This work was partially supported by the Engineering and Physical Sciences Research Council (EPSRC, Swindon, United Kingdom) and the European Commission FP-7 Programs NANONEUROHOP (PIEF-GA-2010-276051) and ANTICARB (HEALTH-2008-20157). AY was supported by a full-time PhD scholarship from the Ministry of Education (Turkey) and IL acknowledges partial support from the British Council and the CAIXA Foundation (Spain). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

1. In vivo Reprogramming of Liver Tissue by HTV Administration of pDNA
<ol>
	<li>Allow female Balb/C mice, 6 weeks old, to acclimatize to the animal facility for a week before any procedure is performed.</li>
	<li>Prepare 0.9% saline in distilled water and filter through 0.22 &#956;m microfilter.</li>
	<li>Prepare a solution with 75 &#956;g pCX-OKS-2A and 75 &#956;g of pCX-cMyc plasmid DNA in 1.5 ml 0.9% saline per mouse. Note: Total injection volume must be between 8-10% of the total body weight. 
	Note: prior to the injection, keep the mice in a heating chamber at 37 &#176;C until the tail veins can be easily visualized and appear dilated.</li>
	<li>Induce anesthesia with isoflurane before (in the heating chamber) and during the injection (with an anesthetic mask).</li>
	<li>Administer the pDNA solution or saline control with a 27 G syringe by HTV injection. Note: for the transfection to be successful, the total volume should be injected in no more than 5-7 sec.</li>
	<li>Monitor that the animals recover properly from the injection.</li>
</ol>
2. Liver perfusion and Isolation of Primary Hepactocytes for qRT-PCR Studies
<ol>
	<li>At different time points including 2, 4, 8, 12, and 24 days after HTV injection, induce deep anesthesia with isoflurane.</li>
	<li>Spray 70% ethanol on the animal&#39;s abdomen, make an incision through the skin on the ventral midline with surgical scissors and dissect away the abdominal muscle layer to expose the viscera.</li>
	<li>Cut the diaphragm to expose the thoracic cavity with scissors and clamp the cava vein with locking forceps.</li>
	<li>Displace the viscera to the right and the liver lobes so that both the inferior cava and the portal vein are easily accessible.</li>
	<li>Cannulate the inferior cava vein with a 22 G catheter and cut the portal vein to avoid excess of pressure.</li>
	<li>Start the perfusion with 10 ml of HBSS buffer (Ca2+ and Mg2+ free, with bicarbonate), prewarmed at 37 &#176;C. Perfuse the buffer slowly with a 10 ml syringe, until the liver whitens (3 min).</li>
	<li>Continue the perfusion with Liver Digest Medium, prewarmed at 37 &#176;C, at a flow rate of 0.6 ml/min (for 15 min) until the liver becomes swollen and loose. Note: Excessive digestion and perfusion can damage hepatocytes or reprogrammed cells.</li>
	<li>Continue the experiment at 4 &#176;C.</li>
	<li>Remove the liver by forceps after cutting the falciform and coronary ligaments and wash it with Hepatocyte Wash Medium, while passing it through a 100 &#956;m cell strainer to obtain a cell suspension.</li>
	<li>Collect the cell suspension in 50 ml tubes and adjust the volume to 15 ml with Hepatocyte Wash Medium.</li>
	<li>Centrifuge the cell suspension at 50 g for 4 min. Keep the temperature at 4 &#176;C. Discard the supernatant (which contains Kupffer and epithelial cells) and resuspend the cell pellet (containing the hepatocytes) in 10 ml of Hepatocyte Wash Medium. Note: The cell pellet should be resuspended very carefully, hepatocytes are very fragile cells.</li>
	<li>Repeat the centrifugation procedure for a total of three times and resuspend the final pellet in 10 ml of Hepatocyte Wash Medium.</li>
	<li>Estimate the cell number using an optical microscope and a hemocytometer.</li>
	<li>Prepare aliquots of 2 x 106 cells, centrifuge at 300 x g to recover all the cells and discard the supernatant.</li>
	<li>At this point, the cell pellet can be frozen and kept at -20 &#176;C until further processing or used straight away for the RNA extraction.</li>
</ol>
3. Gene Expression Study of Isolated Hepatocytes for Upregulation of Pluripotent Genes
<ol>
	<li>Extract RNA from 2 x 106 cells with a spin column kit following the instructions of the supplier.</li>
	<li>Use 1 &#956;g of the extracted RNA to perform two-step qRT-PCR following the instructions of the supplier.</li>
	<li>Use the hepatocytes of the saline-injected animals as a control to correct the relative gene expression of reprogramming, pluripotency, and hepatocyte markers.</li>
</ol>
4. Flow Cytometry Analysis of Enhanced Pluripotency at the Protein Level
<ol>
	<li>On days 1 and 4 after injection, perform liver perfusion and isolate primary hepatocytes as indicated above.</li>
	<li>Adjust cell density to 1 x 107 cells/ml and prepare 100 &#956;l aliquots.</li>
	<li>Fix the cells with BD Cytofix fixation buffer and permeabilize with 1x BD Perm/Wash buffer.</li>
	<li>Incubate the cells with either anti-mouse OCT4-PerCP-Cy5.5 or anti-mouse Nanog-PE for 30 min.</li>
	<li>Include negative and isotype controls.</li>
	<li>Analyze the stained cells by CyAn ADP High Performance Research Flow Cytometer.</li>
</ol>
5. Immunostaining of Liver Sections for Markers of Pluripotency
<ol>
	<li>Four days after injection, perfuse the liver as indicated above but only with HBSS buffer in order to remove the blood from the liver tissue.</li>
	<li>Cut a piece of liver tissue and immerse it in 2-methylbutane (precooled in liquid nitrogen) in order to continue with cryosectioning.</li>
	<li>Frozen tissues may be kept at -80 &#176;C or directly cut in 14 &#956;m thick sections using a cryostat.</li>
	<li>Air-dry the tissue sections for 1 hr at room temperature and post-fix with methanol, precooled at -20 &#176;C for 10 min. Air-dry for 15 min and then wash the sections twice with PBS (5 min each).</li>
	<li>Incubate the sections in blocking buffer (5% goat serum-0.1% Triton in PBS pH 7.3) at room temperature for 1 hr, followed by two washing steps with washing buffer (1 % BSA-0.1% Triton in PBS, pH 7.3).</li>
	<li>Incubate the tissue sections overnight at 4 &#176;C with anti-OCT4, anti-SOX2, and anti-Nanog primary antibodies.</li>
	<li>The next day, wash the sections 3x (5 min each) with washing buffer and incubate them for 1.5 hr at room temperature with the secondary antibody.</li>
	<li>Wash liver sections with PBS (3x, 5 min each) and mount them in DAPI and antifade containing medium.</li>
	<li>Visualize the slides under an epifluorescence microscope.</li>
</ol>
6. Alkaline Phosphatase (ALP) Staining of Liver Tissue Sections
<ol>
	<li>Obtain liver tissue sections as described before.</li>
	<li>Warm the tissue sections at room temperature for 15 min before performing the staining.</li>
	<li>Fix with 4% paraformaldehyde for 2 min. Note: excessive fixation time can decrease ALP activity.</li>
	<li>Air-dry the sections for 30 min and then incubate with BCIP/NBT liquid substrate at 37 &#176;C for 30 min.</li>
	<li>Wash the slides with distilled water and mount with aqueous mounting media.</li>
	<li>Capture random images by light microscopy.</li>
</ol>
7. Quantification of Albumin and Liver Enzyme Levels in Serum to Assess Liver Toxicity
<ol>
	<li>On days 4, 8, 12, and 120 after transfection, collect 300 &#956;l of blood directly from the heart ventricle.</li>
	<li>Keep the blood on ice while the different samples are collected to avoid clotting.</li>
	<li>Once all samples are ready, incubate for 30 min at 37 &#176;C until blood clots.</li>
	<li>Centrifuge the samples at 2,000 x g for 5 min.</li>
	<li>Carefully pipette the serum (in the supernatant) to a new Eppendorf tube and freeze at -80 &#176;C until processing of the samples.</li>
	<li>Analyze serum levels for albumin, ALT, AST, ALP, and GLDH.</li>
</ol>
8. Hematoxylin and Eosin (H&#38;E) and Periodic Acid-Schiff (PAS) Staining of Liver Sections to Assess Liver Toxicity
<ol>
	<li>At different time points, including 2, 4, 8, 12, 24, 50, and 120 days after HTV injection; perform liver perfusion with HBSS buffer only as previously described.</li>
	<li>Cut a piece of liver tissue and fix in 4% paraformaldehyde.</li>
	<li>Embed liver tissue in paraffin blocks, section and stain with either H&#38;E or PAS staining.</li>
	<li>Capture random images by light microscopy.</li>
</ol>

