JAS acknowledges support from the Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, and the Duke University Department of Orthopaedics. HL was supported by the National Science Foundation (NSF) Center for Theoretical Biological Physics (NSF PHY-1427654) and NSF DMS-1361411, and as a CPRIT (Cancer Prevention and Research Institute of Texas) Scholar in Cancer Research of the State of Texas at Rice University. KEW was supported by the NIH F32 CA192630 MKJ and HL benefited from useful discussions with Mary C. Farach-Carson, J. N. Onuchic, Samir M. Hanash, Kenneth J. Pienta, and Donald S. Coffey.

1. Preparation of Reagents
<ol>
	<li>Prepare DMEM for cell culture by adding 50 mL of fetal bovine serum (FBS) and 5 mL of penicillin-streptomycin (5,000 U/mL) to 500 mL of DMEM. This medium can be stored at 4 &#176;C for up to six months.</li>
	<li>Resuspend lyophilized primers in nuclease-free water to a final concentration of 10 &#181;M. Store re-suspended primers at -20 &#176;C.</li>
	<li>Prepare radioimmunoprecipitation assay (RIPA) buffer (150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0). Supplement with protease inhibitor cocktail before use and keep buffer on ice when in use. Store at 4 &#176;C.</li>
	<li>Prepare 10 mg/mL polybrene (hexadimethrine bromide) in water and syringe filter to sterilize using a 0.45 &#181;m polyethersulfone filter. Solution can be stored at 4 &#176;C for up to six months.</li>
	<li>Prepare a 1 mg/mL working solution of nitro blue tetrazolium chloride by dissolving 10 mg in 10 mL of PBS. Store at 4 &#176;C.</li>
</ol>
2. Lentiviral Transduction of GRHL2
Day 1
<ol>
	<li>Plate 3 x 105 HEK293T cells per well of a 6-well plate in 2 mL of supplemented DMEM. Quantify cells using an automated cell counter. Cells should be 40 - 60% confluent after overnight culture at 37 &#176;C with 5% CO2.</li>
</ol>
Day 2
<ol start="2">
	<li>Dilute 2 &#181;g of empty vector (pCMV-UBC-EGFP) or 2 &#181;g of pCMV-GRHL2-UBC-EGFP24,25 in 200 &#181;L of serum-free media along with 1.8 &#181;g of p&#916;8.9 and 0.2 &#181;g of pCMV-VSV-G helper plasmids. In a separate tube, dilute 4 &#181;L of a lipid-based transfection reagent in 200 &#181;L of serum-free media per transfection (8 &#181;L in 400 &#181;L for two samples). Add 200 &#181;L of transfection reagent mixture to each plasmid solution and incubate for 20 min at room temperature.</li>
	<li>During the incubation, wash HEK293T cells by removing the medium by vacuum aspiration and rinsing cells with 1 mL of PBS. Replace the PBS with 800 &#181;L of serum-free media. After 20 min, add 200 &#181;L of transfection reagent:plasmid mixture from step 2.2 dropwise to each well and incubate cells for 2 h at 37 &#176;C in 5% CO2.</li>
	<li>Carefully remove transfection medium by vacuum aspiration and replace with 2 mL of supplemented DMEM. Return the cells to the incubator for overnight culture. 
	&#8203;NOTE: HEK293T cells are loosely adherent. Media replacement must be performed with caution to limit removal of cells from the bottom of the dish or flask.</li>
</ol>
Day 3
<ol start="5">
	<li>Refresh media on transfected HEK293T cells and plate 3 x 105 RD cells per well of a 6-well plate in 2 mL of supplemented DMEM. Culture cells overnight. RD cells are a commercially-available human rhabdomyosarcoma cell line.</li>
</ol>
Day 4
<ol start="6">
	<li>Collect viral media from HEK293T cells. Pipette the DMEM media from the HEK293T cells and place into a new 15 mL conical. Carefully replace with new DMEM media and place HEK293T cells back in the incubator for the next day.</li>
	<li>Add 2 &#181;L of 10 mg/mL polybrene per mL of viral media into two new 50 mL conical tubes (one for the empty vector transfection and another for the GRHL2 transfection). Syringe filter viral media by removing the plunger from a 3 mL syringe and attach a 0.45 &#181;m polyethersulfone filter to the tip.
	<ol>
		<li>Add the viral media collected in step 2.6 into the barrel of the syringe, and plunge media into the new 50 mL conical tubes containing polybrene. Remove media from RD cells by vacuum aspiration and add filtered viral media to RD cells.</li>
	</ol>
	</li>
</ol>
Day 5
<ol start="8">
	<li>Repeat Day 4. HEK293T cells can be discarded after the viral media has been collected.</li>
</ol>
Day 7
<ol start="9">
	<li>Wash RD cells with 1 mL of PBS and add 200 &#181;L of 0.05% trypsin per well. Incubate at 37 &#176;C for 5 min, add 2 mL of supplemented media, and move cell suspension to a new 15 mL conical. Centrifuge cells at 250 x g for 5 min at room temperature and aspirate media. Resuspend in 1 mL of DMEM (supplemented with 5% FBS and 1% penicillin-streptomycin). 
	&#8203;NOTE: Using a higher percentage of FBS may cause clogging during flow cytometry
	<ol>
		<li>Filter cells for flow cytometry. Use a pipette to apply the 1 mL RD cell suspension through a 30 &#181;m filter into flow cytometry tubes and place tubes on ice.</li>
		<li>Sort EGFP+ cells26 into 1.5 mL microcentrifuge tubes containing 0.5 mL of DMEM supplemented with 10% FBS and 1% penicillin-streptomycin and place on ice. Plate EGFP+ sorted cells in total of 1 mL of supplemented DMEM into a single well of a 12-well plate and place in the incubator for culture. 
		&#8203;NOTE: The yield of EGFP+ cells from flow cytometry after this transduction is usually low (50,000-100,000 cells). Cells may need to be cultured for 10 - 14 days before proceeding to step 3.</li>
	</ol>
	</li>
</ol>
3. Reverse Transfection of miR-200s
<ol>
	<li>Prepare 50 &#181;M stocks of miR-200 mimics using nuclease-free H2O. Aliquot stocks and store at -20 &#176;C to avoid repeated freeze/thaw cycles.</li>
	<li>Add 3 &#181;L of each 50 &#181;M miR-200 mimic (miR-200a, miR-200b, and miR-200c) to 300 &#181;L of serum-free media or 9 &#181;L of 50 &#181;M negative control miRNA to 300 &#181;L serum-free media.</li>
