suppressing hepatitis b virus replication using viral antigen-specific t cells

Suppressing Hepatitis B Virus Replication Using Viral Antigen-Specific T Cells

For hydrodynamic HPV plasmid delivery through the tail vein, dilute 10 micrograms of HPV plasmid in an 8% equivalent of the body mass of PBS. Load the plasmid into one 3-milliliter syringe equipped with a 26-gauge half-inch needle per mouse.
Heat HHD mice under a heat lamp for five minutes to dilate the tail veins, and carefully pull a mouse into a plastic restrainer. Locate a dilated lateral tail vein in the middle third of the tail, and insert the needle parallel to the vein to deliver the entire volume of plasmid through the tail vein over a three to five-second period.
For viral antigen-specific iPSC-derived CD8-positive T cell adoptive cell transfer, collect the iPSC CD8-positive T cells on day 22 of culture as demonstrated and seed the cells onto a new 10-centimeter cell culture dish.
After 30 minutes in the cell culture incubator, filter the floating cells through a 70-micrometer nylon strainer, and count the viable cells. Dilute sells to a 1.5 x 107 cells per milliliter of PBS concentration.
Inject 200 microliters of cells into individual four to six-week-old HHD mice into the tail vein, as just demonstrated. On day 14 after cell transfer, perform a hydrodynamic HPV plasmid delivery as demonstrated.