<ol>
	<li>Blelloch, R., Venere, M., Yen, J., Ramalho-Santos, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+Of+Induced+Pluripotent+Stem+Cells+In+The+Absence+Of+Drug+Selection.">Generation Of Induced Pluripotent Stem Cells In The Absence Of Drug Selection.</a> Cell Stem Cell. 1, 245-247 (2007).</li><li>Stadtfeld, M., Nagaya, M., Utikal, J., Weir, G., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+Pluripotent+Stem+Cells+Generated+Without+Viral+Integration.">Induced Pluripotent Stem Cells Generated Without Viral Integration.</a> Science. 322, 945-949 (2008).</li><li>Takahashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+Of+Pluripotent+Stem+Cells+From+Adult+Human+Fibroblasts+By+Defined+Factors.">Induction Of Pluripotent Stem Cells From Adult Human Fibroblasts By Defined Factors.</a> Cell. 131, 861-872 (2007).</li><li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+Of+Pluripotent+Stem+Cells+From+Mouse+Embryonic+And+Adult+Fibroblast+Cultures+By+Defined+Factors.">Induction Of Pluripotent Stem Cells From Mouse Embryonic And Adult Fibroblast Cultures By Defined Factors.</a> Cell. 126, 663-676 (2006).</li><li>Yu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+Pluripotent+Stem+Cell+Lines+Derived+From+Human+Somatic+Cells.">Induced Pluripotent Stem Cell Lines Derived From Human Somatic Cells.</a> Science. 318, 1917-1920 (2007).</li><li>Gonzalez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+Of+Mouse-Induced+Pluripotent+Stem+Cells+By+Transient+Expression+Of+A+Single+Nonviral+Polycistronic+Vector.">Generation Of Mouse-Induced Pluripotent Stem Cells By Transient Expression Of A Single Nonviral Polycistronic Vector.</a> Proc. Natl. Acad. Sci. U.S.A. 106, 8918-8922 (2009).</li><li>Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka, T., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+Of+Mouse+Induced+Pluripotent+Stem+Cells+Without+Viral+Vectors.+.">Generation Of Mouse Induced Pluripotent Stem Cells Without Viral Vectors. .</a> Science. 322, 949-953 (2008).</li><li>Woltjen, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Piggybac+Transposition+Reprograms+Fibroblasts+To+Induced+Pluripotent+Stem+Cells.">Piggybac Transposition Reprograms Fibroblasts To Induced Pluripotent Stem Cells.</a> Nature. 458, 766-770 (2009).</li><li>Yusa, K., Rad, R., Takeda, J., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+Of+Transgene-Free+Induced+Pluripotent+Mouse+Stem+Cells+By+The+Piggybac+Transposon.">Generation Of Transgene-Free Induced Pluripotent Mouse Stem Cells By The Piggybac Transposon.</a> Nat. Meth. 6, 363-369 (2009).</li><li>Warren, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Efficient+Reprogramming+To+Pluripotency+And+Directed+Differentiation+Of+Human+Cells+With+Synthetic+Modified+Mrna.">Highly Efficient Reprogramming To Pluripotency And Directed Differentiation Of Human Cells With Synthetic Modified Mrna.</a> Cell Stem Cell. 7, 618-630 (2010).</li><li>Kim, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+Of+Human+Induced+Pluripotent+Stem+Cells+By+Direct+Delivery+Of+Reprogramming+Proteins.">Generation Of Human Induced Pluripotent Stem Cells By Direct Delivery Of Reprogramming Proteins.</a> Cell Stem Cell. 4, 472-476 (2009).</li><li>Zhou, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+Of+Induced+Pluripotent+Stem+Cells+Using+Recombinant+Proteins.">Generation Of Induced Pluripotent Stem Cells Using Recombinant Proteins.</a> Cell Stem Cell. 4, 381-384 (2009).</li><li>Anokye-Danso, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Efficient+Mirna-Mediated+Reprogramming+Of+Mouse+And+Human+Somatic+Cells+To+Pluripotency.">Highly Efficient Mirna-Mediated Reprogramming Of Mouse And Human Somatic Cells To Pluripotency.</a> Cell Stem Cell. 8, 376-388 (2011).</li><li>Lin, S. -. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+Of+Somatic+Cell+Reprogramming+Through+Inducible+Mir-302+Expression.">Regulation Of Somatic Cell Reprogramming Through Inducible Mir-302 Expression.</a> Nucleic Acids Res. , (2011).</li><li>Miyoshi, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+Of+Mouse+And+Human+Cells+To+Pluripotency+Using+Mature+Micrornas.">Reprogramming Of Mouse And Human Cells To Pluripotency Using Mature Micrornas.</a> Cell Stem Cell. 8, 633-638 (2011).</li><li>Subramanyam, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiple+Targets+Of+Mir-302+And+Mir-372+Promote+Reprogramming+Of+Human+Fibroblasts+To+Induced+Pluripotent+Stem+Cells.">Multiple Targets Of Mir-302 And Mir-372 Promote Reprogramming Of Human Fibroblasts To Induced Pluripotent Stem Cells.</a> Nat. Biotechnol. 29, 443-448 (2011).</li><li>Dolgin, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flaw+In+Induced-Stem-Cell+Model.">Flaw In Induced-Stem-Cell Model.</a> Nature. 470, 13 (2011).</li><li>Miura, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Variation+In+The+Safety+Of+Induced+Pluripotent+Stem+Cell+Lines.">Variation In The Safety Of Induced Pluripotent Stem Cell Lines.</a> Nat. Biotech. 27, 743-745 (2009).</li><li>Pera, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Dark+Side+Of+Pluripotency.">The Dark Side Of Pluripotency.