أن تؤثر على القريبة الهياكل سوبكورتيكال. ومع ذلك، الحفاظ على سرعة منخفضة وتبريد منطقة الحفر مع المحلول الملحي المعقم الباردة ينبغي منع أي ضرر. وباﻹضافة إلى ذلك، ضغط الحد الأدنى أمر أساسي لتجنب كسر مفاجئ للجمجمة والإصابة اللاحقة للقشرة الكامنة. ينبغي أن يجري فتح وإزالة السحايا التي تغطي لجنة التدقيق بعناية لتجنب فصل الأوعية الدموية. في حالة حدوث نزيف، التشخيص المبكر والمتأخر غير المواتية عموما ومن المشكوك فيه ما إذا كان مثل هذا حيوان يفي بمعايير إدراج دراسة موثوق بها. ونحن نوصي القتل الرحيم في هذه الحالة. أخيرا، يجب أن التطلع (ربما أكثر الجوانب صعوبة في أداء آفة فعالة)، تقتصر على الرمادية. هناك اثنين من المؤشرات التي يمكن أن تساعد في الكشف عن وجود هذه المسألة الأبيض: (1) إجراء تغيير في تباين الألوان, كهذه المسألة الأبيض أكثر إشراقا من المادة الرمادية؛ (2)، ووقف نزيف من الشرايين تثقيب.
بعد تنفيذ أي تلاعب في الدماغ، من الضروري تقييم التعريب، والحجم، وتمديد هذا الإجراء في القشرة لتحليلها لاحقاً والتحقق من صحة البيانات التي تم الحصول عليها من الحيوان. في هذه المخطوطة، نحن بالتفصيل كيفية تعريب الاجتثاث أداؤها في القشرة استخدام خريطة تنسيق الموصوفة سابقا لدينا مجموعة18. شيد هذه الخريطة باستخدام مراجع التشريحية التي تم الحصول عليها من عمليات إعادة البناء المسلسل قسم من أقسام النسيجي، ارتباطاً بأطلس الدماغ الفئران22أوضح وواطسون. وبناء على ذلك، الخريطة يفرق بين (A1) الابتدائية والثانوية كورتيسيس (الظهرية والبطني) من لجنة التدقيق. والميزة الرئيسية لهذه الخريطة تنسيق أنه يتيح التعريب السريع للآفة بفرض صورة مأخوذة من السطح جانبية من الدماغ توضع في مصفوفة الدماغ السهمي. ميزة أخرى أن استخدام مختبرات مع خبرة أقل في تشريح الخريطة طريق تكييفه على نماذج حيوانية. أنها فقط اللازمة ضبط المسافات بين بريجما، لامدا، ومراجع 0 إينتيراورال في دماغ تحكم perfused، ومقياس الخريطة صعودا أو هبوطاً تبعاً لذلك. استخدام "الشق رهينال" كمرجع لضبط الصورة للدماغ للخريطة. لا يمكن تحديد عمق الاجتثاث في هذه الخريطة تنسيق، ولذلك فإنه ينبغي أن تحدد في أقسام نسيجية في الدماغ.
هي مزيج أساليب المناظير باستخدام الأشعة مع التعرض الجراحية للتيار المتردد الطرق الأساسية التي يمكن تطويعها بسهولة أي المحقق الذي يرغب في استهداف AC في الفئران. قد يكون هذا لتجربة حادة أو يتطلب غرس الأجهزة الدائمة. وعلاوة على ذلك، الاستئصال الجراحي للتيار المتردد سبق استخدمت كنموذج لدراسة آثار الحرمان المزمن القشرية في جلسة الاستماع. يمكن أيضا استخدام أبلاتيونس التيار المتردد لدراسة آثار الانفرادية AC أبلاتيونس تمارس في سائر المناطق القشرية، أو بمثابة نموذج للسكتة الدماغية. وهكذا، تصاميم تجريبية الموصوفة هنا هي الأساليب المفيدة التي يمكن تطبيقها بصورة فردية أو في مجموعة إلى مجموعة واسعة من تصاميم تجريبية.