suppressing-hepatitis-b-virus-replication-using-viral-antigen

Research

JoVE Encyclopedia of Experiments

Immunology

Immunotherapy

Cellular Immunotherapy

EoE Sub Articles

eoe sub articles

All procedures involving animal models have been reviewed by the local 
institutional animal care committee and the JoVE veterinary review board. All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
1. Generation of viral Ag-specific CD8+ T cells from iPSCs (iPSC-CD8+ T cells)
<ol>
	<li>Creation of the retroviral constructs 
	NOTE: T-cell receptor (TCR) &#945; and &#946; genes are linked with 2A self-cleaving sequence. The retroviral vector MSCV-IRES-DsRed (MiDR) is DsRed+.
	<ol>
		<li>Sub-clone HBs183-191 (FLLTRILTI)-specific A2-restricted human-murine hybrid TCR (s183 TCR) genes (V&#945;34 and V&#946;28) into the MiDR to create the s183 MiDR construct (Figure 1A).</li>
	</ol>
	</li>
	<li>Retroviral transduction 
	NOTE: The Platinum-E (Plat-E) cells are used for packaging retroviruses (carrying s183 TCR genes), which will be used for retroviral transduction. The Plat-E cells are effective retrovirus packaging cells underlying the 293T cells, which were developed by means of unique packaging constructs via the EF1&#945; promoter to express retroviral structure protein, including gag, pol, and ecotropic env.
	<ol>
		<li>On a 100 mm culture dish, seed 3 x 106 Plat-E cells in 8 mL of DMEM culture medium containing 10% fetal calf serum (FCS) in an incubator at 37 &#176;C with 5% CO2, 1 day before transfection.</li>
		<li>On day 0, transfect the s183 MiDR construct into the Plat-E cells using a DNA transfection reagent.</li>
		<li>On day 1, seed 1 x 106 iPSCs (green fluorescent protein [GFP]+) into a gelatin pre-coated culture plate.</li>
		<li>On days 2&#8211;3, collect retroviruses-containing supernatant from Plat-E cell culture to transduce iPSCs with the s183 TCR in the presence of 1,6-dibromohexane solution.</li>
		<li>On day 4, trypsinize the s183 TCR gene-transduced iPSCs, centrifuge at 400 x g for 5 min, and seed 3 &#215; 105 iPSCs in a 100 mm culture dish pre-coated with 3 x 106 irradiated SNL76/7 (irSNL76/7) feeder cells.</li>
		<li>On day 5 or 6 of confluence, trypsinize the cells, centrifuge at 400 x g for 5 min, and process for cell sorting. Gating on live cells, sort GFP and DsRED double-positive cells (the s183 TCR gene-transduced iPSCs) using a high-speed cell sorter. Similar to step 1.2.5, co-culture the sorted cells on irSNL76/7 feeder cells for future use.</li>
	</ol>
	</li>
	<li>Differentiation of HBV-specific iPSC-CD8+ T cells 
	&#8203;NOTE: The OP9-DL1/DL4 stromal cells overexpress both Notch ligands DL1 and DL4, and co-culturing iPSCs with the iPSCs can promote Notch signaling-mediated T cell differentiation.
	<ol>
		<li>Grow s183 TCR gene-transduced iPSCs (s183/iPSCs) in the OP9-DL1-DL4 cell monolayer in &#945;-minimum essential medium (MEM) media containing 20% fetal bovine serum (FBS). Include murine FMS&#8208;like tyrosine kinase 3 (Flt3) ligand (mFlt-3L; final concentration = 5 ng/mL) in the culture.</li>
		<li>On day 0, seed 0.5&#8211;1.0 x 105 S183/iPSCs in a 10 cm culture dish previously grown with OP9-DL1-DL4 cells. Validate that the OP9-DL1-DL4 cells are in a condition of 80%&#8211;90% confluency.</li>
		<li>On day 5, rinse the iPSCs with 10 mL of phosphate-buffered saline (PBS), aspirate off the PBS, add this to 4 mL of 0.25% trypsin, and incubate in a 37 &#176;C incubator for 10 min. Afterward, add a supplementary 8 mL of iPSC media to end trypsin digestion. Accumulate all the digestive solutions containing the cells and centrifuge at 400 x g for 5 min at 15&#8211;30 &#176;C.</li>
		<li>Aspirate the supernatant and resuspend cells in 10 mL of iPSC media. Transfer the cell suspension to a new 10 cm Petri plate and incubate in an incubator for 30 min at 37 &#176;C.</li>
		<li>After 30 min, collect the iPSC media containing the floating cells. Pass the cell suspension through a 70 &#956;m cell strainer and calculate the cell number.</li>
		<li>Seed 5 x 105 cells in the culture dish previously grown OP9-DL1-DL4 cells with a condition of 80%&#8211;90% confluent, as described in step 1.3.1. 
		NOTE: For T cell differentiation, each 2&#8211;3 days, the iPSC-derived cells need to re-seed with a fresh layer of the OP9-DL1-DL4 cells.</li>
	</ol>
	</li>
	<li>Evaluation
	<ol>
		<li>Morphological changes of differentiating iPSCs
		<ol>
			<li>Observe cells under a microscope on various days. 
			NOTE: By day 5, colonies have mesoderm-like characteristics, exhibiting a classic spindle-shaped morphology resembling human dermal fibroblasts and sustained growth in vitro. By day 8, small round clusters of cells begin to appear.</li>
		</ol>
		</li>
		<li>Analysis of differentiating iPSCs by flow cytometry
		<ol>
			<li>On various days of co-culture, analyze iPSC-derived cells as described previously (Figure 1B,C).</li>
		</ol>
		</li>
		<li>Functional analysis of differentiating iPSCs
		<ol>
			<li>On day 28 of co-culture, collect iPSC-CD8+ T cells from cultures by harvesting the floating cells, trypsinize the leftover cells with 0.25% trypsin, re-suspend in 8 mL of iPSC media, centrifuge for 5 min at 400 x g at 15&#8211;30 &#176;C, remove the media, then resuspend the cells in 10 mL of media.</li>
			<li>Keep the re-suspended cells in a fresh 10 cm dish in a 37 &#176;C incubator for 30 min and assemble the floating cells. Then rinse the cells one time with a cold PBS.</li>
			<li>Incubate 3 x 106 T cell-depleted splenocytes (CD4-CD8-) from spleens of H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice with 5 &#181;M s183 peptide (FLLTRILTI) in 200 &#956;L of media at 4 &#176;C for 30 min.</li>
