Name: study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro
Uploaded: 2022-03-07T13:00:00
Description: Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

We are grateful for technical support from Dr. Tz-Ling Chen. We thank the National RNAi Core Facility (Academia Sinica, Taiwan) for providing shRNA lentivirus (http://rnai.genmed.sinica.edu.tw). This work was supported by the Ministry of Science and Technology, Taiwan (MOST 108-2320-B-002-037-MY3 and MOST 109-2320-B-002-054-MY3).

Handling of lentivirus is performed as per the regulation of the Department of Environmental Health and Safety of National Taiwan University College of Medicine.
1. Preparation of immortalized hematopoietic stem and progenitor cell lines (iHSPCs)
<ol>
	<li>Maintain iHSPC cell line in complete RPMI 1640 medium containing 100 ng/mL FL and 1 &#181;M &#946;-estradiol.</li>
	<li>Passage the cells at a ratio of 1:10 every 3 days. 
	&#8203;NOTE: Make complete RPMI 1640 medium by supplementing ...

<ol>
	<li>Steinman, R. M., Witmer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphoid+dendritic+cells+are+potent+stimulators+of+the+primary+mixed+leukocyte+reaction+in+mice.">Lymphoid dendritic cells are potent stimulators of the primary mixed leukocyte reaction in mice.</a> Proceedings of the National Academy of Sciences. 75 (10), 5132-5136 (1978).</li><li>Guilliams, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cells,+monocytes+and+macrophages:+a+unified+nomenclature+based+on+ontogeny.">Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny.</a> Nature Reviews Immunology. 14 (8), 571-578 (2014).</li><li>Blasius, A. L., Cella, M., Maldonado, J., Takai, T., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Siglec-H+is+an+IPC-specific+receptor+that+modulates+type+I+IFN+secretion+through+DAP12.">Siglec-H is an IPC-specific receptor that modulates type I IFN secretion through DAP12.</a> Blood. 107 (6), 2474-2476 (2006).</li><li>Swiecki, M., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+functions+of+plasmacytoid+dendritic+cells+during+viral+infections,+autoimmunity,+and+tolerance.">Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance.</a> Immunology Reviews. 234 (1), 142-162 (2010).</li><li>Liu, Y. -. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPC:+Professional+Type+1+interferon-producing+cells+and+plasmacytoid+dendritic+cell+precursors.">IPC: Professional Type 1 interferon-producing cells and plasmacytoid dendritic cell precursors.</a> Annual Review of Immunology. 23 (1), 275-306 (2005).</li><li>Panda, S. K., Kolbeck, R., Sanjuan, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmacytoid+dendritic+cells+in+autoimmunity.">Plasmacytoid dendritic cells in autoimmunity.</a> Current Opinion in Immunology. 44, 20-25 (2017).</li><li>Durai, V., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functions+of+murine+dendritic+cells.">Functions of murine dendritic cells.</a> Immunity. 45 (4), 719-736 (2016).</li><li>Mashayekhi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD8&#945;(+)+dendritic+cells+are+the+critical+source+of+interleukin-12+that+controls+acute+infection+by+Toxoplasma+gondii+tachyzoites.">CD8&#945;(+) dendritic cells are the critical source of interleukin-12 that controls acute infection by Toxoplasma gondii tachyzoites.</a> Immunity. 35 (2), 249-259 (2011).</li><li>Anderson, D. A., Dutertre, C. -. A., Ginhoux, F., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+models+of+human+and+mouse+dendritic+cell+development+and+function.">Genetic models of human and mouse dendritic cell development and function.</a> Nature Reviews Immunology. 21 (2), 101-115 (2021).</li><li>Plantinga, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conventional+and+monocyte-derived+CD11b(+)+dendritic+cells+initiate+and+maintain+T+helper+2+cell-mediated+immunity+to+house+dust+mite+allergen.">Conventional and monocyte-derived CD11b(+) dendritic cells initiate and maintain T helper 2 cell-mediated immunity to house dust mite allergen.</a> Immunity. 38 (2), 322-335 (2013).</li><li>Persson, E. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+transcription-factor-dependent+CD103(+)CD11b(+)+dendritic+cells+drive+mucosal+T+helper+17+cell+differentiation.">IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation.</a> Immunity. 38 (5), 958-969 (2013).