الفأر واحد من النماذج الحيوانية الأكثر استخداماً في علم الأعصاب السمعية. متانة سلوكها يجعلها قادرة على العمل لمئات تجارب في اليوم الواحد. حساسية والبراعة الطيفية لاستماع1،2، وتنظيم التشريحية والوظيفية لنظامها المركزي، مماثلة ل الثدييات الأخرى3، جعل الفئران نموذجا حيوان مناسبة لتحليل طائفة واسعة من مواضيع البحث في علم الأعصاب السمعية. القشرة السمعية الفئران (AC)، على وجه الخصوص، كانت موضوع العديد من الدراسات التشريحية والفسيولوجية التي حاولت فهم هيكلها والمنظمة، ودور في معالجة الصوت3. في الوقت الحاضر، أصبح التيار المتردد شعبية كبيرة بين علماء الأعصاب المهتمة في اللدونة الاعتماد على الخبرة والإدراك السمعي، وأساس تنظيم الحقل تقبلا متشابك ومراقبة القشرية لمعالجة الصوت في سوبكورتيكال السمعية الأنوية4،5،،من67،،من89. للتصدي للتحديات التي تطرحها هذه النهج الجديدة، والإجراءات التي يمكن تحديد بدقة وفضح جراحيا AC ستعجل الجهود البحثية. تقنيات المناظير باستخدام الأشعة تجعل من السهل لتعريب مناطق محددة داخل المخ دون اختبار فسيولوجيا. على الرغم من أن حجم الدماغ يختلف قليلاً بين الحيوانات، يمكن تحديد موقع أي منطقة الدماغ استخدام المناظير باستخدام الأشعة إحداثيات مجموعة من المعالم على جمجمة الدماغ الفئران.
الاجتثاث مقيد من AC هو الاستئصال الجراحي للمنطقة الحسية من قشرة الأوثق صلة بالسمع. وعلى النقيض من الأساليب الأخرى لحظر نشاط التيار المتردد، مثل التبريد أو المحلية ليدوكائين حقن10،11،12، الاستئصال الجراحي نتائج ميلان خسائر مزمنة في الدالة. وهكذا، أبلاتيونس AC أكثر ملاءمة لدراسة آثار الحرمان القشرية في الأجل الطويل، وكذلك ظواهر اللدونة الآفة اللاحقة. مزيج أساليب المناظير باستخدام الأشعة مع أبلاتيونس الجراحية للتيار المتردد استخدمت بنجاح في دراسة الآثار الفسيولوجية والسلوكية والجزيئية لمراقبة القشرية الحرمان13،14،15 ،،من1617،،من1819. على سبيل المثال، نموذج الفئران مع الثنائية التيار المتردد أبلاتيونس قد استخدمت لدراسة آثار الاجتثاث القشرية في منعكس جفل السمع والدماغ السمعية الردود (ABR)16. في الآونة الأخيرة، وقد قارنا آثار تلك الأحادية مقابل أبلاتيونس الثنائي لإنتاج الفئران التيار المتردد في عتبات ABR والاتساع، والاختفاء في نقاط زمنية مختلفة بعد إصابة18. وبالإضافة إلى ذلك، أيضا يستخدم نموذج الفئران التقييدية AC الاجتثاث لدراسة تأثير كورتيكوفوجال مسار الانحطاط في ال14،13،كولكس أدنى15 و الإذن الداخلية17 ،19. بعد أن يتم تنفيذ مثل هذا تلاعب في الدماغ، من الضروري تقييم التعريب، والحجم، وملحق للآفات في القشرة. على الرغم من المفيد جداً، هي القيد الرئيسي لخرائط تونوتوبيك استناداً إلى استجابات الخلايا العصبية،من2021 التقنيات الكهربية المطلوبة لتحديد موقع حقول السمعية في الدماغ الفئران. إذ قد لا جميع المختبرات بالمعدات اللازمة و/أو الخبرة اللازمة لإجراء مثل هذه التسجيلات، ونحن شيدت خريطة تنسيق استناداً إلى نقل حدود سيتوارتشيتيكتورال AC إلى صورة ل سطح الدماغ18. هذه الخريطة يمكن أن تكون مفيدة جداً لتحديد موقع التيار المتردد دون اختبار فسيولوجيا.
هذا البروتوكول وصف أسلوب لموقع ستيريوتاكتيكالي الإرشادية والتعرض الجراحية، والاجتثاث من لجنة التدقيق في الفئران. كما يصف كيفية استخدام لدينا خريطة تنسيق18 لتعريب تمديد الآفة بسهولة على صورة لسطح العقول أبلاتيد.