			<li>Produce a mixture of iPSC-CD8+ T cells with splenocytes pulsed with s183 peptide (T cells: splenocytes = 1:4; use 0.75 x 106 T cells). Incubate the mixture of cells at 37 &#176;C in a CO2 incubator for 40 h. During the last 7 h, add 4 &#181;L of diluted brefeldin A into the culture (final concentration of 1,000x, which will be diluted in 1x culture media) to block transport processes during cell activation.</li>
			<li>Stain the cells and perform flow cytometric analysis of intracellular Interferon-gamma (IFN-&#947;) as described previously (Figure 2).</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Induction of HBV replication through hydrodynamic delivery of HBV plasmid
NOTE: pAAV/HBV1.2 construct was generated as described previously. The HBV 1.2 complete DNA is incorporated in the vector pAAV.
<ol>
	<li>Hydrodynamic deliveries of HBV plasmid through the tail vein
	<ol>
		<li>Heat HHD mice using a heat lamp for 5 min in the cage in order to dilate the tail vein.</li>
		<li>Detain the animal by means of a restrainer, and clean mouse tails with 70% ethanol spray.</li>
		<li>Delivery of plasmid into the liver.</li>
		<li>Measure the mouse&#39;s body weight by using a measuring scale.</li>
		<li>Dilute 10 &#956;g of HBV plasmid in the 8% equivalent of body mass PBS (e.g., 1.6 mL for a 20 g mouse). Load diluted plasmid in a 3 mL syringe with a 26 G &#215; 1&#8260;2&#8243; (0.45 &#215; 12 mm) hypodermic needle.</li>
		<li>Locate one of the two lateral tail veins in the middle third of the tail and position the needle into either lateral vein. Administer the injection containing HBV plasmid through the tail vein within 3 - 5 s.</li>
	</ol>
	</li>
	<li>Quantification of viremia from blood serum of infected mice 
	NOTE: HBV replication occurs from day 3&#8211;35 in the mouse serum. The DNA replication peaks on day 7 and reduces gradually. The HBV DNA is not cleared from the serum until day 35.
	<ol>
		<li>Collection of blood serum from infected mice
		<ol>
			<li>Collect approximately 0.1 mL of blood in a microcentrifuge tube from each mouse on 3, 5, 7, and 10 days post-infection by retro-orbital bleeding in a 1.5 mL microcentrifuge tube, then incubate at room temperature (RT) for 20 min.</li>
			<li>Centrifuge the sample at 6,000 x g for 15 min at 4 &#176;C and collect the serum supernatant after centrifugation.</li>
		</ol>
		</li>
		<li>Purify the DNA from the blood serum using a commercially available DNA extraction kit following the manufacturer&#39;s recommendations. Briefly, lyse the cells in a silica-based column, perform the washes, and extract DNA by adding 100% ethanol to the elution column and centrifuging at 6000 x g for 1 min. Elute the DNA in 50 &#181;L of RNase-free water.</li>
		<li>Use 100 ng of HBV DNA from the elution for real-time PCR analysis. Use the following primers and probes: forward 5&#39; TAGGAGGCTGTAGGCATAAATTGG 3&#39;; reverse 5&#39; GCACAGCTTGGAGGCTTGT 3&#39;; probe 5&#39; TCACCTCTGCCTAATC 3&#39;.
		<ol>
			<li>Use the HBV genome containing plasmid (pAAV/HBV1.2) for the standard curve and perform real-time PCR in a total volume of 10 &#956;L (Figure 3).</li>
		</ol>
		</li>
		<li>Set up the PCR reaction in a total volume of 10 &#956;L, as shown in Table 1.</li>
		<li>Set up the PCR program in the thermocycler, as shown in Table 2. The programmed temperature transition rate is 20 &#176;C/s for denaturation/annealing and 5 &#176;C/s for extension. Measure the fluorescence at the end of the annealing phase for each cycle for real-time PCR monitoring.</li>
	</ol>
	</li>
</ol>
3. Reduction of HBV replication by ACT of viral Ag-specific iPSC-CD8+ T cells
<ol>
	<li>Adoptive cell transfer (ACT)
	<ol>
		<li>Differentiate s183/iPSCs (1.3.7) upon the OP9-DL1-DL4 stromal cells in the presence of mFlt-3L and mIL-7 for 8 days, as described in section 1.3.</li>
		<li>On day 22, collect iPSC-CD8+ T cells from the 10 cm plate with trypsin, then wash and resuspend each 10 cm plate in 10 mL of fresh media. Add the cells to a fresh 10 cm plate and return to the incubator for 30 min, as done in section 1.3. After 30 min, collect floating cells.</li>
		<li>Use a 70 &#956;m nylon strainer to pass cells to eliminate cell clusters and count the cell number. Adapt the cells to a concentration of 1.5 x 107 cells/mL in cold PBS solution and use a 70 &#956;m nylon strainer to pass cells to eliminate cell clusters again if needed. Keep cells on ice until the ACT.</li>
		<li>Inject 200 &#956;L cell suspension (3 x 106 cells) into 4&#8211;6 week-old HHD mice through the tail vein.</li>
	</ol>
	</li>
	<li>Induction of HBV replication
	<ol>
		<li>On day 14 after cell transfer, perform the hydrodynamic delivery of HBV plasmid through the tail vein as described in section 2.1.</li>
	</ol>
	</li>
</ol>
Table 1: PCR reaction volume
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>DNA template</td>
			<td>2 ml</td>
		</tr>
		<tr>
			<td>DNA master hybridization mixture ((Taq DNA polymerase, PCR reaction buffer, 10 mM MgCl2, and dNTP mixture)</td>
			<td>1 ml</td>
		</tr>
		<tr>
			<td>25 mM MgCl2</td>
			<td>0.8 ml</td>
		</tr>
		<tr>
			<td>0.3 &#956;M the probe</td>
			<td>3 ml</td>
		</tr>
		<tr>
			<td>5 &#956;M of each primer</td>
			<td>3.2 ml</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>10 ml</td>
		</tr>
	</tbody>
</table>
Table 2: PCR program
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Denaturation</td>
			<td>Temperature 
			95 &#176;C</td>
			<td>Time 
			5 s</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>53 &#176;C</td>
			<td>10 s</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72 &#176;C</td>
			<td>20 s</td>
		</tr>
		<tr>
			<td></td>
			<td>5 &#176;C</td>
			<td></td>
		</tr>
	</tbody>
</table>

