Name: preparation and in vitro characterization of magnetized mir-modified endothelial cells
Uploaded: 2017-05-02T14:00:00
Description: Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

We would like to thank G. Fulda (Electron Microscopy Center, Rostock University, Germany) for the technical support in acquiring TEM images of filtered superparamagnetic nanoparticles and in performing their X-ray analysis. The work carried out at the RTC Rostock was supported by the Federal Ministry of Education and Research Germany (FKZ 0312138A, FKZ 316159 and VIP+03VP00241) and the State Mecklenburg-Western Pomerania with EU Structural Funds (ESF/IV-WM-B34-0030/10 and ESF/IV-BM-B35-0010/12) and by the DFG (DA 1296-1), the Damp-Foundation, and the German Heart Foundation (F/01/12). Frank Wiekhorst was supported by the EU FP7 research program "Nanomag" FP7-NMP-2013-LARGE-7.

Human umbilical cords for cell isolation were obtained postpartum from informed, healthy women who gave their written consent to the use of this material for research according to the Declaration of Helsinki. The ethical committee of the University of Rostock has approved the presented study (reg. No. A 2011 06, prolonged 23 September, 2013).
1. Preparation of Transfection Complexes
<ol>
	<li>Biotinylation of polyethyleneimine (PEI).
	<ol>
		<li>Dissolve branched PEI in ultrapure wa...

The production of genetically engineered cells loaded with superparamagnetic nanoparticles for their further magnetically controlled guidance is presented in the current protocol. The successful application of this strategy allows for the resolution of some difficulties of cell therapy, such as low retention and poor engraftment in the injured area2,3,4, by providing a targetable cell product for transplantation. Moreover, the s...

Gene and cell therapy are powerful tools that have the potential to solve current challenges in CVD treatment. Despite the fact that both of these approaches are currently being tested in clinical trials, they are not yet ready for wide clinical application1. Notably, a common approach to tackle the challenges of gene and cell therapy is to develop multifunctional gene delivery vectors suitable for clinical application. The lack of safe and efficient gene delivery systems is the main concern of gene therapy. At the same time, the genetic engineering of cellular products prior to transplantation could overcome the serious challenges of cell therapy, such as low efficiency (e.g., in the cardiac field, only ~ 5% of functional improvement is achieved post-stem cell transplantation1) and poor retention/engraftment at the site of injury (i.e.,cell retention drops below 5 - 10% within minutes to hours post-application, regardless of the administration route2,3,4).
To date, viral vectors greatly exceed non-viral systems in terms of efficiency, which has resulted in their wider application in clinical trials (~ 67%)5. However, viral vehicles carry serious risks, such as immunogenicity (and the subsequent inflammatory response, with severe complications), oncogenicity, and limitations in the size of the carried genetic material6. Due to these safety concerns and the high costs of viral vector production, the use of non-viral systems is preferable in certain cases7,8. It is particularly suitable for disorders that require transient genetic correction, such as the expression of growth factors controlling angiogenesis (e.g., for CVD treatment) or the delivery of vaccines.
In our group, a delivery system was designed by combining branched 25-kDa polyethyleneimine (PEI) and superparamagnetic iron oxide nanoparticles (MNP) bound together by biotin-streptavidin interaction9. This vector is a potential tool for the genetic engineering of cells, allowing for their simultaneous magnetization prior to transplantation. The latter provides a basis for magnetic guidance/retention, which is particularly promising nowadays, as advanced magnetic targeting techniques are being successfully developed10. Moreover, the resulting magnetically responsive cells have the potential to be non-invasively monitored by magnetic resonance imaging (MRI) or magnetic particle imaging11,12.
In the case of the PEI/MNP vector, polyamine ensures nucleic acid condensation and thus protection from degrading factors, vector internalization in cells, and endosomal escape5. The MNPs complement the properties of PEI, not only in terms of magnetic guidance, but also by reducing the known PEI toxicity7,13,14. Previously, PEI/MNP vector properties were adjusted in terms of delivery efficiency (i.e., pDNA and miRNA) and safety by using fibroblasts and human mesenchymal stem cells15,16.
In this manuscript, a detailed protocol on the application of PEI/MNPs for the generation of miRNA-modified cells is described17. For this purpose, HUVECs are used and represent an established model for in vitro angiogenesis. They are challenging to transfect and are susceptible to toxic influence18,19,20. In addition, we provide an algorithm to evaluate such cells in vitro, including their targeting, intercellular communication, and MRI detection.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene and cell therapies are highly promising alternative approaches for CVD treatment. However, the broad clinical application of gene therapy is greatly limited by the lack of suitable gene delivery systems. The development of appropriate gene delivery vectors can provide a solution to current challenges in cell therapy. In particular, existing drawbacks, such as limited efficiency and low cell retention in the injured organ, could be overcome by appropriate cell engineering (i.e., genetic) prior to transplantation. The presented protocol describes the efficient and safe transient modification of endothelial cells using a polyethyleneimine superparamagnetic magnetic nanoparticle (PEI/MNP)-based delivery vector. Also, the algorithm and methods for cell characterization are defined. The successful intracellular delivery of microRNA (miR) into human umbilical vein endothelial cells (HUVECs) has been achieved without affecting cell viability, functionality, or intercellular communication. Moreover, this approach was proven to cause a strong functional effect in introduced exogenous miR. Importantly, the application of this MNP-based vector ensures cell magnetization, with accompanying possibilities of magnetic targeting and non-invasive MRI tracing. This may provide a basis for magnetically guided, genetically engineered cell therapeutics that can be monitored non-invasively with MRI.