	<li>Add 6 &#181;L of siRNA-specific transfection reagent to 600 &#181;L of serum-free media and divide 300 &#181;L of this mixture into two tubes, one for each of the two miR mixtures from step 3.2. Combine the 300 &#181;L of each miR mixture from step 3.2 with a mix of 300 &#181;L of transfection reagent. Incubate for 20 min at room temperature.</li>
	<li>While incubating, prepare a cell suspension of 600,000 EGFP+ RD cells expressing EV or GRHL2 created in Section 2 in 2.4 mL (250 cells/&#181;L) of serum-free media per treatment.</li>
	<li>In a 24-well plate, add 100 &#181;L per well of miR-200 mix or negative control mix from step 3.3 into six wells, and then add 400 &#181;L of each cell suspension into three wells of each miR mix.</li>
	<li>Incubate cells at 37 &#176;C in 5% CO2 overnight and change media to fully supplemented DMEM the following day. Collect cells 2 days later for analysis using the appropriate buffer (see below). Time-lapse imaging of RD sarcoma cells undergoing MET is available as supplemental material. Image each well every 2 h with a 10X objective using an automated live-cell imager27.</li>
</ol>
4. RNA extraction, Reverse transcription, and qPCR
<ol>
	<li>Extract RNA according to manufacturer&#39;s instructions using a standard RNA extraction kit24. Extracted RNA can be stored at -80 &#176;C.</li>
	<li>Quantify RNA concentration. Thaw and work with RNA on ice. To quantify RNA concentrations, measure UV absorbance at 260 nm with a plate reader spectrophotometer according to the manufacturer&#39;s protocol. Dilute all samples to the lowest concentration with nuclease-free water.</li>
	<li>Perform reverse transcription of total RNA into complementary DNA (cDNA). Combine no less than 100 ng of total RNA with PCR buffer, dNTP mix (100 mM), random hexamer primers, reverse transcriptase and nuclease-free water in a 20 &#181;L reaction volume24. Run RT cycles according to the manufacture&#39;s protocol. cDNA can be stored long-term at -20 &#176;C.</li>
	<li>Dilute 20 &#181;L reactions to 100 &#181;L with 80 &#181;L of nuclease-free H2O.</li>
	<li>Mix 5 &#181;L of a fluorescence-based intercalating dye 2x qPCR master mix, 0.06 &#181;L of each 10 &#181;M primer, and 2 &#181;L of diluted RT reaction per sample.</li>
	<li>Run qPCR according to manufacturer&#39;s protocol for the fluorescence-based master mix.</li>
	<li>Quantify relative amounts of mRNA by the delta CT method and normalize to GAPDH. Plot the mean mRNA expression of biological replicates &#177; standard deviation for each treatment group. 
	NOTE: Special precautions should be taken when working with RNA to avoid contact with RNases, such as using RNase-free plastics and reagents. Non-disposable equipment should be treated before use to remove RNases.</li>
</ol>
5. Immunofluorescence Staining
<ol>
	<li>Following step 3.6, aspirate media by vacuum aspiration from RD cells in 24-well format.</li>
	<li>Fix cells by adding 500 &#181;L of 4% paraformaldehyde (PFA) per well and incubate for 15 min at room temperature (RT). Following fixation, place cells in phosphate buffered saline (PBS) and store at 4 &#176;C overnight if necessary.</li>
	<li>Permeabilize cells by adding 500 &#181;L of PBS+0.2% Triton-X100 and incubate 30 min at RT. By vacuum aspiration, remove permeabilization buffer and wash three times with PBS.</li>
	<li>Block in 500 &#181;L of 5% bovine serum albumin (BSA)/PBS and incubate cells for 30 min at RT. Cells can be stored at 4 &#176;C overnight if necessary.</li>
	<li>Prepare primary antibody dilution. Pipette 200 &#181;L of 5% BSA/PBS per well into a 15 mL conical (12 wells = 2.4 mL) and add 1 &#181;L of primary antibody per mL of 5%BSA/PBS needed. Remove blocking buffer by vacuum aspiration and dispense 200 &#181;L of diluted primary antibody to each well.
	<ol>
		<li>Incubate cells in 1:1,000 diluted primary antibodies in 5% BSA/PBS for 1 h at RT or overnight at 4 &#176;C. After incubation, wash cells two times with PBS.</li>
	</ol>
	</li>
	<li>Prepare the secondary antibody dilution in the same volume of 5% BSA/PBS as above. Add the far-red dye-conjugated secondary antibody using a 1:2,000 dilution. Additionally add 1 &#181;g/mL of Hoechst dye to the mix. Remove the PBS and add 200 &#181;L of the mix to each well.
	<ol>
		<li>Incubate at RT for 1 h in the dark. Wash 3 times with PBS, leave cells in PBS, and protect cells from light using foil. Cells can be stored at 4 &#176;C if necessary.</li>
	</ol>
	</li>
	<li>Image cells at 400X total magnification on an inverted epifluorescence microscope with excitation wavelength 594 - 650 nm.</li>
</ol>
6. Western Blotting
<ol>
	<li>Wash cells from 3.6 twice with ice-cold PBS. On ice, lyse cells with 50 &#181;L of 1x RIPA buffer supplemented with 1x protease inhibitor cocktail.</li>
	<li>Rock lysates at 4 &#176;C for 15 min, collect lysates into 1.5 mL tubes, and centrifuge at high speed (20,000 x g) for 5 min to clarify samples. Cell lysates can be stored long-term at -80 &#176;C if necessary.</li>
	<li>Quantify total protein using a Bradford assay and aliquot an equal amount of protein into new 1.5 mL microcentrifuge tubes. Bring samples to equal volume using RIPA buffer and 3x Laemmli loading buffer supplemented with 2-mercaptoethanol.</li>
	<li>Incubate samples in 1x Laemmli sample loading buffer for 5 min at 95 &#176;C and run SDS-PAGE using a 4-12% Tris-glycine gel at 200 V for 45 min. The amount of protein loaded ranges depending on the cell line. In some cases, 50-100 &#181;g of total protein is needed to detect E-cadherin in mesenchymal cell lines.</li>
	<li>Transfer proteins onto a nitrocellulose membrane for 2 h at 50 V in 1x Tris-glycine transfer buffer.</li>