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>HHD mice</td>
			<td>Institut Pasteur, Paris, France</td>
			<td></td>
			<td>H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice</td>
		</tr>
		<tr>
			<td>iPS-MEF-Ng-20D-17</td>
			<td>RIKEN Cell Bank</td>
			<td>APS0001</td>
			<td></td>
		</tr>
		<tr>
			<td>SNL76/7</td>
			<td>ATCC</td>
			<td>SCRC-1049</td>
			<td></td>
		</tr>
		<tr>
			<td>OP9</td>
			<td>ATCC</td>
			<td>CRL-2749</td>
			<td></td>
		</tr>
		<tr>
			<td>pAAV/HBV1.2 plasmid</td>
			<td>Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan)</td>
			<td></td>
			<td>HBV DNA construct</td>
		</tr>
		<tr>
			<td>HBs183-91(s183) (FLLTRILTI)-specific TCR genes</td>
			<td>Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada)</td>
			<td></td>
			<td>FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (V&#945;34 and V&#946;28)</td>
		</tr>
		<tr>
			<td>OVA257&#8211;264-specific TCR genes</td>
			<td>Dr. Dario A. Vignali (University of Pittsburgh, PA)</td>
			<td></td>
			<td>SIINFEKL-specific H-2Kb-restricted TCR genes</td>
		</tr>
		<tr>
			<td>Anti-CD3 (17A2) antibody</td>
			<td>Biolegend</td>
			<td>100236</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-CD44 (IM7) antibody</td>
			<td>BD Pharmingen</td>
			<td>103012</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-CD4 (GK1.5) antibody</td>
			<td>Biolegend</td>
			<td>100408</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-CD8 (53-6.7) antibody</td>
			<td>Biolegend</td>
			<td>100732</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-IFN-&#947; (XMG1.2) antibody</td>
			<td>Biolegend</td>
			<td>505810</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-TNF-a (MP6-XT22) antibody</td>
			<td>Biolegend</td>
			<td>506306</td>
			<td></td>
		</tr>
		<tr>
			<td>&#945;-MEM</td>
			<td>Invitrogen</td>
			<td>A10490-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-HBs antibody</td>
			<td>Thermo Fisher</td>
			<td>MA5-13059</td>
			<td></td>
		</tr>
		<tr>
			<td>ACK Lysis buffer</td>
			<td>Lonza</td>
			<td>10-548E</td>
			<td></td>
		</tr>
		<tr>
			<td>Brefeldin A</td>
			<td>Sigma</td>
			<td>B7651</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Invitrogen</td>
			<td>ABCD1234</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Hyclone</td>
			<td>SH3007.01</td>
			<td></td>
		</tr>
		<tr>
			<td>FACSAria Fusion cell sorter</td>
			<td>BD</td>
			<td>656700</td>
			<td></td>
		</tr>
		<tr>
			<td>Gelatin</td>
			<td>MilliporeSigma</td>
			<td>G9391</td>
			<td></td>
		</tr>
		<tr>
			<td>GeneJammer</td>
			<td>Agilent</td>
			<td>204130</td>
			<td></td>
		</tr>
		<tr>
			<td>HLA-A201-HBs183-91-PE pentamer</td>
			<td>Proimmune</td>
			<td>F027-4A - 27</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP Anti-Mouse Secondary Antibody</td>
			<td>Invitrogen</td>
			<td>A27025</td>
			<td></td>
		</tr>
		<tr>
			<td>mFlt-3L</td>
			<td>Peprotech</td>
			<td>250-31L</td>
			<td></td>
		</tr>
		<tr>
			<td>mIL-7</td>
			<td>Peprotech</td>
			<td>217-17</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease S7</td>
			<td>Roche</td>
			<td>10107921001</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>MilliporeSigma</td>
			<td>P6148-500G</td>
			<td>Caution: Allergenic, Carcenogenic, Toxic</td>
		</tr>
		<tr>
			<td>Permeabilization buffer</td>
			<td>Biolegend</td>
			<td>421002</td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene</td>
			<td>MilliporeSigma</td>
			<td>107689</td>
			<td></td>
		</tr>
		<tr>
			<td>ProLong&#8482; Gold Antifade Mountant with DAPI</td>
			<td>Invitrogen</td>
			<td>P36931</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAamp MinElute Virus Spin Kit</td>
			<td>Qiagen</td>
			<td>57704</td>
			<td></td>
		</tr>
	</tbody>
</table>