</a> Nature. 471, 46-47 (2011).</li><li>Saha, K., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Challenges+In+Using+Human+Induced+Pluripotent+Stem+Cells+To+Model+Disease.">Technical Challenges In Using Human Induced Pluripotent Stem Cells To Model Disease.</a> Cell Stem Cell. 5, 584-595 (2009).</li><li>Okita, K., Ichisaka, T., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+Of+Germline-Competent+Induced+Pluripotent+Stem+Cells.">Generation Of Germline-Competent Induced Pluripotent Stem Cells.</a> Nature. 448, 313-317 (2007).</li><li>Varas, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibroblast-Derived+Induced+Pluripotent+Stem+Cells+Show+No+Common+Retroviral+Vector+Insertions.">Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions.</a> Stem Cells. 27, 300-306 (2009).</li><li>Jia, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Nonviral+Minicircle+Vector+For+Deriving+Human+Ips+Cells.">A Nonviral Minicircle Vector For Deriving Human Ips Cells.</a> Nat. Meth. 7, 197-199 (2010).</li><li>Gonzalez, F., Boue, S., Belmonte, J. C. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+For+Making+Induced+Pluripotent+Stem+Cells:+Reprogramming+A+La.">Methods For Making Induced Pluripotent Stem Cells: Reprogramming A La.</a> Nat. Rev. Genet. 12, 231-242 (2011).</li><li>Stadtfeld, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+Pluripotency:+History,+Mechanisms,+And+Applications.">Induced Pluripotency: History, Mechanisms, And Applications.</a> Genes Dev. 24, 2239-2263 (2011).</li><li>Gore, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+Coding+Mutations+In+Human+Induced+Pluripotent+Stem+Cells.">Somatic Coding Mutations In Human Induced Pluripotent Stem Cells.</a> Nature. 471, 63-67 (2011).</li><li>Hussein, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Copy+Number+Variation+And+Selection+During+Reprogramming+To+Pluripotency.">Copy Number Variation And Selection During Reprogramming To Pluripotency.</a> Nature. 471, 58-62 (2011).</li><li>Lister, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hotspots+Of+Aberrant+Epigenomic+Reprogramming+In+Human+Induced+Pluripotent+Stem+Cells.">Hotspots Of Aberrant Epigenomic Reprogramming In Human Induced Pluripotent Stem Cells.</a> Nature. 471, 68-73 (2011).</li><li>Yilmazer, A., De L&#225;zaro, I., Bussy, C., Kostarelos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Cell+Reprogramming+Towards+Pluripotency+By+Virus-Free+Overexpression+Of+Defined+Factors.+.">In Vivo Cell Reprogramming Towards Pluripotency By Virus-Free Overexpression Of Defined Factors. .</a> Plos One. 8, (2013).</li><li>Liu, F., Song, Y. K., Liu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydrodynamics-Based+Transfection+In+Animals+By+Systemic+Administration+Of+Plasmid+Dna.">Hydrodynamics-Based Transfection In Animals By Systemic Administration Of Plasmid Dna.</a> Gene Ther. 6, 1258-1266 (1999).</li><li>Zhang, G., Budker, V., Wolff, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Levels+Of+Foreign+Gene+Expression+In+Hepatocytes+After+Tail+Vein+Injections+Of+Naked+Plasmid+Dna.">High Levels Of Foreign Gene Expression In Hepatocytes After Tail Vein Injections Of Naked Plasmid Dna.</a> Hum. Gene. Ther. 10, 1735-1737 (1999).</li><li>Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+Pluripotent+Stem+Cells:+Past,+Present,+And+Future.">Induced Pluripotent Stem Cells: Past, Present, And Future.</a> Cell Stem Cell. 10, 678-684 (2012).</li><li>Therapy Giacca, M. G. e. n. e. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> , (2010).</li><li>Colella, P., Auricchio, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aav-Mediated+Gene+Supply+For+Treatment+Of+Degenerative+And+Neovascular+Retinal+Diseases.">Aav-Mediated Gene Supply For Treatment Of Degenerative And Neovascular Retinal Diseases.</a> Curr. Gene Ther. 10, 371-380 (2010).</li><li>Dayton, R. D., Wang, D. B., Klein, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Advent+Of+Aav9+Expands+Applications+For+Brain+And+Spinal+Cord+Gene+Delivery.">The Advent Of Aav9 Expands Applications For Brain And Spinal Cord Gene Delivery.</a> Expert Opin. Biol. Ther. 12, 757-766 (2012).</li><li>Mccown, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-Associated+Virus+(Aav)+Vectors+In+The+Cns.">Adeno-Associated Virus (Aav) Vectors In The Cns.</a> Curr. Gene Ther. 11, 181-188 (2011).</li><li>Vandenberghe, L. H., Auricchio, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Adeno-Associated+Viral+Vectors+For+Retinal+Gene+Therapy.">Novel Adeno-Associated Viral Vectors For Retinal Gene Therapy.</a> Gene Ther. 19, 162-168 (2012).</li><li>Herweijer, H., Wolff, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+And+Prospects:+Naked+Dna+Gene+Transfer+And+Therapy.">Progress And Prospects: Naked Dna Gene Transfer And Therapy.</a> Gene Ther. 10, 453-458 (2003).</li><li>Wolff, J. A., Budker, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mechanism+Of+Naked+Dna+Uptake+And+Expression.">The Mechanism Of Naked Dna Uptake And Expression.</a> Adv. Genet. 54, 3-20 (2005).</li></ol>