<table><tbody><tr><td>Stereotaxic frame</td><td>David Kopf Ins.</td><td>900</td><td></td></tr><tr><td>Surgical microscope</td><td>WILD M650 Heerbrugg</td><td></td><td></td></tr><tr><td>Heating pad</td><td>DAGA</td><td></td><td></td></tr><tr><td>Dental micromotor</td><td>W&amp;amp;H elco</td><td>5118</td><td></td></tr><tr><td>Diamond burr</td><td>B Braun</td><td>GD021R</td><td>0.6 mm</td></tr><tr><td>Surgical suction device</td><td>Atmos</td><td>Atmoforte E2</td><td></td></tr><tr><td>Ketamine</td><td>Merial</td><td></td><td>30 mg/kg</td></tr><tr><td>Xylazine</td><td>Bayer</td><td></td><td>5 mg/kg</td></tr><tr><td>Micromanipulator</td><td>Narishige</td><td>SM-11</td><td></td></tr><tr><td>Scalpel</td><td>Lawton</td><td></td><td></td></tr><tr><td>Povidone iodine</td><td>Meda</td><td>Betadine</td><td></td></tr><tr><td>sterile saline serum</td><td>B.Braun</td><td></td><td></td></tr><tr><td>20G sterile needle</td><td>Terumo Neolus</td><td></td><td></td></tr><tr><td>Cotton tips</td><td></td><td></td><td></td></tr><tr><td>Suture material</td><td>B.Braun</td><td></td><td></td></tr><tr><td>Antibiotic Ointment</td><td>Quadriderm (Betametasona, Gentamicina, Clotrimazol) - Schering-Plough</td><td></td><td></td></tr><tr><td>Forceps</td><td>dimeda</td><td>10.331.12</td><td></td></tr><tr><td>Surgical needles</td><td>World Precision Instruments</td><td>501940</td><td></td></tr><tr><td>Buprenorphine</td><td>Indivior UK</td><td>Buprex</td><td>0.05 mg/kg</td></tr><tr><td>Scissor</td><td>dimeda</td><td>08.120.15</td><td></td></tr><tr><td>Spencer scissor</td><td>dimeda</td><td>08.804.14</td><td></td></tr><tr><td>Rongeurs</td><td>Lawton</td><td></td><td></td></tr><tr><td>Microsurgical knife</td><td>MSP</td><td>7503</td><td></td></tr><tr><td>Absorbable hemostatic gauze</td><td>Surgicel</td><td></td><td></td></tr><tr><td>Saggital rat Brain Matrix</td><td>Activational systems Inc.</td><td>RBM-1000DV / RBM 4000C</td><td></td></tr><tr><td>Sodium pentobarbital</td><td>Vetoquinol</td><td></td><td>60 mg/kg</td></tr><tr><td>Camera</td><td>Olympus 5.1 MP</td><td>C-5060 wide zoom</td><td>lens F2.8-4.8</td></tr><tr><td>Wound clips</td><td>Reflex 9</td><td></td><td>9 mm</td></tr><tr><td>Canvas 12</td><td>ACD Systems</td><td></td><td></td></tr><tr><td>needle gauge</td><td></td><td></td><td>diameter 1.8 mm</td></tr><tr><td>Separatory funnel</td><td>labbox</td><td>11409</td><td>500 mL</td></tr><tr><td>GluA2 primer Forward</td><td>GeneBank</td><td>NM_017261</td><td>CGGCAGCTCAGCTAAAAACT</td></tr><tr><td>GluA2 primer Reverse</td><td>GeneBank</td><td>NM_017261</td><td>TTGTAGCTGGTGGCTGTTGA</td></tr><tr><td>GluA3 primer Forward</td><td>GeneBank</td><td>NM_032990</td><td>ATTGCTGATGGTGCAATGAC</td></tr><tr><td>GluA3 primer Reverse</td><td>GeneBank</td><td>NM_032990</td><td>TTTGCATTGTCGCAAGTCTC</td></tr></tbody></table>

stereotactically-guided ablation of the rat auditory cortex, and localization of the lesion in the brain

تزداد شعبية بين علم الأعصاب السمعية المحققين الذين يرغبون في الاعتماد على خبرة اللدونة والعمليات الإدراكية السمعية القشرية تحكم الصوت المعالجة في الأنوية سمعي subcortical القشرة السمعية الفئران (AC). معالجة جديدة للتحديات، إجراء لتحديد بدقة وجراحيا القشرة السمعية فضح سيعجل هذا الجهد البحثي. جراحة المناظير باستخدام الأشعة يستخدم بشكل روتيني في البحوث السريرية قبل في نماذج حيوانية انجرافت إبرة أو قطب كهربائي في مكان محدد مسبقاً داخل القشرة السمعية. في بروتوكول التالية، ونستخدم أساليب المناظير باستخدام الأشعة بطريقة مبتكرة. نحن تحديد أربع نقاط تنسيق فوق سطح temporal bone الفئران لتحديد إطار الذي، بمجرد فتح، يكشف بدقة على حد سواء الأولية (A1) والثانوي كورتيسيس (الظهرية والبطني) يتراوح استخدام هذا الأسلوب، ونحن ثم قم العمليات الجراحية الاجتثاث AC. بعد أن يتم تنفيذ مثل هذا تلاعب، من الضروري تقييم التعريب، والحجم، وملحق للآفات في القشرة. وهكذا، نحن أيضا وصف أسلوب لتحديد بسهولة بعد الوفاة الاجتثاث AC استخدام خريطة تنسيق شيدت بنقل حدود سيتوارتشيتيكتورال AC إلى سطح الدماغ. المزيج من موقع يسترشد ستيريوتاكتيكالي والاجتثاث من التيار المتردد مع إضفاء الطابع المحلي على المنطقة المتضررة في تشريح الجثة خريطة تنسيق يسهل التحقق المعلومات التي تم الحصول عليها من الحيوان، ويؤدي إلى إجراء تحليل أفضل و فهم البيانات.