	<li>Block membrane for 1 h at room temperature or overnight at 4 &#176;C in a BSA-based blocking buffer.</li>
	<li>Dilute primary antibodies at 1:1,000 concentration in 5 mL of blocking buffer, add dilution to the membrane, and incubate with gentle rocking for 1 h at room temperature or overnight at 4 &#176;C. Wash membrane 3 times in PBS with 0.05% Tween-20.</li>
	<li>Incubate membranes for 1 h at RT with infrared fluorescent-coupled secondary antibody at 1:20,000 dilution in blocking buffer as above.</li>
	<li>Wash membrane two times in PBS with 0.05% Tween-20 and then one time in PBS.</li>
	<li>Image membrane using standard infrared fluorescence detection.</li>
</ol>
7. Anchorage-independent Growth Assays
NOTE: For a detailed soft agar assay protocol, see 28.
<ol>
	<li>Warm sterile 2x DMEM media to 42 &#176;C in hot water bath. During this time, heat pre-autoclaved 1% agarose in the microwave for 3 min. Microwave for an additional 30 s at a time as needed or until completely melted. Move agarose to a 42 &#176;C water bath.</li>
	<li>Place a 50 mL conical tube in a beaker with 42 &#176;C water in a sterile hood and mix 1% agarose and 2x DMEM media in a 1:1 ratio accounting for 1.5 mL of mixture per well in a 6-well plate. Always prepare extra DMEM/agarose to account for pipetting error and to avoid bubbles.</li>
	<li>Add mixture to the sides of the well, ensuring no bubbles form and let stand for 30 min at RT.</li>
	<li>While the bottom layer is solidifying, prepare each group of RD cells transfected in step 3 by aspirating media and washing once with 1 mL PBS. Aspirate PBS and add 0.2 mL of 0.05% trypsin and incubate at 37 &#176;C for 5 min.</li>
	<li>Neutralize trypsin in 0.8 mL of media and triturate cells to form a single-cell suspension. Transfer cell suspension to a 15 mL conical tube.</li>
	<li>Count cells and calculate volume of cell suspension required for 10,000 cells per well.</li>
	<li>Heat 0.6% agarose in the microwave for 3 min followed by 30 s at a time until completely melted. Move agarose to 42 &#176;C water bath.</li>
	<li>Place a 50 mL conical tube in a beaker with 42 &#176;C water in a sterile hood. Mix 0.6% agarose and diluted cell suspension in a 1:1 ratio to prepare 1.5 mL of mixture per well in a 6-well plate. Always prepare extra cell suspension/agarose mix to account for pipetting error and to avoid bubbles. 
	&#8203;NOTE: It is important to work at 42 &#176;C here. If the temperature is too low the mixture will solidify before plating, and temperatures above 42 &#176;C will affect cell viability.</li>
	<li>Mix well by triturating cells several times and add cell mixture to the wells, ensuring no bubbles form, and let solidify for 20 min at RT.</li>
	<li>Add 2 mL of supplemented media to each well and move plates to incubator.
	<ol>
		<li>Change media once a week for 3-4 weeks or until multi-cellular colonies form. Be careful to avoid touching the agar when removing media by vacuum aspiration. Alternatively, use a P1000 to remove the top layer of liquid media.</li>
		<li>Stain soft agar plates by adding 200 &#181;L of Nitro Blue Tetrazolium chloride solution (1 mg/mL in PBS) and incubate the plate overnight at 37 &#176;C. Replace media the next day with PBS for imaging.</li>
		<li>Image wells at 40X total magnification on an inverted microscope.</li>
		<li>Perform analysis on ImageJ for colony area and number. Plot mean colony number of biological replicates &#177; standard deviation.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition,+TGF-beta,+and+osteopontin+in+wound+healing+and+tissue+remodeling+after+injury.">Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury.</a> J Burn Care Res. 33 (3), 311-318 (2012).</li><li>Galichon, P., Finianos, S., Hertig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMT-MET+in+renal+disease:+should+we+curb+our+enthusiasm.">EMT-MET in renal disease: should we curb our enthusiasm.</a> Cancer Lett. 341 (1), 24-29 (2013).</li><li>Carew, R. M., Wang, B., Kantharidis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+EMT+in+renal+fibrosis.">The role of EMT in renal fibrosis.</a> Cell Tissue Res. 347 (1), 103-116 (2012).</li><li>Willis, B. C., Borok, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta-induced+EMT:+mechanisms+and+implications+for+fibrotic+lung+disease.">TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease.</a> Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).</li><li>Ye, X., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Plasticity:+A+Central+Regulator+of+Cancer+Progression.">Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression.</a> Trends Cell Biol. 25 (11), 675-686 (2015).</li><li>Li, L., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+human+cancer:+comprehensive+reprogramming+of+metabolism,+epigenetics,+and+differentiation.">Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation.</a> Pharmacol Ther. 150, 33-46 (2015).</li><li>Tsai, J. H., Yang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+plasticity+in+carcinoma+metastasis.">Epithelial-mesenchymal plasticity in carcinoma metastasis.</a> Genes Dev. 27 (20), 2192-2206 (2013).</li><li>Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+epithelial+plasticity+in+prostate+cancer+dissemination+and+treatment+resistance.">The role of epithelial plasticity in prostate cancer dissemination and treatment resistance.</a> Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).</li><li>Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Migration+and+Invasion+Uncoupled:+Increased+Migration+Is+Not+an+Inexorable+Consequence+of+Epithelial-to-Mesenchymal+Transition.">Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition.</a> Mol Cell Biol. 34 (18), 3486-3499 (2014).