</li><li>Kumamoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD301b++dermal+dendritic+cells+drive+T+helper+2+cell-mediated+immunity.">CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.</a> Immunity. 39 (4), 733-743 (2013).</li><li>Cisse, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factor+E2-2+is+an+essential+and+specific+regulator+of+plasmacytoid+dendritic+cell+development.">Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development.</a> Cell. 135 (1), 37-48 (2008).</li><li>Grajkowska, L. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isoform-specific+expression+and+feedback+regulation+of+E+protein+TCF4+control+dendritic+cell+lineage+specification.">Isoform-specific expression and feedback regulation of E protein TCF4 control dendritic cell lineage specification.</a> Immunity. 46 (1), 65-77 (2017).</li><li>Jackson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Id2+expression+delineates+differential+checkpoints+in+the+genetic+program+of+CD8&#945;++and+CD103++dendritic+cell+lineages.">Id2 expression delineates differential checkpoints in the genetic program of CD8&#945;+ and CD103+ dendritic cell lineages.</a> The EMBO Journal. 30 (13), 2690-2704 (2011).</li><li>Suzuki, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+roles+of+interferon+regulatory+factor+4+in+CD11bhighCD8alpha-+dendritic+cell+development.">Critical roles of interferon regulatory factor 4 in CD11bhighCD8alpha- dendritic cell development.</a> Proceedings of the National Academy of Science U. S. A. 101 (24), 8981-8986 (2004).</li><li>Rodrigues, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+progenitor+lineages+contribute+to+the+heterogeneity+of+plasmacytoid+dendritic+cells.">Distinct progenitor lineages contribute to the heterogeneity of plasmacytoid dendritic cells.</a> Nature Immunology. 19 (7), 711-722 (2018).</li><li>Brown, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+basis+of+mouse+and+human+dendritic+cell+heterogeneity.">Transcriptional basis of mouse and human dendritic cell heterogeneity.</a> Cell. 179 (4), 846-863 (2019).</li><li>Redecke, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hematopoietic+progenitor+cell+lines+with+myeloid+and+lymphoid+potential.">Hematopoietic progenitor cell lines with myeloid and lymphoid potential.</a> Nature Methods. 10 (8), 795-803 (2013).</li><li>Abe, A., Miyanohara, A., Friedmann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polybrene+increases+the+efficiency+of+gene+transfer+by+lipofection.">Polybrene increases the efficiency of gene transfer by lipofection.</a> Gene Therapy. 5 (5), 708-711 (1998).</li><li>Sorgi, F. L., Bhattacharya, S., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protamine+sulfate+enhances+lipid-mediated+gene+transfer.">Protamine sulfate enhances lipid-mediated gene transfer.</a> Gene Therapy. 4 (9), 961-968 (1997).</li><li>Kirkling, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling+facilitates+in+vitro+generation+of+cross-presenting+classical+dendritic+cells.">Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells.</a> Cell Reports. 23 (12), 3658-3672 (2018).</li><li>Pearce, E. J., Everts, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cell+metabolism.">Dendritic cell metabolism.</a> Nature Reviews. Immunology. 15 (1), 18-29 (2015).</li><li>Wculek, S. K., Khouili, S. C., Priego, E., Heras-Murillo, I., Sancho, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+Control+of+Dendritic+Cell+Functions:+Digesting+Information.">Metabolic Control of Dendritic Cell Functions: Digesting Information.</a> Frontiers in Immunology. 10 (775), (2019).</li><li>Saxton, R. A., Sabatini, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mTOR+signaling+in+growth,+metabolism,+and+disease.">mTOR signaling in growth, metabolism, and disease.</a> Cell. 168 (6), 960-976 (2017).</li></ol>

Lentivirus-based shRNA vectors are often used for gene silencing by viral transduction into cells and permit stable integration into the host genome. However, various transduction efficiency in different cell types needs to be considered, and a number of approaches have been taken to overcome this problem. 
Polybrene is a polycationic polymer that can neutralize the charges on the cell membrane, thereby enhancing the binding of the virion to the cells during transduction20</s...