أجرينا موقع ستيريوتاكتيكالي الإرشادية والتعرض الجراحية الاجتثاث الانفرادية من AC في ثلاثة ويستار. توطين الآفة أكدت أن يقوم أبلاتيونس في الثلاثة فئران تعدت التقسيمات الفرعية الرئيسية للتيار المتردد (كورتيسيس الأولية والظهريه والبطني)، وتضم مجموعة من 80 إلى 100% من إجمالي مساحة التيار المتردد (الشكل 2).
سابقا البروتوكول الموصوفة هنا لإجراء تقييدي AC أبلاتيونس قد استخدمت في المختبر لدراسة آثار الحرمان التحكم القشرية في الأنوية سمعي subcortical في الأجل الطويل، وكذلك ظواهر اللدونة اللاحقة. في هذه الدراسات، كان التحقق من بروتوكول أبلاتيونس التيار المتردد بتطبيق الفسيولوجية (ABR)، سلوكية (باغت الردود، بريبولسي تثبيط؛ نقطة في البوصة)، والجزيئية ([ميكروارس] الحمض النووي، قبكر، ولطخة الغربية) أساليب13،14،15،16،18،،من1719. هنا، لإثبات فعالية لدينا بروتوكول، تركنا الفئران AC أبلاتيد الثلاثة البقاء على قيد الحياة لمدة أسبوع واحد، وخطوة كوكليا أثناء جمع الأنسجة التي تم جمعها لدراسة التغيرات في التعبير عن مفارز امبا الأكثر صلة بالموضوع الحالي في القوقعة الكبار ، GluA2 و GluA3، من قبكر. المقارنة بين النصوص من التيار المتردد أبلاتيد الفئران وأظهرت الشام مراقبة الحيوانات حيث تم إجراء كل عملية جراحة ولكن ليس الاجتثاث القشرية أسفل لائحة GluA2، وحتى لائحة ل GluA3 في كلا كوكليا (الشكل 3) ، الذي هو الاتفاق مع جهودنا السابقة دراسة19.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56429/56429fig1.jpg"> 
رقم 1: صور العظم الصدغي الفئران في ثلاث خطوات الجراحية المختلفة. (أ) نقل إحداثيات AC ستيريوتاكسيك للعظم الصدغي. إحداثيات النقاط الأربع: a: A/P =-5.8 مم، M/L = +/-6.4 مم؛ باء: A/P =-2.7 مم، M/L = +/-6.4 مم؛ C: A/P =-2.7 مم، M/L = +/-8.67 مم؛ دال: A/P =-5.8 مم، M/L = +/-8.67 مم. (ب) الإحداثيات وتستخدم كمرجع لرسم مستطيل على سطح العظم الصدغي التي ستوجه فتح نافذة. (ج) يظهر فتح الإطار في العظام بعد الحفر. ويمكن ملاحظة السحايا مع الأوعية الدموية على سطح الدماغ. ص: روسترال، d: الظهرية. <a href="http://ecsource.jove.com/files/ftp_upload/56429/56429fig1large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56429/56429fig2.jpg"> 
رقم 2: إجراءات لتحديد مكان وجود الآفات في الدماغ الفئران. (أ) الصورة السطحية الظهرية للدماغ التيار المتردد أبلاتيد مع الإبر ستيريوتاكتيكالي مزروع في أمداً وبريجما (وفقا Paxinos وواطسون إحداثيات19). خطوط منقطة وضع علامة على موضع بريجما وإينتيراورال 0 في شبكة 9 × 9 سم، كذلك كما هو الحال في الظهرية سطح الدماغ. (ب) صورة فوتوغرافية للسطح جانبية من الدماغ أبلاتيد فرضه على خريطة تنسيق AC. هو المسمى في محيط الآفة باللون الأحمر في الصورة. هو المسمى في محيط منطقة التيار المتردد في أسود في الخريطة. في هذا المثال، هو النسبة المئوية للاجتثاث التدقيق فيما يتعلق بالمساحة الكلية التي تحتلها AC 84.79%. التيار المتردد: القشرة السمعية، IA: جملة أورال، الأب: "شرخ رينال". <a href="http://ecsource.jove.com/files/ftp_upload/56429/56429fig2large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56429/56429fig3.jpg"> 
الشكل 3: التغيرات في مستويات مرناً لمفارز مستقبلات امبا GluA2 و GluA3 بعد الأحادية AC أبلاتيونس 7 أيام بعد انتهاء الآفة. وترد نتائج الانحراف المعياري ± يعني التغيير إضعاف. يتم تمثيل التغييرات للنصوص GluA2 باللون الأزرق. يتم عرض التغييرات بالنسبة للنصوص GluA3 باللون الأحمر. ويلاحظ انخفاض كبير في GluA2 وزيادة في GluA3 في كلا كوتشلياي (علوم-وكونترالاتيرال للاجتثاث) بالنسبة إلى عناصر تحكم الشام مع لا أبلاتيونس القشرية في 7 أيام بعد الجراحة؛ وهذا يتفق مع نتائج أعمالنا السابقة في19. <a href="http://ecsource.jove.com/files/ftp_upload/56429/56429fig3large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-</a>