Source: Xiong, X., et al. <a href="https://app.jove.com/v/60043">Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice.</a> J. Vis. Exp. (2019).
The video demonstrates an assay using human induced pluripotent stem cell (iPSC)-derived CD8+ T cells to inhibit hepatitis B virus (HBV) replication in mice. These T cells, engineered with HBV-specific receptors, are transferred into transgenic mice. Replication-competent HBV genome plasmids are then injected directly into the liver, enabling viral DNA uptake. Once viral antigens are expressed and presented by hybrid MHC-I molecules, the engineered T cells recognize and bind to these complexes. This triggers the release of cytotoxic molecules, resulting in the destruction of HBV-infected liver cells and suppression of viral replication.

<img alt="Figure 1" src="/files/ftp_upload/22236/22236_Figure1.jpg" /> 
Figure 1: Generation of HBV viral Ag-specific iPSC-CD8+ T cells.
Mouse iPSCs are transduced with the following retroviral constructs: HBs183-91 TCR (MiDR-s183 TCR) or OVA257&#8211;264 TCR (MiDR-OVA TCR), and the transduced iPSCs are co-cultured with OP9-DL1/DL4 stromal cells for T lineage differentiation. (A) Schematic representation of the retroviral constr...

All procedures involving animal models have been reviewed by the local
institutional animal care committee and the JoVE veterinary review board. All ...

Take T cells with receptors that bind to the antigens of hepatitis B virus, or HBV.
Inject the T cells into the tail vein of a mouse.
Allow the injected cells to spread in the liver.
To mimic virus infection, take plasmids carrying the HBV genome.
Inject the plasmids rapidly into the tail vein, directing the plasmids into the liver.
The force of the liquid permeabilizes the vessel endothelium and generates temporary pores in the cells.
The plasmids enter the cell and undergo RNA synthesis, producing mRNA that is used for viral protein production.
Some of these proteins act as viral antigens.
The antigen-presenting molecules carry the viral antigens to the cell surface, exposing them to the T cells.
These immune cells interact with the viral antigens and initiate mechanisms to eliminate the infected cells, inhibiting viral protein assembly and spreading.

22 vistas. Supresión de la replicación del virus de la hepatitis B mediante linfocitos T específicos de antígenos virales

Video: Supresión de la replicación del virus de la hepatitis B mediante linfocitos T específicos de antígenos virales - Experimento

Isolation Protocol of Mouse Monocyte-derived Dendritic Cells and Their Subsequent In Vitro Activation with Tumor Immune Complexes

Dendritic cells (DC) are heterogeneous cell populations that differ in their cell membrane markers, migration patterns and distribution, and in their antigen presentation and T cell activation capacities. Since most vaccinations of experimental tumor models require millions of DC, they are widely isolated from the bone marrow or spleen. However, these DC significantly differ from blood and tumor DC in their responses to immune complexes (IC), and presumably to other Syk-coupled lectin receptors. Importantly, given the sensitivity of DC to danger-associated molecules, the presence of endotoxins or antibodies that crosslink activation receptors in one of the isolating steps could result in the priming of DC and thus affect the parameters, or at least the dosage, required to activate them. Therefore, here we describe a detailed protocol for isolating MoDC from blood and tumors while avoiding their premature activation. In addition, a protocol is provided for MoDC activation with tumor IC, and their subsequent analyses.