DCs are key regulators of innate and adaptive immunity1. DCs are mainly classified into two functionally distinct populations, namely pDCs and cDCs. Moreover, cDCs comprise two subsets, namely, type I and type II cDCs or cDC1s and cDC2s, respectively2. pDCs, expressing BST2, Siglec-H, and intermediate levels of CD11c in mice3,4, are the cells that can secrete large amounts of IFN-I during inflammation and viral infection5. Due to their robust IFN-I-producing ability, they are also suspected to play a key role in the progression of autoimmune diseases, including systemic lupus erythematosus (SLE)6. cDC1s, defined by the surface expression of XCR1, CD8a, CLEC9A, and CD103 in mice7, are specialized in the activation and polarization of cytotoxic CD8+ T cells (CTLs) through the antigen cross-presentation, thereby initiating type I immunity in response to intracellular pathogens and cancer8,9. On the other hand, cDC2s, expressing CD11b and CD172&#945; (also known as Sirp&#945;) in both humans and mice, can activate CD4+ T cells and promote type II immune response against allergen and parasites10, as well as modulate type III immunity following extracellular bacteria and microbiota recognition11,12.
Diversification of DCs is determined by a group of TFs from hematopoietic stem and progenitor cells (HSPCs) in the BM. E2-2 (encoded by Tcf4) is a master regulator for differentiation and function of pDCs13,14. In contrast, the inhibitor of DNA binding 2 (ID2) drives cDC specification and inhibits pDC development through blocking E protein activity15. Moreover, the development of cDC1s requires IRF8 and BATF3, while differentiation of cDC2s highly depends on IRF416. Recent works have explored the heterogeneity of pDCs17 and cDCs and their transcriptional regulation18. Because of the complexity of DC network, there is an unmet need to establish a platform to identify other TFs controlling the development and functionality of DCs.
Here, we used an iHSPC that was generated by expressing estrogen-regulated nuclear translocation of Hoxb8 in BM cells (also referred to as Hoxb8-FL cells)19. iHSPCs can proliferate and remain in an undifferentiated stage in the presence of &#946;-estradiol and Flt3 ligand (FL), whereas they start to differentiate into different DC types in the presence of FL upon withdrawal of &#946;-estradiol19. Based on this feature, we can knock down genes of interest at the progenitor stage, followed by examining the effect on in vitro differentiation of pDCs and cDCs. Therefore, this method is a powerful tool to discover the genes that regulate the development and function of DCs.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Antibodies</td>
		</tr>
		<tr>
			<td>APC/Cy7 anti-mouse CD11c Antibody</td>
			<td>Biolegend</td>
			<td>117324</td>
			<td>(Clone: N418)</td>
		</tr>
		<tr>
			<td>FITC anti-mouse/human CD11b Antibody</td>
			<td>Biolegend</td>
			<td>101206</td>
			<td>(Clone: M1/70)</td>
		</tr>
		<tr>
			<td>PE anti-mouse/human B220 Antibody</td>
			<td>Biolegend</td>
			<td>103208</td>
			<td>(Clone: RA3-6B2)</td>
		</tr>
		<tr>
			<td colspan="4">Cell culture</td>
		</tr>
		<tr>
			<td>1.5 mL Micro tube</td>
			<td>&#160;ExtraGene</td>
			<td>TUBE-170-C</td>
			<td></td>
		</tr>
		<tr>
			<td>12-well tissue culture-treated plate</td>
			<td>Falcon</td>
			<td>353043</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>Corning</td>
			<td>35-010-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 medium</td>
			<td>gibco</td>
			<td>11875-085</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Reagent</td>
		</tr>
		<tr>
			<td>&#946;-estradiol</td>
			<td>Sigma-Aldrich</td>
			<td>E2758-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-mercaptoethanol (&#946;-ME)</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td>home-made</td>
			<td></td>
			<td>Formula: 1xPBS+0.5 %FBS+0.1%NaN3</td>
		</tr>
		<tr>
			<td>Flt3 ligand (FL)</td>
			<td>home-made</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene</td>
			<td>Sigma-Aldrich</td>
			<td>TR-1003-G</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Invivogen</td>
			<td>ant-pr-1</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIsure</td>
			<td>BIOLINE</td>
			<td>BIO-38032</td>
			<td></td>
		</tr>
		<tr>
			<td>shRNA (Taregt sequence/clone ID)</td>
			<td>Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shId2&#160; (GCTTATGTCGAATGATAGCAA/TRCN0000054390)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro

Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided into conventional DCs (cDCs) and plasmacytoid DCs (pDCs). cDCs specializes in presenting antigens to and activate na&#239;ve T cells. On the other hand, pDCs can produce large quantities of type I interferons (IFN-I) during viral infection. The specification of DCs occurs at an early stage of DC progenitors in the bone marrow (BM) and is defined by a network of transcription factors (TFs). For example, cDCs highly express ID2, while pDCs highly express E2-2. Since more and more subsets of DCs are being identified, there is a growing interest in understanding specific TFs controlling DC development. Here, we establish a method to screen TFs critical for DCs differentiation in vitro by delivering lentivirus carrying short hairpin RNA (shRNA) into an immortalized hematopoietic stem and progenitor cell (iHSPCs) line. After the selection and in vitro differentiation, cDC and pDC potential of the stable knockdown cell lines are analyzed by flow cytometry. This approach provides a platform to identify genes potentially governing DC fates from progenitors in vitro.

The map of lentiviral vector pLKO.1-Puro is shown (Figure 1). After the delivery of lentivirus expressing shRNA against LacZ (a non-targeting control), Tcf4, and Id2 in iHSPCs, the knockdown efficiency confirmed by RT-qPCR revealed that the expression of Tcf4 was reduced in shTcf4 iHSPCs, compared to shLacZ iHSPCs (Figure 2A). On the other hand, the decreased expression of Id2 was also observed in sh...

Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Here we provide a protocol for screening potential transcription factors involved in the development of dendritic cell (DC) using lentiviral transduction of shRNA to obtain stable knockdown cell lines for in vitro DC differentiation.

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided ...