The authors declare that they have no competing financial interests.

This study provides proof-of-principle evidence of in vivo cell reprogramming towards pluripotency following the efficient transfer and overexpression of the OKSM factors to the adult mouse liver. With the help of different techniques such as qRT-PCR, flow cytometry, IHC or serum analysis, the target tissue was investigated to observe in vivo cell reprogramming. Very rapidly from the induction of OKSM factor overexpression in the tissue, pluripotency markers were upregulated at the mRNA and protein levels (within 48 hr). Throughout these experiments, between 5-15% of cells extracted from the tissue were shown to be Nanog and Oct3/4 positive. Furthermore, no structural or functional abnormalities were observed in the liver throughout 120 days. Expression of transgenes by HTV injection of plasmid DNA in tissues other than liver (lung, spleen, kidney and heart) has been previously reported, however the levels of gene expression were at least 3 orders of magnitude lower than those in hepatocytes30. The data in this study indicates that reprogramming of somatic cells towards a pluripotent state in vivo is safe, fast and efficient. In view of the majority of existing in vitro cell reprogramming methodologies that generally achieve pluripotent (iPS) cell generation within 3 weeks with less than 1% of efficiency32, in vivo reprogramming to pluripotency may offer very interesting alternatives. We hypothesize that the concept of in vivo reprogramming to pluripotency could be applied to various types of somatic cells with high efficiency (dependent on the vector used), however the level of functional pluripotency achieved in the in vivo reprogrammed cells will need to be determined. Moreover, with the development of improved protocols and technologies, in vivo reprogrammed cells could potentially be extracted and utilized for regenerative medicine purposes.
There are some critical steps to follow in order to reprogram adult, somatic cells in vivo with high efficiency. Achieving high levels of gene expression in the target tissue is a prerequisite. In this study this was illustrated by utilizing the efficient transfer and expression of plasmid DNA to hepatocytes using HTV injection. The most important factors for HTV injection are the volume, which should be between 8-10% of the total body weight of the animal, and the speed of injection, which must be performed within 5-7 sec. Mice younger than 6 weeks old should not be used, as HTV injection can cause more tissue damage in the liver, which can affect the efficiency of cellular reprogramming. The genetic background of the animals had no impact in determining the efficiency of in vivo reprogramming, as we have previously reported similar levels of reprogramming in both Balb/C and TNG-A mice, the latter being a transgenic strain that carries the eGFP reporter inserted in the Nanog locus and is bred on Sv129 background29.
We speculate that in vivo cell reprogramming to a pluripotent state (that will need to be determined) can be applied to other tissue types provided that the OKSM factors are efficiently delivered to target cells, allowing high levels of gene expression. A variety of nonviral and viral gene delivery vectors have been studied in preclinical and clinical trials in order to target different cell and tissue types33. For example, for neural or ocular tissues adeno-associated viruses have been the preferred vector choice for efficient in vivo gene transfer34-37, whereas in muscle tissue naked plasmid DNA injections have been shown to result in relatively high levels of gene expression38,39. Therefore, the method of gene transfer vector should be carefully selected depending on the tissue type in order to achieve efficient and rapid in vivo cell reprogramming toward a pluripotent state.

