Einzelkopien-Genlocus-Chromatin-Aufreinigung in Saccharomyces cerevisiae

Zusammenfassung

Dieses Protokoll stellt eine Locus-spezifische Chromatin-Isolierungsmethode vor, die auf ortsspezifischer Rekombination basiert, um einen interessierenden Single-Copy-Genlocus in seinem nativen Chromatinkontext aus knospender Hefe, Saccharomyces cerevisiae, zu reinigen.

Zusammenfassung

Die grundlegende Organisationseinheit des eukaryotischen Chromatins ist das Nukleosomenkernpartikel (NCP), das aus DNA besteht, die ~1,7-mal um ein Histon-Oktamer gewickelt ist. Chromatin ist definiert als die Entität von NCPs und zahlreichen anderen Proteinkomplexen, einschließlich Transkriptionsfaktoren, Chromatin-Remodeling und modifizierenden Enzymen. Es ist noch unklar, wie diese Protein-DNA-Interaktionen auf der Ebene spezifischer genomischer Loci in verschiedenen Stadien des Zellzyklus orchestriert werden. Dies ist vor allem auf die derzeitigen technischen Einschränkungen zurückzuführen, die es schwierig machen, präzise Messungen solcher dynamischen Wechselwirkungen zu erhalten. Hier beschreiben wir eine verbesserte Methode, die ortsspezifische Rekombination mit einem effizienten einstufigen Affinitätsreinigungsprotokoll kombiniert, um einen Genlocus von Interesse in seinem nativen Chromatinzustand zu isolieren. Die Methode ermöglicht die robuste Anreicherung des Zielortes über genomisches Chromatin, was diese Technik zu einer effektiven Strategie zur unvoreingenommenen und systematischen Identifizierung und Quantifizierung von Proteininteraktionen macht, z. B. durch Massenspektrometrie. Zusätzlich zu solchen Zusammensetzungsanalysen spiegelt natives Chromatin, das mit dieser Methode gereinigt wurde, wahrscheinlich die In-vivo-Situation in Bezug auf Nukleosomenpositionierung und Histonmodifikationen wider und ist daher für weitere strukturelle und biochemische Analysen von Chromatin zugänglich, das von praktisch jedem genomischen Locus in Hefe stammt.

Einleitung

Die dynamische Organisation eukaryotischer Genome in Chromatin verdichtet die DNA, um in die Grenzen des Zellkerns zu passen, während gleichzeitig eine ausreichende Dynamik für die Genexpression und die Zugänglichkeit für regulatorische Faktoren gewährleistet wird. Diese Vielseitigkeit wird zum Teil durch das Nukleosom vermittelt, die Grundeinheit des Chromatins, das aus einem Kernpartikel mit 147 bp DNA besteht, das ~1,7-mal um das Histon-Oktamer¹ gewickelt ist. Das Nukleosom ist eine hochdynamische Struktur in Bezug auf seine Zusammensetzung, mit zahlreichen Histonvarianten und posttranslationalen Modifikationen (PTMs) an den N- und C-termina....

Protokoll

In der Materialtabelle finden Sie Einzelheiten zu allen Materialien und Instrumenten, die in diesem Protokoll verwendet werden. In Tabelle 1 finden Sie eine Liste der verwendeten Lösungen, Puffer und Medien.

1. Rekombinanter Hefestammaufbau

1. Um einen rekombinationskompetenten Hefestamm zu konstruieren, transformieren Sie das SbfI-verdaute Plasmid K238 in einen Hefestamm mit integrierten LexA-Bindungsstellen und RS-Rekombinationsstellen am interessierenden Locus^13,14.
   HINWEIS: Das transformierte SbfI-Restriktionsfragment ....