Watch this Scientific Journal Video about Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain at JoVE.com

Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain

ستيريوتاكتيكالي تسترشد الاجتثاث الفئران القشرة السمعية، وتوطين الآفة في الدماغ

يصف لنا طريقة لموقع يسترشد ستيريوتاكتيكالي والتعرض، والاجتثاث من القشرة السمعية في الفئران. يتم تقييم إضفاء الطابع المحلي على الاجتثاث استخدام خريطة تنسيق تشريح الجثة.

The rat auditory cortex (AC) is becoming popular among auditory neuroscience investigators who are interested in experience-dependence plasticity, ...

stereotactically-guided-ablation-rat-auditory-cortex-localization

Research

JoVE Journal

Behavior

11.5K Views.  University of Salamanca. يصف لنا طريقة لموقع يسترشد ستيريوتاكتيكالي والتعرض، والاجتثاث من القشرة السمعية في الفئران. يتم تقييم إضفاء الطابع المحلي على الاجتثاث استخدام خريطة تنسيق تشريح الجثة.

Video: Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain

Simultaneous fMRI and Electrophysiology in the Rodent Brain

To examine the neural basis of the blood oxygenation level dependent (BOLD) magnetic resonance imaging (MRI) signal, we have developed a rodent model in which functional MRI data and in vivo intracortical recording can be performed simultaneously. The combination of MRI and electrical recording is technically challenging because the electrodes used for recording distort the MRI images and the MRI acquisition induces noise in the electrical recording. To minimize the mutual interference of the two modalities, glass microelectrodes were used rather than metal and a noise removal algorithm was implemented for the electrophysiology data. In our studies, two microelectrodes were separately implanted in bilateral primary somatosensory cortices (SI) of the rat and fixed in place. One coronal slice covering the electrode tips was selected for functional MRI. Electrode shafts and fixation positions were not included in the image slice to avoid imaging artifacts. The removed scalp was replaced with toothpaste to reduce susceptibility mismatch and prevent Gibbs ringing artifacts in the images. The artifact structure induced in the electrical recordings by the rapidly-switching magnetic fields during image acquisition was characterized by averaging all cycles of scans for each run. The noise structure during imaging was then subtracted from original recordings. The denoised time courses were then used for further analysis in combination with the fMRI data. As an example, the simultaneous acquisition was used to determine the relationship between spontaneous fMRI BOLD signals and band-limited intracortical electrical activity. Simultaneous fMRI and electrophysiological recording in the rodent will provide a platform for many exciting applications in neuroscience in addition to elucidating the relationship between the fMRI BOLD signal and neuronal activity.

We have developed a method for simultaneous functional magnetic resonance imaging and electrophysiological recording in the rodent brain, providing a platform for the investigation of the relationship between neural activity and the blood oxygenation level dependent (BOLD) MRI signal.

الرنين المغناطيسي الوظيفي في وقت واحد والكهربية في الدماغ القوارض

To examine the neural basis of the blood oxygenation level dependent (BOLD) magnetic resonance imaging (MRI) signal, we have developed a rodent model in ...

Neuroscience

A Wireless, Bidirectional Interface for In Vivo Recording and Stimulation of Neural Activity in Freely Behaving Rats

In vivo electrophysiology is a powerful technique to investigate the relationship between brain activity and behavior at a millisecond and micrometer scale. However, current methods mostly rely on tethered cable recordings or only use unidirectional systems, allowing either recording or stimulation of neural activity, but not at the same time or same target. Here, a new wireless, bidirectional device for simultaneous multichannel recording and stimulation of neural activity in freely behaving rats is described. The system operates through a single portable head stage that both transmits recorded activity and can be targeted in real-time for brain stimulation using a telemetry-based multichannel software. The head stage is equipped with a preamplifier and a rechargeable battery, allowing stable long-term recordings or stimulation for up to 1 h. Importantly, the head stage is compact, weighs 12 g (including battery) and thus has minimal impact on the animal&#180;s behavioral repertoire, making the method applicable to a broad set of behavioral tasks. Moreover, the method has the major advantage that the effect of brain stimulation on neural activity and behavior can be measured simultaneously, providing a tool to assess the causal relationships between specific brain activation patterns and behavior. This feature makes the method particularly valuable for the field of deep brain stimulation, allowing precise assessment, monitoring, and adjustment of stimulation parameters during long-term behavioral experiments. The applicability of the system has been validated using the inferior colliculus as a model structure.