Ethical concerns about the use of embryonic stem cells have been one of the limitations in the development of stem cells research. However, the discovery by Yamanaka and colleagues that the forced expression of four transcription factors (namely: Oct3/4, Klf4, Sox2, c-Myc (OKSM)) could lead to in vitro reprogramming of somatic cells into pluripotent cells, named induced pluripotent stem (iPS) cells, has opened new opportunities. Viral1-5 and nonviral6-10 gene transfer, protein cytoplasmic translocation11,12, and miRNA13-16 transfection are among the various methods used today to generate iPS cells. Yet, such reprogramming methodologies suffer from various issues that are restricting their translation into the clinic, such as: a) severe limitations in efficiency of cell reprogramming; b) the predominant use of viral vectors; c) long and multi-step protocols of culturing conditions; and d) the risk of tumorigenicity by implantation of the in vitro generated iPS cells17-20.
Gene transfer of defined transcription factors3-5 by retroviruses is the most commonly used method to reprogram somatic cells. However, it contains the risks from the possibility of insertional mutagenesis, stable transduction and long-term proto-oncogene expression21,22. Nonviral gene transfer vectors such as plasmid DNA6,7,23 or RNA10 delivery using liposomes or electroporation have also been explored. While safer compared to viruses, those vectors offer significantly limited transduction and reprogramming efficiency24,25 .
One of the central dogmas of this emerging field is that in vivo implantation of iPS cells will lead to their uncontrolled differentiation and the formation of a tumor-like mass (teratoma), composed of various tissues from the three different germ layers. Therefore, the concept of reprogramming to pluripotency has been primarily focused on in vitro manipulations of primary extracted somatic cells (most commonly fibroblasts). However, as described above, this principle suffers from long and complex cell culture protocols, including multiple rounds of treatment (gene transfer, growth factors, antibiotics, antioxidants) that may themselves enhance the risks for teratoma formation or other forms of tumorigenesis upon implantation of the cells24-28.
We propose that reprogramming of adult somatic cells in vivo by the transient overexpression of the OKSM transcription factors does not lead to subsequent formation of teratomas29. The method to achieve that will depend on achieving high levels of transcription factor expression within the target tissue in the safest possible way. In this study, we selected an established virus-free gene transfer technology that has been shown to target efficiently liver in order to reprogram cells to pluripotency in vivo. This technology involves large-volume, rapid hydrodynamic tail vein (HTV) injection of plasmid DNA30,31. High expression levels of transfected genes can be achieved in adult hepatocytes following this nonviral gene transfer method. Moreover, this technology minimizes the potential risks from use of viral vectors (e.g. permanent genomic insertion, insertional mutagenesis).

<table border="1">
	<tbody>
		<tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>pCX-OKS-2A pDNA</td>
			<td>Addgene</td>
			<td>19771</td>
			<td>Obtained from Addgene as bacterial stab, plasmid production performed in Plasmid Factory (Germany)</td>
		</tr>
		<tr>
			<td>pCX-cMyc</td>
			<td>Addgene</td>
			<td>19772</td>
			<td>Obtained from Addgene as bacterial stab, plasmid production performed in Plasmid Factory (Germany)</td>
		</tr>
		<tr>
			<td>0.22 &#956;m filter</td>
			<td>Milliopore</td>
			<td>SLGP033RS</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>Abbott</td>
			<td>B505</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS buffer</td>
			<td>Sigma-Aldrich</td>
			<td>H6648</td>
			<td>Ca2+ and Mg2+ free, with bicarbonate</td>
		</tr>
		<tr>
			<td>Liver Digest Medium</td>
			<td>Gibco</td>
			<td>17703-034</td>
			<td></td>
		</tr>
		<tr>
			<td>Hepatocyte Wash Medium</td>
			<td>Gibco</td>
			<td>17704-024</td>
			<td></td>
		</tr>
		<tr>
			<td>100 &#956;m cell strainer</td>
			<td>BD Biosciences</td>
			<td>352360</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleospin RNA II kit</td>
			<td>Macherey-Nagel</td>
			<td>740955.25</td>
			<td>Kit for RNA isolation from cells and tissues</td>
		</tr>
		<tr>
			<td>iScript cDNA synthesis kit</td>
			<td>Bio-Rad</td>
			<td>170-8890</td>
			<td></td>
		</tr>
		<tr>
			<td>iO SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>170-8880</td>
			<td></td>
		</tr>
		<tr>
			<td>Oct3/4 forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>TGAGAACCTTCAGGAGATATGCAA</td>
		</tr>
		<tr>
			<td>Oct3/4 reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>CTCAATGCTAGTTCGCTTTCTCTTC</td>
		</tr>
		<tr>
			<td>Sox2 forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>GGTTACCTCTTCCTCCCACTCCAG</td>
		</tr>
		<tr>
			<td>Sox2 reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>TCACATGTGCGACAGGGGCAG</td>
		</tr>
		<tr>
			<td>C-myc forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>CAGAGGAGGAACGAGCTGAAGCGC</td>
		</tr>
		<tr>
			<td>C-myc reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>TTATGCACCAGAGTTTCGAAGCTGTTCG</td>
		</tr>
		<tr>
			<td>Nanog forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>CAGAAAAACCAGTGGTTGAAGACTAG</td>
		</tr>
		<tr>
			<td>Nanog reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>GCAATGGATGCTGGGATACTC</td>
		</tr>
		<tr>
			<td>Ecat1 forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>TGTGGGGCCCTGAAAGGCGAGCTGAGAT</td>
		</tr>
		<tr>
			<td>Ecat1 reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>ATGGGCCGCCATACGACGACGCTCAACT</td>
		</tr>
		<tr>
			<td>Rex1 forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>ACGAGTGGCAGTTTCTTCTTGGGA</td>
		</tr>
		<tr>
			<td>Rex1 reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>TATGACTCACTTCCAGGGGGCACT</td>
		</tr>
		<tr>
			<td>Alb forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>GTTCGCTACACCCAGAAAGC</td>
		</tr>
		<tr>
			<td>Alb reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>CCACACAAGGCAGTCTCTGA</td>
		</tr>
		<tr>
			<td>Aat forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>CAGAGGAGGCCAAGAAAGTG</td>
		</tr>
		<tr>
			<td>Aat reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>ATGGACAGTCTGGGGAAGTG</td>
		</tr>
		<tr>
			<td>Trf forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>ACCATGTTGTGGTCTCACGA</td>
		</tr>
		<tr>
			<td>Trf reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>ACAGAAGGTCCTTGGTGGTG</td>
		</tr>
		<tr>
			<td>B actin forward primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>GACCTCTATGCCAACACAGT</td>
		</tr>
		<tr>
			<td>B actin reverse primer</td>
			<td>Sigma</td>
			<td>sequence given in comments</td>
			<td>AGTACTTGCGCTCAGGAGGA</td>
		</tr>
		<tr>
			<td>BD Cytofix fixation buffer</td>
			<td>BD Biosciences</td>
			<td>560585</td>
			<td></td>
		</tr>
		<tr>
			<td>1x BD Perm/Wash buffer</td>
			<td>BD Biosciences</td>
			<td>560585</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-mouse OCT4-PerCP-Cy5.5</td>
			<td>BD Biosciences</td>
			<td>560585</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-mouse Nanog-PE</td>
			<td>BD Biosciences</td>
			<td>560585</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Methylbutane</td>
			<td>Sigma-Aldrich</td>
			<td>M32631</td>
			<td></td>
		</tr>
		<tr>
			<td>X100-Triton</td>
			<td>Sigma-Aldrich</td>
			<td>X100-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Goat serum</td>
			<td>Sigma-Aldrich</td>
			<td>G9023</td>
			<td></td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma</td>
			<td>A2153</td>
			<td></td>
		</tr>
		<tr>
			<td>rabbit pAb anti-OCT4</td>
			<td>Abcam</td>
			<td>ab19857</td>
			<td>Use at a concentration of 3 &#956;g/ml</td>
		</tr>
		<tr>
			<td>rabbit pAb anti-SOX2</td>
			<td>Abcam</td>
			<td>ab97959</td>
			<td>Use at a concentration of 1 &#956;g/ml</td>
		</tr>
		<tr>
			<td>rabbit pAb anti-Nanog</td>
			<td>Abcam</td>
			<td>ab80892</td>
			<td>Use at a concentration of 1 &#956;g/ml</td>
		</tr>
		<tr>
			<td>mouse mAb anti-SSEA1</td>
			<td>Abcam</td>
			<td>ab16285</td>
			<td>Use at a concentration of 20 &#956;g/ml</td>
		</tr>
		<tr>
			<td>goat pAb anti-rabbit IgG labeled with Cy3</td>
			<td>Jackson ImmunoResearch Laboratories Inc.</td>
			<td>111-165-003-JIR</td>
			<td>Use at a concentration of 1/250</td>
		</tr>
		<tr>
			<td>goat pAb anti-mouse IgG labeled with Cy3</td>
			<td>Jackson ImmunoResearch Laboratories Inc.</td>
			<td>115-165-003-JIR</td>
			<td>Use at a concentration of 1/250</td>
		</tr>
		<tr>
			<td>VECTASHIELD mounting medium with DAPI</td>
			<td>Vector Laboratories</td>
			<td>H-1200</td>
			<td></td>
		</tr>
		<tr>
			<td>BCIP/NBT liquid substrate system</td>
			<td>Sigma</td>
			<td>B1911</td>
			<td></td>
		</tr>
		<tr>
			<td>Aqueous mounting medium</td>
			<td>Sigma</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>16% Paraformaldehyde</td>
			<td>Fisher</td>
			<td>AA433689M</td>
			<td>Stock solution is 16%, use it at 4%</td>
		</tr>
		<tr>
			<td>Hematoxylin and eosin</td>
			<td>Sigma</td>
			<td>GH53/HT110216</td>
			<td></td>
		</tr>
		<tr>
			<td>PAS staining</td>
			<td>Sigma</td>
			<td>395B</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo reprogramming of adult somatic cells to pluripotency by overexpression of yamanaka factors