</li><li>Mathow, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeb1+affects+epithelial+cell+adhesion+by+diverting+glycosphingolipid+metabolism.">Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism.</a> EMBO Rep. 16 (3), 321-331 (2015).</li><li>Ware, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mechanism+of+resistance+to+gefitinib+mediated+by+cellular+reprogramming+and+the+acquisition+of+an+FGF2-FGFR1+autocrine+growth+loop.">A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop.</a> Oncogenesis. 2, e39 (2013).</li><li>Yauch, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+versus+mesenchymal+phenotype+determines+in+vitro+sensitivity+and+predicts+clinical+activity+of+erlotinib+in+lung+cancer+patients.">Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients.</a> Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).</li><li>Jolly, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+elucidating+the+connection+between+epithelial-mesenchymal+transitions+and+stemness.">Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.</a> J R Soc Interface. 11 (101), 20140962 (2014).</li><li>Mani, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-mesenchymal+transition+generates+cells+with+properties+of+stem+cells.">The epithelial-mesenchymal transition generates cells with properties of stem cells.</a> Cell. 133 (4), 704-715 (2008).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metastasis+is+regulated+via+microRNA-200/ZEB1+axis+control+of+tumour+cell+PD-L1+expression+and+intratumoral+immunosuppression.">Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.</a> Nat Commun. 5, 5241 (2014).</li><li>Nicolazzo, C., Gradilone, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+circulating+tumor+cells+in+soft+tissue+sarcoma.">Significance of circulating tumor cells in soft tissue sarcoma.</a> Anal Cell Pathol (Amst). , 697395 (2015).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-epithelial+transition+in+sarcomas+is+controlled+by+the+combinatorial+expression+of+miR-200s+and+GRHL2.">Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2.</a> Mol Cell Biol. , (2016).</li><li>Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Transition+Phenotype+Is+Associated+with+Clinicopathological+Factors+That+Indicate+Aggressive+Biological+Behavior+and+Poor+Clinical+Outcomes+in+Invasive+Breast+Cancer.">Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer.</a> J Breast Cancer. 18 (3), 256-263 (2015).</li><li>Humphries, B., Yang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microRNA-200+family:+small+molecules+with+novel+roles+in+cancer+development,+progression+and+therapy.">The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy.</a> Oncotarget. 6 (9), 6472-6498 (2015).</li><li>Renner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling+of+primary+high-grade+soft+tissue+sarcomas.">MicroRNA profiling of primary high-grade soft tissue sarcomas.</a> Genes Chromosomes Cancer. 51 (11), 982-996 (2012).</li><li>Petrof, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+GRHL2+result+in+an+autosomal-recessive+ectodermal+Dysplasia+syndrome.">Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome.</a> Am J Hum Genet. 95 (3), 308-314 (2014).</li><li>Werner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+the+transcription+factor+grainyhead-like+2+(GRHL2)+in+breast+cancer.">Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer.</a> J Biol Chem. 288 (32), 22993-23008 (2013).</li><li>Werth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factor+grainyhead-like+2+regulates+the+molecular+composition+of+the+epithelial+apical+junctional+complex.">The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex.</a> Development. 137 (22), 3835-3845 (2010).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-Epithelial+Transition+in+Sarcomas+Is+Controlled+by+the+Combinatorial+Expression+of+MicroRNA+200s+and+GRHL2.">Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2.</a> Mol Cell Biol. 36 (19), 2503-2513 (2016).</li><li>Varma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+Grainyhead-like+2+and+NK2-homeobox+1+form+a+regulatory+loop+that+coordinates+lung+epithelial+cell+morphogenesis+and+differentiation.">The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation.</a> J Biol Chem. 287 (44), 37282-37295 (2012).</li><li>Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+fluorescent+protein+expressing+cells+by+flow+cytometry.">Analysis of fluorescent protein expressing cells by flow cytometry.</a> Methods Mol Biol. 263, 239-258 (2004).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-content+morphological+screen+identifies+novel+microRNAs+that+regulate+neuroblastoma+cell+differentiation.">A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation.</a> Oncotarget. 5 (9), 2499-2512 (2014).</li><li>Borowicz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+soft+agar+colony+formation+assay.">The soft agar colony formation assay.</a> J Vis Exp. (92), e51998 (2014).</li><li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+proteomics+and+genomics+analysis+reveals+a+novel+mesenchymal+to+epithelial+reverting+transition+in+leiomyosarcoma+through+regulation+of+slug.">Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug.</a> Mol Cell Proteomics. 9 (11), 2405-2413 (2010).</li><li>Alba-Castellon, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snail1+expression+is+required+for+sarcomagenesis.">Snail1 expression is required for sarcomagenesis.</a> Neoplasia. 16 (5), 413-421 (2014).</li><li>Takaishi, M., Tarutani, M., Takeda, J., Sano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+to+Epithelial+Transition+Induced+by+Reprogramming+Factors+Attenuates+the+Malignancy+of+Cancer+Cells.">Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells.</a> PLoS One. 11 (6), e0156904 (2016).</li></ol>