A Wireless, Bidirectional Interface for In Vivo Recording and Stimulation of Neural Activity in Freely Behaving Rats

A wireless, bidirectional system for multi-channel neural recordings and stimulation in freely behaving rats is introduced. The system is light and compact, thus having minimal impact on the animal&#180;s behavioral repertoire. Moreover, this bidirectional system provides a sophisticated tool to assess causal relationships between brain activation patterns and behavior.

جهاز لاسلكي، واجهة ثنائية الاتجاه للتسجيل في فيفو وحفز النشاط العصبي في التصرف بحرية الفئران

In vivo electrophysiology is a powerful technique to investigate the relationship between brain activity and behavior at a millisecond and micrometer ...

Stereotaxic Surgery for Excitotoxic Lesion of Specific Brain Areas in the Adult Rat

Many behavioral functions in mammals, including rodents and humans, are mediated principally by discrete brain regions. A common method for discerning the function of various brain regions for behavior or other experimental outcomes is to implement a localized ablation of function. In humans, patient populations with localized brain lesions are often studied for deficits, in hopes of revealing the underlying function of the damaged area. In rodents, one can experimentally induce lesions of specific brain regions.
Lesion can be accomplished in several ways. Electrolytic lesions can cause localized damage but will damage a variety of cell types as well as traversing fibers from other brain regions that happen to be near the lesion site. Inducible genetic techniques using cell-type specific promoters may also enable site-specific targeting. These techniques are complex and not always practical depending on the target brain area. Excitotoxic lesion using stereotaxic surgery, by contrast, is one of the most reliable and practical methods of lesioning excitatory neurons without damaging local glial cells or traversing fibers.
Here, we present a protocol for stereotaxic infusion of the excitotoxin, N-methyl-D-aspartate (NMDA), into the basolateral amygdala complex. Using anatomical indications, we apply stereotaxic coordinates to determine the location of our target brain region and lower an injection needle in place just above the target. We then infuse our excitotoxin into the brain, resulting in excitotoxic death of nearby neurons. While our experimental subject of choice is a rat, the same methods can be applied to other mammals, with the appropriate adjustments in equipment and coordinates.
This method can be used on a variety of brain regions, including the basolateral amygdala1-6, other amygdala nuclei6, 7, hippocampus8, entorhinal cortex9 and prefrontal cortex10. It can also be used to infuse biological compounds such as viral vectors1, 11. The basic stereotaxic technique could also be adapted for implantation of more permanent osmotic pumps, allowing more prolonged exposure to a compound of interest.

Targeted ablation of specific brain region(s) by infusion of an excitotoxin using stereotaxic coordinates is described. This technique could also be adapted for infusion of other chemicals into the rat brain.

التجسيمي جراحة الآفات Excitotoxic من مناطق محددة في الدماغ في الجرذ الكبار

Many behavioral functions in mammals, including rodents and humans, are mediated principally by discrete brain regions. A common method for discerning the ...

Deep Brain Stimulation with Simultaneous fMRI in Rodents

In order to visualize the global and downstream neuronal responses to deep brain stimulation (DBS) at various targets, we have developed a protocol for using blood oxygen level dependent (BOLD) functional magnetic resonance imaging (fMRI) to image rodents with simultaneous DBS. DBS fMRI presents a number of technical challenges, including accuracy of electrode implantation, MR artifacts created by the electrode, choice of anesthesia and paralytic to minimize any neuronal effects while simultaneously eliminating animal motion, and maintenance of physiological parameters, deviation from which can confound the BOLD signal.&#160;Our laboratory has developed a set of procedures that are capable of overcoming most of these possible issues. For electrical stimulation, a homemade tungsten bipolar microelectrode is used, inserted stereotactically at the stimulation site in the anesthetized subject. In preparation for imaging, rodents are fixed on a plastic headpiece and transferred to the magnet bore. For sedation and paralysis during scanning, a cocktail of dexmedetomidine and pancuronium is continuously infused, along with a minimal dose of isoflurane; this preparation minimizes the BOLD ceiling effect of volatile anesthetics. In this example experiment, stimulation of the subthalamic nucleus (STN) produces BOLD responses which are observed primarily in ipsilateral cortical regions, centered in motor cortex. Simultaneous DBS and fMRI allows the unambiguous modulation of neural circuits dependent on stimulation location and stimulation parameters, and permits observation of neuronal modulations free of regional bias. This technique may be used to explore the downstream effects of modulating neural circuitry at nearly any brain region, with implications for both experimental and clinical DBS.