Induced pluripotent stem (iPS) cells that result from the reprogramming of somatic cells to a pluripotent state by forced expression of defined factors are offering new opportunities for regenerative medicine. Such clinical applications of iPS cells have been limited so far, mainly due to the poor efficiency of the existing reprogramming methodologies and the risk of the generated iPS cells to form tumors upon implantation.
We hypothesized that the reprogramming of somatic cells towards pluripotency could be achieved in vivo by gene transfer of reprogramming factors. In order to efficiently reprogram cells in vivo, high levels of the Yamanaka (OKSM) transcription factors need to be expressed at the target tissue. This can be achieved by using different viral or nonviral gene vectors depending on the target tissue. In this particular study, hydrodynamic tail-vein (HTV) injection of plasmid DNA was used to deliver the OKSM factors to mouse hepatocytes. This provided proof-of-evidence of in vivo reprogramming of adult, somatic cells towards a pluripotent state with high efficiency and fast kinetics. Furthermore no tumor or teratoma formation was observed in situ.
It can be concluded that reprogramming somatic cells in vivo may offer a potential approach to induce enhanced pluripotency rapidly, efficiently, and safely compared to in vitro performed protocols and can be applied to different tissue types in the future.

Figure 1 shows the overview of the procedure that involves the gene transfer of OKSM encoding plasmids to mice liver and the different techniques performed to observe in vivo cell reprogramming. Following HTV injection of the plasmids, a significant increase in gene expression of the transfected reprogramming factors (Oct3/4, Sox2, Klf4, and cMyc) at the mRNA level was observed on day 2 after injection. The expression of these factors decreases over time after injection, as shown in Figure 2a. Regarding the expression of endogenous pluripotency markers (Nanog, Ecat1 and Rex1), their levels were significantly upregulated compared to those in hepatocytes from saline-injected animals on day 2 and 4 after injection, and were back to baseline levels from day 8 onward (Figure 2b). At the same time dedifferentiation of the hepatocyte population was confirmed by the downregulation of hepatocyte-specific genes (Alb, Aat, and Trf) that was statistically significant on day 4 and reached baseline levels from day 8 onward (Figure 2d).
The expression of Oct3/4 and Nanog at the protein level was investigated by flow cytometry. As shown in Figure 2c, only Oct3/4 is expressed on day 1 after HTV injection, while for the expression of the endogenous pluripotency marker Nanog it was necessary to wait until day 4.
The occurrence of in vivo cell reprogramming was further confirmed by immunohistochemical analysis of liver tissues with anti-OCT4, anti-SOX2 and anti-Nanog antibodies and by specific staining for ALP activity. Positive cells for all markers and enzymatic activity are reproducibly found in the liver tissues from OKSM-injected animals but not in the saline-injected controls (Figure 3).
The possible toxicity side-effects and teratoma formation from in vivo cell reprogramming by HTV injection of pDNA were investigated by quantification of liver enzyme levels in serum, as well as H&#38;E and PAS staining of liver tissue sections over a period of 120 days. Transient and not severe signs of tissue damage were observed until day 2, but not longer. No formation of teratomas or any sign of dysplasia or morphological alterations were observed for the period of study (Figure 4). There were no hepatic structural or functional abnormalities throughout the course of the study for any of the animals, as confirmed by albumin and liver enzyme levels and glycogen staining of tissue sections (Figures 4b and c).
<img alt="Figure 1" fo:content-width="6in" fo:src="/files/ftp_upload/50837/50837fig1highres.jpg" src="/files/ftp_upload/50837/50837fig1.jpg" /> 
Figure 1. The schematic overview of in vivo reprogramming procedure and its analysis. The protocol involves two main stages: (i) administration of reprogramming factors in vivo and (ii) tissue extraction and sample analysis. <a href="https://www.jove.com/files/ftp_upload/50837/50837fig1large.jpg" target="_blank"> Click here to view larger figure</a>.
<img alt="Figure 2" fo:content-width="6.5in" fo:src="/files/ftp_upload/50837/50837fig2highres.jpg" src="/files/ftp_upload/50837/50837fig2.jpg" /> 
Figure 2. In vivo overexpression of Yamanaka transcription factors in adult mouse liver. Balb/C mice were HTV injected with 0.9% saline alone, 75 &#956;g of pCX-OKS-2A and 75 &#956;g pCX-cMyc in 0.9% saline and at days 2, 4, 8, 12, 24, RT-qPCR analysis of hepatocytes was performed to determine the relative gene expression of: (a) transfected transcription factors (OKSM) and (b) endogenous pluripotency markers; (c) flow cytometry analysis of OCT3/4 positive and Nanog positive cells; (d) relative gene expression of hepatocyte markers as determined by RT-qPCR. All gene expression levels were normalized to saline HTV-injected group. (* p&#60;0.05 indicates statistically significant difference compared to saline HTV-injected groups, obtained by the analysis of variance and Tukey&#39;s pairwise comparison). Figure adapted from Yilmazer et al.29 <a href="https://www.jove.com/files/ftp_upload/50837/50837fig2large.jpg" target="_blank"> Click here to view larger figure</a>.
<img alt="Figure 3" fo:content-width="5in" fo:src="/files/ftp_upload/50837/50837fig3highres.jpg" src="/files/ftp_upload/50837/50837fig3.jpg" /> 
Figure 3. In vivo cell reprogramming on adult mouse liver tissue by immunohistochemistry. Balb/C mice HTV injected with 0.9% saline alone, 75 &#956;g of pCX-OKS-2A and 75 &#956;g pCX-cMyc in 0.9% saline. At day 4, livers were collected and frozen tissue sections were stained with anti-OCT4, anti-SOX2 or anti-Nanog antibodies to assess immunoreactivity, or BCIP/NBT to determine ALP activity in the tissue (40X). Scale bars represent 100 &#956;m. Figure adapted from Yilmazer et al.29 <a href="https://www.jove.com/files/ftp_upload/50837/50837fig3large.jpg" target="_blank"> Click here to view larger figure</a>.
<img alt="Figure 4" fo:content-width="6in" fo:src="/files/ftp_upload/50837/50837fig4highres.jpg" src="/files/ftp_upload/50837/50837fig4.jpg" /> 
Figure 4. The effect of in vivo cell reprogramming on liver functionality and histopathology. Balb/C mice HTV injected with either 75 &#956;g of pCX-OKS-2A and 75 &#956;g pCX-cMyc in 0.9% saline or 0.9% saline only. On days 2, 4, 8, 12, 50, and 120 liver tissues and sera were isolated and processed for: (a) H&#38;E staining; (b) levels of liver enzymes; (c) levels of albumin; (d) PAS staining. Representative images were captured with light microscopy (10X). Scale bars represent 100 &#956;m. Figure adapted from Yilmazer et al.29&#160;<a href="https://www.jove.com/files/ftp_upload/50837/50837fig4large.jpg" target="_blank">Click here to view larger figure</a>.

Watch this Scientific Journal Video about In vivo Reprogramming of Adult Somatic Cells to Pluripotency by Overexpression of Yamanaka Factors at JoVE.com

In vivo Reprogramming of Adult Somatic Cells to Pluripotency by Overexpression of Yamanaka Factors

This study demonstrates the reprogramming of somatic cells towards pluripotency in vivo without the generation of teratomas. We used hydrodynamic tail vein injection of plasmid DNA encoding the Yamanka factors to induce the in vivo reprogramming of adult hepatocytes into cells of enhanced pluripotency.

In vivo Reprogramming of Adult Somatic Cells to Pluripotency by Overexpression of Yamanaka Factors

Induced pluripotent stem (iPS) cells that result from the reprogramming of somatic cells to a pluripotent state by forced expression of defined factors ...

in-vivo-reprogramming-adult-somatic-cells-to-pluripotency

Research

JoVE Journal

Biology

12.5K 次观看.  University College London. This study demonstrates the reprogramming of somatic cells towards pluripotency in vivo without the generation of teratomas. We used hydrodynamic tail vein injection of plasmid DNA encoding the Yamanka factors to induce the in vivo reprogramming of adult hepatocytes into cells of enhanced pluripotency.

视频: In vivo Reprogramming of Adult Somatic Cells to Pluripotency by Overexpression of Yamanaka Factors

Generation of Induced Pluripotent Stem Cells by Reprogramming Human Fibroblasts with the Stemgent Human TF Lentivirus Set

In 2006, Yamanaka and colleagues first demonstrated that retrovirus-mediated delivery and expression of Oct4, Sox2, c-Myc and Klf4 is capable of inducing the pluripotent state in mouse fibroblasts.1 The same group also reported the successful reprogramming of human somatic cells into induced pluripotent stem (iPS) cells using human versions of the same transcription factors delivered by retroviral vectors.2 Additionally, James Thomson et al. reported that the lentivirus-mediated co-expression of another set of factors (Oct4, Sox2, Nanog and Lin28) was capable of reprogramming human somatic cells into iPS cells.3
iPS cells are similar to ES cells in morphology, proliferation and the ability to differentiate into all tissue types of the body. Human iPS cells have a distinct advantage over ES cells as they exhibit key properties of ES cells without the ethical dilemma of embryo destruction. The generation of patient-specific iPS cells circumvents an important roadblock to personalized regenerative medicine therapies by eliminating the potential for immune rejection of non-autologous transplanted cells.
Here we demonstrate the protocol for reprogramming human fibroblast cells using the Stemgent Human TF Lentivirus Set. We also show that cells reprogrammed with this set begin to show iPS morphology four days post-transduction. Using the Stemolecule Y27632, we selected for iPS cells and observed correct morphology after three sequential rounds of colony picking and passaging. We also demonstrate that after reprogramming cells displayed the pluripotency marker AP, surface markers TRA-1-81, TRA-1-60, SSEA-4, and SSEA-3, and nuclear markers Oct4, Sox2 and Nanog.

We demonstrate the protocol for the generation of induced pluripotent stem cells from human somatic cells using lentivirus-mediated delivery of the human factors Oct4, Sox2, Nanog, and Lin28. Pluripotency was confirmed by morphology and the presence of embryonic stem (ES) cell-specific markers.

由Stemgent人类TF慢病毒重新编程人类成纤维细胞生成诱导多能干细胞

In 2006, Yamanaka and colleagues first demonstrated that retrovirus-mediated delivery and expression of Oct4, Sox2, c-Myc and Klf4 is capable of inducing ...