The authors have nothing to disclose.

Sarcomas are rare, but highly aggressive cancers of a mesenchymal lineage. Despite their mesenchymal lineage, a subset of sarcomas appears to undergo a phenotypic transition to a more epithelial-like state. This MET-like switch has prognostic relevance, as patients with more epithelial-like tumors are less aggressive24. Despite their clinical relevance, there are few studies addressing the molecular mechanisms driving these phenotypic transitions in sarcomas.
To examine...

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.
One of the authors&#39; names was corrected from:
Shenghan Xu
to:
Shengnan Xu

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.

Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Phenotypic plasticity refers to a reversible transition between cellular phenotypes, and is commonly divided into two types, epithelial-to-mesenchymal (EMT) transitions and mesenchymal-to-epithelial transitions (MET). This phenotypic plasticity plays an important role in normal processes of multicellular organisms, such as development and wound healing1; however, these same pathways and gene expression programs can also lead to disease, such as fibrosis (reviewed in2,3,4) and carcinoma metastasis (reviewed in references5,6,7,8). During metastasis, for example, EMT disrupts cell polarity, cell-cell interactions, and promotes invasion9,10. Together, EMT contributes to a phenotypic state that facilitates cancer cell dissemination. In addition, EMT also leads to a host of other phenotypic alterations that drive an aggressive phenotype, including deregulation of cancer cell metabolism6, development of drug resistance11,12, increased tumor-initiation ability13,14 and host immune evasion15.
Phenotypic plasticity has been well studied in carcinoma progression; however, sarcomas also exhibit phenotypic plasticity. Interestingly, it appears as if some of the same drivers of phenotypic plasticity in carcinomas also contribute to sarcoma plasticity and aggressiveness. For instance, circulating tumor cells (CTCs) from sarcoma patients have been shown to express EpCAM, a cell surface protein that is typically found on epithelial cells16. Additionally, 250 soft tissue sarcoma samples were categorized as epithelial-like or mesenchymal-like based on gene expression. Patients in the epithelial-like biomarker signature had a better prognosis than patients with the mesenchymal-like biomarker signature17. This is consistent with many carcinomas, in which patients with more epithelial-like carcinomas have better outcomes compared with patients with more mesenchymal-like tumors18.
While some sarcomas display biomarkers and gene expression pathways consistent with MET, the molecular underpinnings of this phenotypic plasticity remain poorly understood. To study the mechanisms and drivers of MET in sarcoma we developed a model of MET induction using two epithelial-specific factors, the microRNA (miR)-200 family and grainyhead-like 2 (GRHL2). The miR-200s are a family of small non-coding RNAs that regulate gene expression by binding to the 3&#39; UTRs of messenger RNA and preventing translation into protein. The miR-200 family consists of two subgroups - one containing miR-141 and miR-200a, and the other including&#160;miR-200b, miR-200c, and miR-429. Members of the miR-200 family are enriched in epithelial tissues, and the loss of miR-200s is associated with metastasis in carcinomas19. The miR-200 family is also downregulated in soft tissue sarcomas compared to normal tissue20. Similar to the miR-200s, GRHL2 is a key regulator that is important for epithelial development21. The GRHL2 transcription factor acts in two ways to upregulate epithelial genes, such as E-cadherin: 1) In epithelial cells, GRHL2 directly represses the EMT master regulator, ZEB122; and 2) GRHL2 directly activates transcription of epithelial genes23. Our previous investigations have shown that combined expression of miR-200s and GRHL2 in sarcoma cells induces an MET-like phenotype24. Here, we present a detailed protocol to create an in vitro model of MET induction in sarcoma cells using ectopic expression of miR-200s and GRHL2.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Countess automated counter</td>
			<td>Life technologies</td>
			<td>AMQAX1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Countess cell counting chamber slides</td>
			<td>Invitrogen</td>
			<td>C10283</td>
			<td></td>
		</tr>
		<tr>
			<td>SimpliAmp Thermal Cycler</td>
			<td>Thermo Fisher</td>
			<td>A24811</td>
			<td></td>
		</tr>
		<tr>
			<td>Odyssey Fc</td>
			<td>LI-COR Inc</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ViiA7 Real Time PCR System</td>
			<td>Thermo Fisher</td>
			<td>4453536</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR microplate</td>
			<td>Corning</td>
			<td>321-29-051</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA SYBR Fast Universal qPCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK4602</td>
			<td></td>
		</tr>
		<tr>
			<td>Starting Block (PBS) Blocking Buffer</td>
			<td>Thermo Fisher</td>
			<td>37538</td>
			<td>BSA-based blocking buffer</td>
		</tr>
		<tr>
			<td>Agarose General Purpose LE</td>
			<td>Genesee Scientific</td>
			<td>20-102</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Tris/Glycine/SDS Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0732</td>
			<td>Running buffer</td>
		</tr>
		<tr>
			<td>10X Tris/Glycine Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0734</td>
			<td>Transfer buffer</td>
		</tr>
		<tr>
			<td>RIPA Buffer</td>
			<td>Sigma Life Sciences</td>
			<td>SLBG8489</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham Protran 0.45 &#956;m nitrocellulose</td>
			<td>GE Healthcare Lifesciences</td>
			<td>10600012</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-RNA MiniPrep Kit</td>
			<td>Genesee Scientific</td>
			<td>11-358</td>
			<td></td>
		</tr>
		<tr>
			<td>Laemmli Sample Buffer (4X)</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1610747</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Trans-Blot Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1703930</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Tetra Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1658005EDU</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Life technologies</td>
			<td>14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAi Max</td>
			<td>Thermo Fisher</td>
			<td>13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine 2000 Ragents</td>
			<td>Thermo Fisher</td>
			<td>11668019</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin Streptomycin</td>
			<td>Life technologies</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>miRVana miRNA mimic negative control #1</td>
			<td>Thermo Fisher</td>
			<td>4464058</td>
			<td>neg miRNA</td>
		</tr>
		<tr>
			<td>hsa-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4464066</td>
			<td>miR200A</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200B</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200C</td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Life technologies</td>
			<td>11088-021</td>
			<td>serum-free media</td>
		</tr>
		<tr>
			<td>anti-Ecadherin antibody</td>
			<td>BD Bioscience</td>
			<td>610182</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-beta actin</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-69879</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-EpCam</td>
			<td>Ab Serotec</td>
			<td>MCA18706</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-ZO1</td>
			<td>Invitrogen</td>
			<td>402200</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800W</td>
			<td>LI-COR Inc</td>
			<td>925-32210</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680</td>
			<td>LI-COR Inc</td>
			<td>926-32223</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-mouse AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>A211241</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-rabbit AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>ab150075</td>
			<td></td>
		</tr>
		<tr>
			<td>Halt Protease and Phosphatesse Inhibitor</td>
			<td>Thermo Fisher</td>
			<td>1861281</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>Partec CellTrics</td>
			<td>Sysmex</td>
			<td>04-004-2326</td>
			<td>30 &#956;m filter for flow</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td>IDT</td>
			<td></td>
			<td>AGCCACATCGCTCAGACAC</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td>IDT</td>
			<td></td>
			<td>GCCCAATACGACCAAATCC</td>
		</tr>
		<tr>
			<td>Ecadherin-F</td>
			<td>IDT</td>
			<td></td>
			<td>TGGAGGAATTCTTGCTTTGC</td>
		</tr>
		<tr>
			<td>Ecadherin-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGCTCTCCTCCGAAGAAAC</td>
		</tr>
		<tr>
			<td>ZEB1-F</td>
			<td>IDT</td>
			<td></td>
			<td>GCATACAGAACCCAACTTGAACGTC</td>
		</tr>
		<tr>
			<td>ZEB1-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGATTACACCCAGACTGC</td>
		</tr>
		<tr>
			<td>NOTCH-F</td>
			<td>IDT</td>
			<td></td>
			<td>GGCAATCCGAGGACTATGAG</td>
		</tr>
		<tr>
			<td>NOTCH-R</td>
			<td>IDT</td>
			<td></td>
			<td>CTCAGAACGCACTCGTTGAT</td>
		</tr>
		<tr>
			<td>nitro blue tetrazolium&#160;</td>
			<td>Sigma</td>
			<td>N5514</td>
			<td></td>
		</tr>
		<tr>
			<td>hexadimethrine bromide</td>
			<td>Sigma</td>
			<td>H9268</td>
			<td>polybrene</td>
		</tr>
		<tr>
			<td>3 mL syringe</td>
			<td>BD Bioscience</td>
			<td>309657</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile syringe filter</td>
			<td>VWR</td>
			<td>28145-505</td>
			<td></td>
		</tr>
		<tr>
			<td>5mL polypropylene round-bottom tube</td>
			<td>352063</td>
			<td></td>
			<td>flow cytometry tubes</td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher</td>
			<td>4368814</td>
			<td>reverse transcription kit</td>
		</tr>
		<tr>
			<td>4% paraformaldyhyde</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-281612</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Sigma</td>
			<td>93443</td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A7906</td>
			<td></td>
		</tr>
	</tbody>
</table>