This protocol describes a standard method for simultaneous functional magnetic resonance imaging and deep brain stimulation in the rodent. The combined use of these experimental tools allows for the exploration of global downstream activity in response to electrical stimulation at virtually any brain target.

تحفيز الدماغ العميق مع الرنين المغناطيسي الوظيفي في وقت واحد في القوارض

In order to visualize the global and downstream neuronal responses to deep brain stimulation (DBS) at various targets, we have developed a protocol for ...

Microelectrode Guided Implantation of Electrodes into the Subthalamic Nucleus of Rats for Long-term Deep Brain Stimulation

Deep brain stimulation (DBS) is a widely used and effective therapy for several neurologic disorders, such as idiopathic Parkinson&#8217;s disease, dystonia or tremor. DBS is based on the delivery of electrical stimuli to specific deep anatomic structures of the central nervous system. However, the mechanisms underlying the effect of DBS remain enigmatic. This has led to an interest in investigating the impact of DBS in animal models, especially in rats. As DBS is a long-term therapy, research should be focused on molecular-genetic changes of neural circuits that occur several weeks after DBS. Long-term DBS in rats is challenging because the rats move around in their cage, which causes problems in keeping in place the wire leading from the head of the animal to the stimulator. Furthermore, target structures for stimulation in the rat brain are small and therefore electrodes cannot easily be placed at the required position. Thus, a set-up for long-lasting stimulation of rats using platinum/iridium electrodes with an impedance of about 1 M&#937; was developed for this study. An electrode with these specifications allows for not only adequate stimulation but also recording of deep brain structures to identify the target area for DBS. In our set-up, an electrode with a plug for the wire was embedded in dental cement with four anchoring screws secured onto the skull. The wire from the plug to the stimulator was protected by a stainless-steel spring. A swivel was connected to the circuit to prevent the wire from becoming tangled. Overall, this stimulation set-up offers a high degree of free mobility for the rat and enables the head plug, as well as the wire connection between the plug and the stimulator, to retain long-lasting strength.

A method for implanting electrodes into the subthalamic nucleus (STN) of rats is described. Better localization of the STN was achieved by using a microrecording system. Furthermore, a stimulation set-up is presented that is characterized by long-lasting connections between the head of the animal and the stimulator.

مسرى مكروي تسترشد زرع الأقطاب الكهربائية في نواة تحت المهاد الجرذان على المدى الطويل العميق تحفيز الدماغ

Deep brain stimulation (DBS) is a widely used and effective therapy for several neurologic disorders, such as idiopathic Parkinson&#8217;s disease, ...

Concurrent Recording of Co-localized Electroencephalography and Local Field Potential in Rodent

Although electroencephalography (EEG) is widely used as a non-invasive technique for recording neural activities of the brain, our understanding of the neurogenesis of EEG is still very limited. Local field potentials (LFPs) recorded via a multi-laminar microelectrode can provide a more detailed account of simultaneous neural activity across different cortical layers in the neocortex, but the technique is invasive. Combining EEG and LFP measurements in a pre-clinical model can greatly enhance understanding of the neural mechanisms involved in the generation of EEG signals, and facilitate the derivation of a more realistic and biologically accurate mathematical model of EEG. A simple procedure for acquiring concurrent and co-localized EEG and multi-laminar LFP signals in the anesthetized rodent is presented here. We also investigated whether EEG signals were significantly affected by a burr hole drilled in the skull for the insertion of a microelectrode. Our results suggest that the burr hole has a negligible impact on EEG recordings.

This protocol describes a simple method for concurrent recording of co-localized electroencephalography (EEG) and multi-laminar local field potential in an anesthetized rat. A burr hole drilled in the skull for the insertion of a microelectrode is shown to produce negligible distortion of the EEG signal.

تسجيل المتزامنة المخ يشترك المترجمة والإمكانات الميدانية المحلية في مكافحة القوارض

Although electroencephalography (EEG) is widely used as a non-invasive technique for recording neural activities of the brain, our understanding of the ...

A Micro-CT-based Method for Characterizing Lesions and Locating Electrodes in Small Animal Brains

Lesion and electrode location verification are traditionally done via histological examination of stained brain slices, a time-consuming procedure that requires manual estimation. Here, we describe a simple, straightforward method for quantifying lesions and locating electrodes in the brain that is less laborious and yields more detailed results. Whole brains are stained with osmium tetroxide, embedded in resin, and imaged with a micro-CT scanner. The scans result in 3D digital volumes of the brains with resolutions and virtual section thicknesses dependent on the sample size (12&#8211;15 and 5&#8211;6 &#181;m&#160;per voxel for rat and zebra finch brains, respectively). Surface and deep lesions can be characterized, and single tetrodes, tetrode arrays, electrolytic lesions, and silicon probes can also be localized. Free and proprietary software allows experimenters to examine the sample volume from any plane and segment the volume manually or automatically. Because this method generates whole brain volume, lesions and electrodes can be quantified to a much higher degree than in current methods, which will help standardize comparisons within and across studies.