Diskussion

Die Identifizierung der Faktoren und der Chromatinlandschaft einer bestimmten genomischen Zielregion stellt nach wie vor eine große Herausforderung in der Chromatinforschung^{dar 18}. Dieses Protokoll beschreibt ein effizientes System zur gezielten Exzision und Reinigung bestimmter Chromatindomänen aus Hefechromosomen. Unseres Wissens nach überwinden die Reinheit und Ausbeute dieser einstufigen Aufreinigung viele der Einschränkungen von Locus-spezifischen Chromatin-Aufreinigungsmethoden, wodurch .......

Materialien

Name	Company	Catalog Number	Comments
Yeast strains
Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see references 13 and 14
Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR			Section 1, see reference 13 and 14
Plasmid
K238 plasmid			Section 1, see reference 13 Storage: Store at -20 °C
K071 Spike-in plasmid DNA			Section 7.1, see reference 13 Storage: Store at -20 °C
Reagents
Acetone	Carl Roth	5025.1	Section 2 Storage: Store at room temperature
Ammonium acetate (NH4Ac)	Sigma Aldrich	A7262	Section 6 and 7.1 Storage: Store at room temperature
Ammonium solution (NH4OH) 25%	Merck Millipore	533003	Section 6 Storage: Store at room temperature
Ammonium sulfate	Santa Cruz	Sc-29085	Section 2 Storage: Store at room temperature
Bacto agar	BD (VWR)	90000-760	Section 3 Storage: Store at room temperature
Bacto peptone	BD (VWR)	211820	Section 3 Storage: Store at room temperature
β-Mercaptoethanol	Sigma Aldrich	07604	Section 7.2 Storage: Store at 4 °C
Chemiluminescent substrate kit	ThermoFisher	34580	Section 7.2 Storage: Store at 4 °C
Di-Sodium Hydrogen phosphate dodecahydrate	Merck	1.06579.1000	Section 2 and 7.1 Storage: Store at room temperature
Dithiothreitol (DTT)	ThermoFisher	15508013	Section 4 Storage: Store at 4 °C
Ethanol	Merck	100983	Section 7.1 Storage: Store at room temperature
Ethylenediaminetetraacetic acid (EDTA)	Sigma Aldrich	ED	Section 7.1 Storage: Store at room temperature
Galactose (20% (w/v) stock)	Sigma Aldrich	G0625-1KG  /  5KG	Section 3 Storage: Store at room temperature
Gel loading dye (6x)	BioLabs	B7024A	Section 7.1 Storage: Store at -20 °C
Glusose	Sigma-Aldrich	G8270	Section Storage: Store at room temperature
Glycine	Carl Roth	.0079.4	Section 2 Storage: Store at room temperature
Glycogen (5 mg/mL)	Invitrogen	AM9510	Section 7.1 Storage: Store at -20 °C
Hydrochloric acid (HCl)	PanReac AppliChem	182109.1211	Section 2, 4 and 7.1 Storage: Store at room temperature
Magnesium Acetate (MgAc)	Bernd Kraft	15274.2600/C035	Section 4 Storage: Store at room temperature
Magnesium chloride (MgCl2)	Sigma Aldrich	M8266	Section 6 Storage: Store at room temperature
Nu PAGE LDS sample buffer (4x)	Invitrogen	2399549	Section 7.2 Storage: Store at room temperature
Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v)	Invitrogen	15593-031	Section 7.1 Storage: Store at 4 °C
Potassium chloride (KCl)	Sigma	P9541	Section 4 Storage: Store at room temperature
Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL)	Hartmann Analytic	SRP-203	Section 7.1 Storage: Store at 4 °C
RadPrime labeling system	ThermoFisher	18428-011	Section 7.1 Storage: Store at -20 °C
Raffinose (20% (w/v) stock)	SERVA	34140.03	Section 3 Storage: Store at room temperature
Sodium chloride (NaCl)	Merck	K53710504142	Section 7.1 Storage: Store at room temperature
Sodium citrate (Na3C6H5O7)	Sigma-Aldrich	71402	Section 7.1 Storage: Store at room temperature