Isolation Protocol of Mouse Monocyte-derived Dendritic Cells and Their Subsequent In Vitro Activation with Tumor Immune Complexes

Monocyte-derived DC (MoDC) can sense minor amounts of danger-associated molecules and are therefore easily primed. We provide a detailed protocol for the isolation of MoDC from blood and tumors and their activation with immune complexes while highlighting key precautions that should be considered in order to avoid their premature activation.

Protocolo de aislamiento de células dendríticas derivadas de monocitos de ratón y su activación posterior In Vitro con complejos inmunes Tumor

Dendritic cells (DC) are heterogeneous cell populations that differ in their cell membrane markers, migration patterns and distribution, and in their ...

Investigación

JoVE Journal

Investigación sobre el cáncer

Manufacturing Chimeric Antigen Receptor (CAR) T Cells for Adoptive Immunotherapy

Adoptive immunotherapy holds promise for the treatment of cancer and infectious disease. We describe a simple approach to transduce primary human T cells with chimeric antigen receptor (CAR) and expand their progeny ex vivo. We include assays to measure CAR expression as well as differentiation, proliferative capacity and cytolytic activity. We describe assays to measure effector cytokine production and inflammatory cytokine secretion in CAR T cells. Our approach provides a reliable and comprehensive method to culture CAR T cells for preclinical models of adoptive immunotherapy.

Manufacturing Chimeric Antigen Receptor CAR T Cells for Adoptive Immunotherapy

We describe an approach to reliably generate chimeric antigen receptor (CAR) T cells and test their differentiation and function in vitro and in vivo.

Fabricación de células T del receptor de antígeno quimérico (CAR) para inmunoterapia adoptiva

Adoptive immunotherapy holds promise for the treatment of cancer and infectious disease. We describe a simple approach to transduce primary human T cells ...

Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors

We describe here a method to obtain functional spinal and cranial motor neurons from human induced pluripotent stem cells (iPSCs). Direct conversion into motor neuron is obtained by ectopic expression of alternative modules of transcription factors, namely Ngn2, Isl1 and Lhx3 (NIL) or Ngn2, Isl1 and Phox2a (NIP). NIL and NIP specify, respectively, spinal and cranial motor neuron identity. Our protocol starts with the generation of modified iPSC lines in which NIL or NIP are stably integrated in the genome via a piggyBac transposon vector. Expression of the transgenes is then induced by doxycycline and leads, in 5 days, to the conversion of iPSCs into MN progenitors. Subsequent maturation, for 7 days, leads to homogeneous populations of spinal or cranial MNs. Our method holds several advantages over previous protocols: it is extremely rapid and simplified; it does not require viral infection or further MN isolation; it allows generating different MN subpopulations (spinal and cranial) with a remarkable degree of maturation, as demonstrated by the ability to fire trains of action potentials. Moreover, a large number of motor neurons can be obtained without purification from mixed populations. iPSC-derived spinal and cranial motor neurons can be used for in vitro modeling of Amyotrophic Lateral Sclerosis and other neurodegenerative diseases of the motor neuron. Homogeneous motor neuron populations might represent an important resource for cell type specific drug screenings.

Conversion of Human Induced Pluripotent Stem Cells iPSCs into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors

This protocol allows rapid and efficient conversion of induced pluripotent stem cells into motor neurons with a spinal or cranial identity, by ectopic expression of transcription factors from inducible piggyBac vectors.

Conversión de células madre pluripotentes inducidas por humanos (IPSC) en neuronas motoras craneales y espinales funcionales usando vectores PiggyBac

We describe here a method to obtain functional spinal and cranial motor neurons from human induced pluripotent stem cells (iPSCs). Direct conversion into ...

Suppressing Hepatitis B Virus Replication Using Viral Antigen-Specific T Cells

Transcripción

Suppressing Hepatitis B Virus Replication Using Viral Antigen-Specific T Cells