induction of mesenchymal-epithelial transitions in sarcoma cells

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic plasticity drives invasion, dissemination and metastasis. Indeed, while most of the studies of phenotypic plasticity have been in the context of epithelial-derived carcinomas, it turns out sarcomas, which are mesenchymal in origin, also exhibit phenotypic plasticity, with a subset of sarcomas undergoing a phenomenon that resembles a mesenchymal-epithelial transition (MET). Here, we developed a method comprising the miR-200 family and grainyhead-like 2 (GRHL2) to mimic this MET-like phenomenon observed in sarcoma patient samples.We sequentially express GRHL2 and the miR-200 family using cell transduction and transfection, respectively, to better understand the molecular underpinnings of these phenotypic transitions in sarcoma cells. Sarcoma cells expressing miR-200s and GRHL2 demonstrated enhanced epithelial characteristics in cell morphology and alteration of epithelial and mesenchymal biomarkers. Future studies using these methods can be used to better understand the phenotypic consequences of MET-like processes on sarcoma cells, such as migration, invasion, metastatic propensity, and therapy resistance.

Schema for MET induction in sarcoma cells
A general timeline for the induction of MET-like changes in sarcoma cells is shown in Figure 1. The protocol begins by transducing GRHL2 (Figure 1A), followed by transfection of the miR-200 family (Figure 1B). GRHL2 or miR-200 family members were not able to impact the appearance of RD cells when expressed alone, but ectopic expression of G...

Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

We present here a cell culture method for inducing mesenchymal-epithelial transitions (MET) in sarcoma cells based on combined ectopic expression of microRNA-200 family members and grainyhead-like 2 (GRHL2). This method is suitable for better understanding the biological impact of phenotypic plasticity on cancer aggressiveness and treatments.

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic ...

induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells

Research

JoVE Journal

Developmental Biology

9.3K Views.  Duke University. We present here a cell culture method for inducing mesenchymal-epithelial transitions (MET) in sarcoma cells based on combined ectopic expression of microRNA-200 family members and grainyhead-like 2 (GRHL2). This method is suitable for better understanding the biological impact of phenotypic plasticity on cancer aggressiveness and treatments.

Video: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Direct Induction of Human Neural Stem Cells from Peripheral Blood Hematopoietic Progenitor Cells

Human disease specific neuronal cultures are essential for generating in vitro models for human neurological diseases. However, the lack of access to primary human adult neural cultures raises unique challenges. Recent developments in induced pluripotent stem cells (iPSC) provides an alternative approach to derive neural cultures from skin fibroblasts through patient specific iPSC, but this process is labor intensive, requires special expertise and large amounts of resources, and can take several months. This prevents the wide application of this technology to the study of neurological diseases. To overcome some of these issues, we have developed a method to derive neural stem cells directly from human adult peripheral blood, bypassing the iPSC derivation process. Hematopoietic progenitor cells enriched from human adult peripheral blood were cultured in vitro and transfected with Sendai virus vectors containing transcriptional factors Sox2, Oct3/4, Klf4, and c-Myc. The transfection results in morphological changes in the cells which are further selected by using human neural progenitor medium containing basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF). The resulting cells are characterized by the expression for neural stem cell markers, such as nestin and SOX2. These neural stem cells could be further differentiated to neurons, astroglia and oligodendrocytes in specified differentiation media. Using easily accessible human peripheral blood samples, this method could be used to derive neural stem cells for further differentiation to neural cells for in vitro modeling of neurological disorders and may advance studies related to the pathogenesis and treatment of those diseases.