This article describes a straightforward method to prepare small animal brains for micro-CT imaging, in which lesions can be quantified and electrodes located with high precision in the context of the whole brain.

أسلوب المستندة إلى الأشعة المقطعية الصغرى لتميز الآفات وتحديد مواقع الأقطاب في أدمغة الحيوانات الصغيرة

Lesion and electrode location verification are traditionally done via histological examination of stained brain slices, a time-consuming procedure that ...

In vivo Positron Emission Tomography to Reveal Activity Patterns Induced by Deep Brain Stimulation in Rats

Deep brain stimulation (DBS) is an invasive neurosurgical technique based on the application of electrical pulses to brain structures involved in the patient&#39;s pathophysiology. Despite the long history of DBS, its mechanism of action and appropriate protocols remain unclear, highlighting the need for research aiming to solve these enigmas. In this sense, evaluating the in vivo effects of DBS using functional imaging techniques represents a powerful strategy to determine the impact of stimulation on brain dynamics. Here, an experimental protocol for preclinical models (Wistar rats), combined with a longitudinal study [18F]-fluorodeoxyclucose positron emission tomography (FDG-PET), to assess the acute consequences of DBS on brain metabolism is described. First, animals underwent stereotactic surgery for bilateral implantation of electrodes into the prefrontal cortex. A post-surgical computerized tomography (CT) scan of each animal was acquired to verify electrode placement. After one week of recovery, a first static FDG-PET of each operated animal without stimulation (D1) was acquired, and two days later (D2), a second FDG-PET was acquired while animals were stimulated. For that, the electrodes were connected to an isolated stimulator after administering FDG to the animals. Thus, animals were stimulated during the FDG uptake period (45 min), recording the acute effects of DBS on brain metabolism. Given the exploratory nature of this study, FDG-PET images were analyzed by a voxel-wise approach based on a paired T-test between D1 and D2 studies. Overall, the combination of DBS and imaging studies allows describing the neuromodulation consequences on neural networks, ultimately helping to unravel the conundrums surrounding DBS.

In vivo Positron Emission Tomography to Reveal Activity Patterns Induced by Deep Brain Stimulation in Rats

We describe a preclinical experimental method to evaluate metabolic neuromodulation induced by acute deep brain stimulation with in vivo FDG-PET. This manuscript includes all experimental steps, from stereotaxic surgery to the application of the stimulation treatment and the acquisition, processing, and analysis of PET images.

في الجسم الحي التصوير المقطعي بالإصدار البوزيتروني للكشف عن أنماط النشاط الناجم عن التحفيز العميق للدماغ في الفئران

Deep brain stimulation (DBS) is an invasive neurosurgical technique based on the application of electrical pulses to brain structures involved in the ...

Implanting a Wireless Bidirectional Microelectrode System in a Rat Brain

Source: Melo-Thomas, L., et al., <a href="https://app.jove.com/v/56299">A Wireless, Bidirectional Interface for In Vivo Recording and Stimulation of Neural Activity in Freely Behaving Rats.</a> J. Vis. Exp. (2017)
The video demonstrates a procedure for implanting a wireless bidirectional multichannel electrode unit into a rat brain to record and stimulate multichannel neural networks.

زرع نظام قطب كهربائي دقيق لاسلكي ثنائي الاتجاه في دماغ الفئران

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. ...

JoVE Encyclopedia of Experiments

Neurophysiology

Electrophysiology Techniques

A Stereotactically Guided Ablation Technique for Auditory Cortex Removal in Rats

Source: Lamas, V., et al. <a href="https://app.jove.com/v/56429">Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain.</a>&#160;J. Vis. Exp. (2017).
This video demonstrates a stereotactically-guided surgical procedure for ablating the auditory cortex in a rat. The steps include identifying anatomical landmarks in an anesthetized rat secured in a stereotactic frame, creating a window on the skull above the auditory cortex, aspirating the cortical layers, and providing post-operative care to assess the impact of the ablation on sound processing.

Source: Lamas, V., et al. Stereotactically-guided Ablation of the Rat Auditory Cortex, and Localization of the Lesion in the Brain.&#160;J. Vis. Exp. ...

ستيريوتاكتيكالي تسترشد الاجتثاث الفئران القشرة السمعية، وتوطين الآفة في الدماغ

Summary

Explore More Videos

PLAYLIST