Sodium hydroxide (NaOH)	Sigma Aldrich	S5881	Section 7.1 Storage: Store at room temperature
Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) )	Alfa Aesar	A11183	Section 7.1 Storage: Store at room temperature
Sodium phosphate monobasic	Sigma-Aldrich	71496	Section 2 and 7.1 Storage: Store at room temperature
Sodium azide	Santa Cruz Biotechnology	sc-208393	Section 2 Storage: Store at -20 °C
Triethylamine	Sigma Aldrich	90340	Section 2 Storage: Store at room temperature
Tris base	Chem Cruz	SC-3715B	Section 2 and 4 Storage: Store at room temperature
Triton X-100	Sigma Aldrich	X100	Section 2 and 4 Storage: Store at room temperature
Tween-20	Bernd Kraft	18014332	Section 4 Storage: Store at room temperature
Yeast extract	BD (VWR)	212720	Section 3 Storage: Store at room temperature
Yeast mating factor alpha (1 µg/mL stock )	Biomol	Y2016.5	Section 3 Storage: Store at -20 °C
Yeast Synthetic Drop-out medium Supplements without LEUCINE	Sigma Aldrich	Y1376	Section 1, see reference 14
Enzymes
HpaI restriction enzyme (5,000 U/mL)	NEB	R0105S	Section 7.1 Storage: Store at -20 °C
Protease and Phosphatase Inhibitor Cocktail (100x)	ThermoFisher Scientific	78446	Section 4 Storage: Store at4 °C
Proteinase K (10 mg/mL)	SERVA	33756	Section 7.1 Storage: Store at -20 °C
RNase A (10 mg/mL)	ThermoFisher	EN0531	Section 7.1 Storage: Store at -20 °C
TEV protease (10000 U/µL)	NEB	P8112S	Section 5 Storage: Store at -20 °C
Materials
BcMag Epoxy-Activated Magnetic Beads	Bioclone Inc.	FC-102	Section 2 Storage: Store at 4 °C
Dry ice			Section 4
Low-binding centrifuge tubes 2.0 mL	Eppendorf	22431102	Section 4
Microspin G-25 Columns	Cytiva	27-5325-01	Section 7.1 Storage: Store at room temperature
Parafilm	Merck	P7793	Section 4
Positive nylon membrane	Biozol	11MEMP0001	Section 7.1 Storage: Store at room temperature
PVDF transfer membrane	Immobilon-Merck Millipore	IPVH00010	Section 7.2 Storage: Store at room temperature
SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm)	Invitrogen	NP0336BOX	Section 7.2 Storage: Store at 4 °C
Syringe (25 mL) with luer fitting	Henke Sass Wolf	4200-000V0	Section 3
Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet)	Cytiva	3030-917	Section 7.1 Storage: Store at room temperature
Antibodies
Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody	Merck Millipore	06-719	Section 7.2 Storage: Store at -20 °C
Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate	Invitrogen	G21234	Section 7.2 Storage: Store at -20 °C
Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins	Sigma Aldrich	P1291-500UL	Section 7.2 Storage: Store at -20 °C
Rabbit IgG antibodies	Sigma	I5006-100MG	Section 2 Storage: Store at 4 °C
Primers (10 µM)
ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT			Section 7.1
K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT			Section 7.1
PCR fragment from yeast genomic DNA as a template  for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT                                                  rev 5’- TTTGTTTATCTCATCACTAAT			Section 7.1
PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT			Section 7.1
Equipment
Coffee grinder	Gastroback	42601	Section 4
Dewar flask	NAL GENE	4150-2000	Section 3
DynaMag TM-2 magnetic rack	Invitrogen	12321D	Section 4, 5 and 6
Hybridization oven	Hybaid Mini10	Ri418	Section 2
Microcentrifuge	Eppendorf	5424R	Section 4 and 7.1
UV-crosslinker	Analytikjena	95-0174-02	Section 7.1