A method was developed to directly derive human neural stem cells from hematopoietic progenitor cells enriched from peripheral blood cells.

Human disease specific neuronal cultures are essential for generating in vitro models for human neurological diseases. However, the lack of access to ...

Direct Induction of Hemogenic Endothelium and Blood by Overexpression of Transcription Factors in Human Pluripotent Stem Cells

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro is essential for mechanistic studies of the endothelial-hematopoietic transition and hematopoietic specification. Here, we describe a method for the efficient induction of HE from human pluripotent stem cells (hPSCs) by way of overexpression of different sets of transcription factors. The combination of ETV2 and GATA1 or GATA2 TFs is used to induce HE with pan-myeloid potential, while a combination of GATA2 and TAL1 transcription factors allows for the production of HE with erythroid and megakaryocytic potential. The addition of LMO2 to GATA2 and TAL1 combination substantially accelerates differentiation and increases erythroid and megakaryocytic cells production. This method provides an efficient and rapid means of HE induction from hPSCs and allows for the observation of the endothelial-hematopoietic transition in a culture dish. The protocol includes hPSCs transduction procedures and post-transduction analysis of HE and blood progenitors.

This protocol describes the efficient induction of hemogenic endothelium and multipotential hematopoietic progenitors from human pluripotent stem cells via the forced expression of transcription factors.

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro ...

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes differentiated from stem cells using cytokines. Unfortunately, cytokine-induced chondrogenic differentiation is costly, time-consuming, and associated with a high risk of contamination during in vitro differentiation. However, biomechanical stimuli also serve as crucial regulatory factors for chondrogenesis. For example, mechanical stress can induce chondrogenic differentiation of stem cells, suggesting a potential therapeutic approach for the repair of impaired cartilage. In this study, we demonstrated that centrifugal gravity (CG, 2,400 &#215; g), a mechanical stress easily applied by centrifugation, induced the upregulation of sex determining region Y (SRY)-box 9 (SOX9) in adipose-derived stem cells (ASCs), causing them to express chondrogenic phenotypes. The centrifuged ASCs expressed higher levels of chondrogenic differentiation markers, such as aggrecan (ACAN), collagen type 2 alpha 1 (COL2A1), and collagen type 1 (COL1), but lower levels of collagen type 10 (COL10), a marker of hypertrophic chondrocytes. In addition, chondrogenic aggregate formation, a prerequisite for chondrogenesis, was observed in centrifuged ASCs.

Mechanical stress can induce the chondrogenic differentiation of stem cells, providing a potential therapeutic approach for the repair of impaired cartilage. We present a protocol to induce the chondrogenic differentiation of adipose-derived stem cells (ASCs) using centrifugal gravity (CG). CG-induced upregulation of SOX9 results in the development of chondrogenic phenotypes.

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem cells (hPSCs). Until recently, efforts to differentiate hPSCs into HSCs have predominantly generated hematopoietic progenitors that lack HSC potential, and instead resemble yolk sac hematopoiesis.&#160;These resulting hematopoietic progenitors may have limited utility for in vitro disease modeling of various adult hematopoietic disorders, particularly those of the lymphoid lineages. However, we have recently described methods to generate erythro-myelo-lymphoid multilineage definitive hematopoietic progenitors from hPSCs using a stage-specific directed differentiation protocol, which we outline here. Through enzymatic dissociation of hPSCs on basement membrane matrix-coated plasticware, embryoid bodies (EBs) are formed. EBs are differentiated to mesoderm by recombinant BMP4, which is subsequently specified to the definitive hematopoietic program by the GSK3&#946; inhibitor, CHIR99021. Alternatively, primitive hematopoiesis is specified by the PORCN inhibitor, IWP2. Hematopoiesis is further driven through the addition of recombinant VEGF and supportive hematopoietic cytokines. The resulting hematopoietic progenitors generated using this method have the potential to be used for disease and developmental modeling, in vitro.

Here, we present human pluripotent stem cell (hPSC) culture protocols, used to differentiate hPSCs into CD34+ hematopoietic progenitors. This method uses stage-specific manipulation of canonical WNT signaling to specify cells exclusively to either the definitive or primitive hematopoietic program.

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and zebrafish embryos. Our system comprises a chamber featuring a simple setup that is nevertheless robust to induce and maintain a specific oxygen concentration and temperature in any experimental solution of choice. The presented system is very cost-effective but highly functional, it allows induction and sustainment of hypoxia for direct experiments in vivo and for various time periods up to 48 h.
To monitor and study the effects of hypoxia, we have employed two methods - measurement of levels of hypoxia-inducible factor 1alpha (HIF-1&#945;) in whole embryos or specific tissues and determination of retinal stem cell proliferation by 5-ethynyl-2&#8242;-deoxyuridine (EdU) incorporation into the DNA. HIF-1&#945; levels can serve as a general hypoxia marker in the whole embryo or tissue of choice, here embryonic retina. EdU incorporation into the proliferating cells of embryonic retina is a specific output of hypoxia induction. Thus, we have shown that hypoxic embryonic retinal progenitors decrease proliferation within 1 h of incubation under 5% oxygen of both frog and zebrafish embryos.
Once mastered, our setup can be employed for use with small aquatic model organisms, for direct in vivo experiments, any given time period and under normal, hypoxic or hyperoxic oxygen concentration or under any other given gas mixture.