科研

生物学

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The liver is the metabolic center of the mammalian body and serves as a filter for the blood. The basic architecture of the liver is illustrated in figure 1 in which more than 85% of the liver mass is composed of hepatocytes and the remaining 15% of the cellular mass is composed of Kupffer cells (KCs), stellate cells (HSCs), and sinusoidal endothelial cells (SECs). SECs form the blood vessel walls within the liver and contain specialized morphology called fenestrae within in the cytoplasm. Fenestration of the cytoplasm is the appearance of holes (&tilde;100 &mu;m) within the cells so that the SECs act as a sieve in which most chylomicrons, chylomicron remnants and macromolecules, but not cells, pass through to the hepatocytes and HSCs 1 (Fig. 1). Due to the lack of a basement membrane, the gap between the SECs and hepatocytes form the Space of Disse. HSCs occupy this space and play a prominent role in regulation and response to injury, storage of retinoic acid and immunoregulation of the liver 2.
SECs are among the most endocytically active cells of the body displaying an array of scavenger receptors on their cell surface 3. These include SR-A, Stabilin-1 and Stabilin-2. Generally, small colloidal particles less than 230 nm and macromolecules in buffer phase are taken up by SECs, whereas, large particles and cellular debris is endocytosed (phagocytosed) by KCs 4. Thus, the bulk clearance of extracellular material such as the glycosaminoglycans from blood is largely dependent on the health and endocytic functions of SECs 5,6. For example, an increase in blood hyaluronan levels is indicative of liver disease ranging from mild to more severe forms 7.
With the exception of one report 8, there are no immortalized SEC cell lines in existence. Even this immortalized cell line is de-differentiated in that it does not express scavenger receptors that are present on primary SECs (our data, not shown). All cell biological studies must be performed on primary cells obtained freshly from the animal. Unfortunately, SECs dedifferentiate under standard culture conditions and must be used within 1 or 2 days upon isolation from the animal. Differentiation of SECs is marked by the expression of Stabilin-2 or HARE receptor 9 , CD31, and the presence of cytoplasmic fenestration 1. Differentiation of SECs can be extended by the addition of VEGF in culture media or by culturing cells in hepatocyte conditioned medium 10,11.
In this report, we will demonstrate the endocytic activity of SECs in the intact organ using radio-labeled heparin for hyaluronan for the SEC-specific Stabilin-2 receptor. We will then purify hepatocytes and SECs from the perfused liver to measure endocytosis.

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The study of liver sinusoidal endothelial cells (SECs) must be performed with primary cells obtained from the animal as no cell lines exist. This method relies on liver digestion and differential centrifugation for SEC purification for subsequent culturing and experimentation.

在体内肝细胞的分离纯化的肝细胞内吞其次是肝脏灌注

The liver is the metabolic center of the mammalian body and serves as a filter for the blood.  The basic architecture of the liver is illustrated in ...

In vivo Electroporation of Morpholinos into the Adult Zebrafish Retina

Many devastating inherited eye diseases result in progressive and irreversible blindness because humans cannot regenerate dying or diseased retinal neurons. In contrast, the adult zebrafish retina possesses the robust ability to spontaneously regenerate any neuronal class that is lost in a variety of different retinal damage models, including retinal puncture, chemical ablation, concentrated high temperature, and intense light treatment 1-8. Our lab extensively characterized regeneration of photoreceptors following constant intense light treatment and inner retinal neurons after intravitreal ouabain injection 2, 5, 9. In all cases, resident M&uuml;ller glia re-enter the cell cycle to produce neuronal progenitors, which continue to proliferate and migrate to the proper retinal layer, where they differentiate into the deficient neurons. 
	We characterized five different stages during regeneration of the light-damaged retina that were highlighted by specific cellular responses. We identified several differentially expressed genes at each stage of retinal regeneration by mRNA microarray analysis 10. Many of these genes are also critical for ocular development. To test the role of each candidate gene/protein during retinal regeneration, we needed to develop a method to conditionally limit the expression of a candidate protein only at times during regeneration of the adult retina. 
	Morpholino oligos are widely used to study loss of function of specific proteins during the development of zebrafish, Xenopus, chick, mouse, and tumors in human xenografts 11-14. These modified oligos basepair with complementary RNA sequence to either block the splicing or translation of the target RNA. Morpholinos are stable in the cell and can eliminate or "knockdown" protein expression for three to five days 12. 
	Here, we describe a method to efficiently knockdown target protein expression in the adult zebrafish retina. This method employs lissamine-tagged antisense morpholinos that are injected into the vitreous of the adult zebrafish eye. Using electrode forceps, the morpholino is then electroporated into all the cell types of the dorsal and central retina. Lissamine provides the charge on the morpholino for electroporation and can be visualized to assess the presence of the morpholino in the retinal cells. 
	Conditional knockdown in the retina can be used to examine the role of specific proteins at different times during regeneration. Additionally, this approach can be used to study the role of specific proteins in the undamaged retina, in such processes as visual transduction and visual processing in second order neurons.

In vivo Electroporation of Morpholinos into the Adult Zebrafish Retina

A method to conditionally knockdown a target protein&#x2019;s expression in the adult zebrafish retina is described, which involves intravitreally injecting antisense morpholinos and electroporating them into the retina. The resulting protein is knocked down for several days, which allows testing the protein&#x2019;s role in the regenerating or intact retina.

在体内电穿孔Morpholinos到成年斑马鱼视网膜

Many devastating inherited eye diseases result in progressive and irreversible blindness because humans cannot regenerate dying or diseased retinal ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

人类体细胞重编程为诱导多能干细胞（iPS细胞）用绿色荧光蛋白逆转录病毒载体

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...

Generation of Myospheres From hESCs by Epigenetic Reprogramming

Generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hESCs) is a requirement for cell-based therapies and for a "disease in a dish" model of human neuromuscular diseases. Major hurdles, such as low abundance and heterogeneity of the population of interest, as well as a lack of protocols for the formation of three-dimensional contractile structures, have limited the applications of stem cells for neuromuscular disorders. We have designed a protocol that overcomes these limits by ectopic introduction of defined factors in hESCs - the muscle determination factor MyoD and SWI/SNF chromatin remodeling complex component BAF60C - that are able to reprogram hESCs into skeletal muscle cells. Here we describe the protocol established to generate hESC-derived myoblasts and promote their clustering into tridimensional miniaturized structures (myospheres) that functionally mimic miniaturized skeletal muscles7.

Here, we describe a protocol based on epigenetic reprogramming of human embryonic stem cells (hESCs) toward generating a homogeneous population of skeletal muscle progenitors that under permissive culture conditions form three-dimensional clusters of contractile myofibers (myospheres), which recapitulate biological features of human skeletal muscles.

Myospheres的产生从人类胚胎干细胞通过表观遗传修饰

Generation of a homogeneous and abundant population of skeletal muscle cells from human embryonic stem cells (hESCs) is a requirement for cell-based ...

Efficient Generation Human Induced Pluripotent Stem Cells from Human Somatic Cells with Sendai-virus

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs include modeling pathogenesis of human genetic diseases, autologous cell therapy after gene correction, and personalized drug screening by providing a source of patient-specific and symptom relevant cells. However, there are several hurdles to overcome, such as eliminating the remaining reprogramming factor transgene expression after human iPSCs production. More importantly, residual transgene expression in undifferentiated human iPSCs could hamper proper differentiations and misguide the interpretation of disease-relevant in vitro phenotypes. With this reason, integration-free and/or transgene-free human iPSCs have been developed using several methods, such as adenovirus, the piggyBac system, minicircle vector, episomal vectors, direct protein delivery and synthesized mRNA. However, efficiency of reprogramming using integration-free methods is quite low in most cases.
Here, we present a method to isolate human iPSCs by using Sendai-virus (RNA virus) based reprogramming system. This reprogramming method shows consistent results and high efficiency in cost-effective manner.

Here, we present our established method to reprogram human somatic cells into transgene-free human iPSCs with Sendai virus, which shows consistent outcome and enhanced efficiency.