Dendritic cells, or DCs, are key immune cells linking the innate and adaptive immune system. While DCs are heterogeneous, this method help us understand which genes, including transcription factors, may regulate DC development. This technique provides a simple and quick way to identify a gene that controls DC development from their progenitor in vitro.To begin, maintain the immortalized hematopoietic stem and progenitor cells or iHSPCs in complete RPMI 1640 medium, supplemented with 100 nanograms per milliliter of the FLT3 ligand and one micromolar beta estradiol. For lentiviral transduction, plate the iHSPCs in 12 well plates at a density of one times 10 to the fifth cells per well and one milliliter of complete medium containing the FLT3 ligand, beta estradiol, and polybrene. Then, add the lentivirus carrying the short hairpin RNA in each well at a multiplicity of infection of 100.Next, spin the plate at 1100 times g and 37 degrees Celsius for 90 minutes, then incubate the infected cells overnight at 37 degree Celsius. The following day, remove the polybrene by collecting the cells into 15 milliliter tubes in centrifugation, following replacing the media with fresh complete medium containing the FLT3 ligand and beta estradiol. After an additional 24 hours, add six micrograms per milliliter of puromycin to the medium to select the infected cells.Replace the selection medium every three days and maintain the cells for at least one week to expand the stably transduced iHSPCs. Generate and maintain stable knockdown iHSPCs for LacZ, Tcf4, and Id2 in complete medium supplemented with the FLT3 ligand and beta estradiol. To initiate in vitro differentiation collect the undifferentiated iHSPCs into 15 milliliter tubes and pellet the cells by centrifugation.After centrifugation, discard the supernatant and wash the cells twice with 10 milliliters of PBS. After the second wash, resuspend the cells in complete medium containing only the FLT3 ligand then seed them at a density of two times 10 to the fifth sells per milliliter into a 12 well plate. After three days, add one milliliter of fresh complete medium containing the FLT3 ligand.After an additional two days, proceed to analyze the differentiated cells by flow cytometry. For flow cytometric analysis, pipette the cells up and down two to three times in the plate then collect the cells into 1.5 milliliter tubes. Centrifuge the tubes and discard the supernatant before resuspending the cells in 50 microliters of fax buffer.Next, add 50 microliters of anti-CD16 by 32 hybridoma supernatant and incubate for five to 10 minutes on ice. Then, add fluorescent dye-conjugated antibodies directly to the cells and incubate for 15 minutes on ice in the dark. After incubation, wash the cells with one milliliter of fax buffer and centrifuge the sample.After centrifugation, resuspend the cells in 100 microliters of fax buffer and analyze the samples by flow cytometry. After short hairpin RNA-mediated knockdown of LacZ, Tcf4, and Id2 in iHSPCS, confirmation of knockdown efficiency by RTQ-PCR showed that the expression of Tcf4 and Tcf4 knockdown iHSPCs was reduced compared to that in LacZ knockdown iHSPCs. Similar results were observed for Id2 expression in the Id2 knockdown iHSPCs.After culturing LacZ knockdown iHSPCs for five days, the frequency of CD11c positive cells, which represent the dendritic cell population, was around 95%However, knocking down Tcf4 or Id2 slightly decreased the generation of CD11c-positive dendritic cells. Further analysis of CD11c-positive dendritic cells derived from the LacZ knockdown iHSPCs revealed that 70%were conventional dendritic cells while 22%were plasmacytoid dendritic cells. The Tcf4 knockdown iHSPCs generated a significantly lower percentage of plasmacytoid dendritic cells that the LacZ knockdown controls.In contrast, the Id2 knockdown iHSPCs generated a significantly lower percentage of conventional dendritic cells than the LacZ knockdown controls but a higher percentage of plasmacytoid dendritic cells. Spin infections increase the transduction efficiency of lentivirus-carrying shRNA into the iHSPCs. This technique addresses the role of transcription factors and facilitates the study of other genes in cytokine signaling transduction or metabolism, which are likely to be involved in DC development.

Research

JoVE Journal

Immunology and Infection

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Analysis of Pulmonary Dendritic Cell Maturation and Migration during Allergic Airway Inflammation

Dendritic cells (DCs) are the key players involved in initiation of adaptive immune response by activating antigen-specific T cells. DCs are present in ...

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

Implant-associated infection is becoming more and more challenging to the healthcare industry worldwide due to increasing antibiotic resistance, ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Identifying DNA Mutations in Purified Hematopoietic Stem/Progenitor Cells

In recent years, it has become apparent that genomic instability is tightly related to many developmental disorders, cancers, and aging. Given that stem ...

Assessing the Development of Murine Plasmacytoid Dendritic Cells in Peyer's Patches Using Adoptive Transfer of Hematopoietic Progenitors

This protocol details a method to analyze the ability of purified hematopoietic progenitors to generate plasmacytoid dendritic cells (pDC) in intestinal ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

Neutrophils (PMN) are best known for their phagocytic functions against invading pathogens and microorganisms. They have the shortest half-life amongst ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...

Simultaneous Study of the Recruitment of Monocyte Subpopulations Under Flow In Vitro

The recruitment of monocytes from the blood to targeted peripheral tissues is critical to the inflammatory process during tissue injury, tumor development ...