We introduce a novel hypoxic chamber system for use with aquatic organisms such as frog and zebrafish embryos. Our system is simple, robust, cost-effective and allows the induction and sustainment of hypoxia in vivo and for up to 48 h. We present 2 reproducible methods to monitor the effectiveness of hypoxia.

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality microscopic images is not entirely dependent upon the quality of the microscope, but also upon the methods of tissue processing, which often involve multiple critical actions or steps. Furthermore, mesenchymal cell types in the skin and other tissues represent a new challenge for tissue preparation and imaging. Here, we present a complete process, from tissue harvest to microscopy. Our technique, called &#34;horizontal whole mount,&#34; is one that novices can quickly become proficient in and that allows for antigen preservation and detection in 60-300 &#181;m-thick sections cut with a cryostat. Sections of this thickness provide enhanced visualization of tissue microarchitecture in a three-dimensional environment. In addition, the protocol preserves mesenchymal cells in a manner that enhances image quality when compared to standard cryostat or paraffin sections, thereby increasing the efficacy and reliability of immunostaining. We believe that this protocol will benefit all laboratories that visualize skin, and possibly other tissues and organs.

This work presents a novel processing and imaging protocol for thick, three-dimensional tissue cross-section analysis that enables the full exploitation of confocal imaging modalities. This protocol preserves antigenicity and represents a robust system to analyze skin histology and potentially other tissue types.

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Single-cell Photoconversion in Living Intact Zebrafish

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause disease when disrupted. Scientists have developed clever techniques to investigate characteristics and natural dynamics of these cells within intact tissue by expressing fluorescent proteins in subsets of cells. However, at times, experiments require more selected visualization of cells within the tissue, sometimes at the single-cell or population-of-cells manner. To achieve this and visualize single cells within a population of cells, scientists have utilized single-cell photoconversion of fluorescent proteins. To demonstrate this technique, we show here how to direct UV light to an Eos-expressing cell of interest in an intact, living zebrafish. We then image those photoconverted Eos+ cells 24 h later to determine how they changed in the tissue. We describe two techniques: single cell photoconversion and photoconversions of populations of cell. These techniques can be used to visualize cell-cell interactions, cell-fate and differentiation, and cell migrations, making it a technique that is applicable in numerous biological questions.

Here, we present a protocol to show how cell photoconversion is achieved through UV exposure to specific areas expressing the fluorescent protein, Eos, in living animals.

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

We present an automated method for three-dimensional reconstruction of the Caenorhabditis elegans germline. Our method determines the number and position of each nucleus within the germline and analyses germline protein distribution and cytoskeletal structure.

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Induction and Validation of Cellular Senescence in Primary Human Cells

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a hallmark of various pathophysiological conditions including tumor suppression, tissue remodeling and aging. The inducers of cellular senescence in vivo are still poorly characterized. However, a number of stimuli can be used to promote cellular senescence ex vivo. Among them, most common senescence-inducers are replicative exhaustion, ionizing and non-ionizing radiation, genotoxic drugs, oxidative stress, and demethylating and acetylating agents. Here, we will provide detailed instructions on how to use these stimuli to induce fibroblasts into senescence. This protocol can easily be adapted for different types of primary cells and cell lines, including cancer cells. We also describe different methods for the validation of senescence induction. In particular, we focus on measuring the activity of the lysosomal enzyme Senescence-Associated &#946;-galactosidase (SA-&#946;-gal), the rate of DNA synthesis using 5-ethynyl-2&#39;-deoxyuridine (EdU) incorporation assay, the levels of expression of the cell cycle inhibitors p16 and p21, and the expression and secretion of members of the Senescence-Associated Secretory Phenotype (SASP). Finally, we provide example results and discuss further applications of these protocols.

Here, we discuss a series of protocols for induction and validation of cellular senescence in cultured cells. We focus on different senescence-inducing stimuli and describe the quantification of common senescence-associated markers. We provide technical details using fibroblasts as a model, but the protocols can be adapted to various cellular models.

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a ...

Induction of Endothelial Differentiation in Cardiac Progenitor Cells Under Low Serum Conditions

Cardiac progenitor cells (CPCs) may have therapeutic potential for cardiac regeneration after injury. In the adult mammalian heart, intrinsic CPCs are extremely scarce, but expanded CPCs could be useful for cell therapy. A prerequisite for their use is their ability to differentiate in a controlled manner into the various cardiac lineages using defined and efficient protocols. In addition, upon in vitro expansion, CPCs isolated from patients or preclinical disease models may offer fruitful research tools for the investigation of disease mechanisms.
Current studies use different markers to identify CPCs. However, not all of them are expressed in humans, which limits the translational impact of some preclinical studies. Differentiation protocols that are applicable irrespective of the isolation technique and marker expression will allow for the standardized expansion and priming of CPCs for cell therapy purpose. Here we describe that the priming of CPCs under a low fetal bovine serum (FBS) concentration and low cell density conditions facilitates the endothelial differentiation of CPCs. Using two different subpopulations of mouse and rat CPCs, we show that laminin is a more suitable substrate than fibronectin for this purpose under the following protocol: after culturing for 2 - 3 days in medium including supplements that maintain multipotency and with 3.5% FBS, CPCs are seeded on laminin at &#60;60% confluence and cultured in supplement-free medium with low concentrations of FBS (0.1%) for 20 - 24 hours before differentiation in endothelial differentiation medium. Because CPCs are a heterogeneous population, serum concentrations and incubation times may need to be adjusted depending on the properties of the respective CPC subpopulation. Considering this, the technique can be applied to other types of CPCs as well and provides a useful method to investigate the potential and mechanisms of differentiation and how they are affected by disease when using CPCs isolated from respective disease models.

This protocol describes an endothelial differentiation technique for cardiac progenitor cells. It particularly focuses on how serum concentration and cell-seeding density affect the endothelial differentiation potential.

Cardiac progenitor cells (CPCs) may have therapeutic potential for cardiac regeneration after injury. In the adult mammalian heart, intrinsic CPCs are ...