从人类体细胞与仙台病毒高效的新一代人类诱导多能干细胞

A few years ago, the establishment of human induced pluripotent stem cells (iPSCs) ushered in a new era in biomedicine. Potential uses of human iPSCs ...

Monitoring Functionality and Morphology of Vasculature Recruited by Factors Secreted by Fast-growing Tumor-generating Cells

The subcutaneous matrigel plug assay in mice is a method of choice for the in vivo evaluation of pro- and anti-angiogenic factors. In this method, desired factors are introduced into cold-liquid ECM-mimic gel which, after subcutaneous injection, solidifies to form an environment mimicking the cancer milieu. This matrix permits the penetration of host cells, such as endothelial cells, and therefore, the formation of vasculature.
Herein we propose a new modified matrigel plug assay, which can be exploited to illustrate the angiogenic potential of a pool of factors secreted by cancer cells, as opposed to a specific factor (e.g., bFGF and VEGF) or agent. The plug containing ECM-mimic gel is utilized to introduce the host (i.e., mouse) with a pool of factors secreted to the C.M. of fast-growing tumor-generating glioblastoma cells. We have previously described an extensive comparison of the angiogenic potential of U-87 MG human glioblastoma and its dormant-derived clone, in this system model, showing induced angiogenesis in the U-87 MG parental cells. The C.M. is prepared by filtering collected media from confluent tissue culture plates of either cell line following 48 hr incubation. Hence, it contains only factors secreted by the cells, without the cells themselves. Described here is the combination of two imaging modalities, microbubbles contrast-enhanced ultrasound imaging and intravital fibered-confocal endomicroscopy, for an accurate, real-time characterization of the extent, morphology and functionality of newly-formed blood vessels within the plugs.

We describe a matrigel plug assay to illustrate angiogenic potential of a pool of factors secreted by cancer cells using two complementary imaging modalities, ultrasound and endomicroscopy. The matrigel, an extracellular matrix (ECM)-mimic gel, is utilized to introduce the host (mouse) with angiogenic factors secreted to the conditioned media (C.M.).&#160;

监控功能和血管形态由快速增长的肿瘤产生细胞分泌的因素招募

The subcutaneous matrigel plug assay in mice is a method of choice for the in vivo evaluation of pro- and anti-angiogenic factors. In this method, desired ...

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) maintain the turnover of all mature blood cell lineages. The coordination of the complex signals leading to specific HSC fates relies upon the interaction between HSCs and the intricate bone marrow microenvironment, which is still poorly understood[1-2].
We describe how by combining a newly developed specimen holder for stable animal positioning with multi-step confocal and two-photon in vivo imaging techniques, it is possible to obtain high-resolution 3D stacks containing HSPCs and their surrounding niches and to monitor them over time through multi-point time-lapse imaging. High definition imaging allows detecting ex vivo labeled hematopoietic stem and progenitor cells (HSPCs) residing within the bone marrow. Moreover, multi-point time-lapse 3D imaging, obtained with faster acquisition settings, provides accurate information about HSPC movement and the reciprocal interactions between HSPCs and stroma cells.
Tracking of HSPCs in relation to GFP positive osteoblastic cells is shown as an exemplary application of this method. This technique can be utilized to track any appropriately labeled hematopoietic or stromal cell of interest within the mouse calvarium bone marrow space.

In Vivo 4-Dimensional Tracking of Hematopoietic Stem and Progenitor Cells in Adult Mouse Calvarial Bone Marrow

The nature of the interactions between hematopoietic stem and progenitor cells (HSPCs) and bone marrow niches is poorly understood. Custom hardware modifications and a multi-step acquisition protocol allow the use of two-photon and confocal microscopy to image ex vivo labeled HSPCs homed within bone marrow areas, tracking interactions and movement.

在造血干细胞和祖细胞的成年小鼠颅骨骨髓体内四维跟踪

Through a delicate balance between quiescence and proliferation, self renewal and production of differentiated progeny, hematopoietic stem cells (HSCs) ...

Identification of Key Factors Regulating Self-renewal and Differentiation in EML Hematopoietic Precursor Cells by RNA-sequencing Analysis

Hematopoietic stem cells (HSCs) are used clinically for transplantation treatment to rebuild a patient&#39;s hematopoietic system in many diseases such as leukemia and lymphoma. Elucidating the mechanisms controlling HSCs self-renewal and differentiation is important for application of HSCs for research and clinical uses. However, it is not possible to obtain large quantity of HSCs due to their inability to proliferate in vitro. To overcome this hurdle, we used a mouse bone marrow derived cell line, the EML (Erythroid, Myeloid, and Lymphocytic) cell line, as a model system for this study.
RNA-sequencing (RNA-Seq) has been increasingly used to replace microarray for gene expression studies. We report here a detailed method of using RNA-Seq technology to investigate the potential key factors in regulation of EML cell self-renewal and differentiation. The protocol provided in this paper is divided into three parts. The first part explains how to culture EML cells and separate Lin-CD34+ and Lin-CD34- cells. The second part of the protocol offers detailed procedures for total RNA preparation and the subsequent library construction for high-throughput sequencing. The last part describes the method for RNA-Seq data analysis and explains how to use the data to identify differentially expressed transcription factors between Lin-CD34+ and Lin-CD34- cells. The most significantly differentially expressed transcription factors were identified to be the potential key regulators controlling EML cell self-renewal and differentiation. In the discussion section of this paper, we highlight the key steps for successful performance of this experiment.
In summary, this paper offers a method of using RNA-Seq technology to identify potential regulators of self-renewal and differentiation in EML cells. The key factors identified are subjected to downstream functional analysis in vitro and in vivo.

RNA-sequencing and bioinformatics analyses were used to identify significantly and differentially expressed transcription factors in Lin-CD34+ and Lin-CD34- subpopulations of mouse EMLcells. These transcription factors might play important roles in determining the switch between self-renewing Lin-CD34+ and partially differentiated Lin-CD34- cells.

在EML造血前体细胞调节自我更新和分化的关键因素，通过RNA测序分析鉴定

Hematopoietic stem cells (HSCs) are used clinically for transplantation treatment to rebuild a patient&#39;s hematopoietic system in many diseases such as ...

A Graphical User Interface for Software-assisted Tracking of Protein Concentration in Dynamic Cellular Protrusions

Filopodia are dynamic, finger-like cellular protrusions associated with migration and cell-cell communication. In order to better understand the complex signaling mechanisms underlying filopodial initiation, elongation and subsequent stabilization or retraction, it is crucial to determine the spatio-temporal protein activity in these dynamic structures. To analyze protein function in filopodia, we recently developed a semi-automated tracking algorithm that adapts to filopodial shape-changes, thus allowing parallel analysis of protrusion dynamics and relative protein concentration along the whole filopodial length. Here, we present a detailed step-by-step protocol for optimized cell handling, image acquisition and software analysis. We further provide instructions for the use of optional features during image analysis and data representation, as well as troubleshooting guidelines for all critical steps along the way. Finally, we also include a comparison of the described image analysis software with other programs available for filopodia quantification. Together, the presented protocol provides a framework for accurate analysis of protein dynamics in filopodial protrusions using image analysis software.

We present a software solution for semi-automated tracking of relative protein concentration along the length of dynamic cellular protrusions.

软件辅助跟踪动态细胞突变中蛋白质浓度的图形用户界面

Filopodia are dynamic, finger-like cellular protrusions associated with migration and cell-cell communication. In order to better understand the complex ...