The main purpose of the proposed protocol is to produce magnetically responsive miR-modified cells and to conduct their accurate characterization (Figure 1). As a result, efficiently transfected cells, responsive to magnetic selection and guidance and detectable with MRI, should be obtained.
First, the identities of isolated HUVECs were confirmed by typical staining with the endothelial marker CD31 (PECAM) (<str...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

This manuscript describes the efficient, non-viral delivery of miR to endothelial cells by a PEI/MNP vector and their magnetization. Thus, in addition to genetic modification, this approach allows for magnetic cell guidance and MRI detectability. The technique can be used to improve the characteristics of therapeutic cell products.

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

The overall goal of this procedure is to introduce a technique which ensures cell modification with microRNA and in parallel cell magnetization. This method can address key challenges in the regenerative medicine field. Such as genetic engineering of cells prior to transplantation.In addition to efficient cell modification with microRNA, they allowed it with iron oxide. This can be used for enhancing cell retention in the side of interest by magnetic field application. Cell therapy is very promising for the treatment of heart diseases, hypocell retention, and to cell survival urgently need to be improved.Begin this procedure with human umbilical vein endothelial cell culture in preparation of transfection complexes as described in the text protocol. 48 hours prior to transfection, seed the HUVECs on plastic cell culture well plates of suitable size. With a starting cell density of approximately 13, 000 cells per square centimeter of growth surface.Next, prepare fresh miR/polyethyleneimene/super paramagnetic iron oxide nanoparticles. First dilute 2.5 picomoles of microRNA per square centimeter of cell growth surface and five percent glucose solution to obtain a final concentration of 0.125 picomoles of microRNA per microliter. Next, dilute the PEI in an equal volume of five percent glucose solution.Add the diluted PEI to the microRNA solution and vortex the obtained mixture for 30 seconds. Then incubate the miR/PEI mixture for 30 minutes at room temperature. Sonicate the MNP's for at least 20 minutes in the sonicating water bath at room temperature.Then add the appropriate amount of MNP solution to the ready miR/PEI mixture. After vortexing for 30 seconds, incubate for 30 minutes at room temperature. Next add the prepared miR/PEI/MNP mixture drop-wise directly to the culture medium on the cells.Replace this mixture with fresh culture medium six hours post-transfection. After analysis of vector safety as described in the text protocol, confirm and characterize the intracellular localization of transfection complexes by confocal and super-resolution structured illumination microscopy. To do so, seed the HUVECs on gelatin-coated glass cover slips placed in the wells of 24-well culture plates as before.Transfect the cells with 3-color labeled miR/PEI/MNP and incubate for 24 hours at 37 degrees Celsius in a humidified atmosphere containing five percent carbon dioxide. Wash the cover slips first with two percent bovine serum albumin and phosphate buffered saline, and then with just PBS. Fix the cells by incubating in four percent paraformaldehyde or PFA at 37 degrees Celsius for 15 minutes.Wash with PBS and then stain the nuclei with DAPI following standard protocols. Then wash the cells with PBS three times 15 minutes on the shaker to remove excess dye. Place the prepared cover slips on microscope slides using suitable mounting medium and let the slides dry for at least one hour before using them for microscopy.Acquire images using a 63 times oil immersion objective in the SIM settings found in the text protocol. For cell targeting and simulated dynamic conditions in vitro, first transfect the HUVECs into 24-well plate as before. After incubating them for 24 hours, wash the cells.Then add one x trips in EDTA diluted in PBS and incubate the cells for four minutes at 37 degrees Celsius before collecting the cells. Centrifuge the collected cells at 300 times G for 10 minutes. Mix the cell pellet obtained from one well with one milliliter of fresh culture medium.And transfer the cells to a single well of a 12-well plate. Fix a small magnet locally using tape. Place the culture plate on the shaker and incubate the cell suspension for 12 hours at 150 RPM to simulate dynamic conditions.Then wash the cells and fix them using four percent PFA. Stain the nuclei with DAPI. Record the cell attachment using laser scanning confocal microscopy with 405 and 504 teen-nanometer excitation lasers in z-stack mode to obtain the raw data.Use maximum intensity projection image processing to create images for analysis. For quantitative analysis of magnetically reponsive and non-responsive cells, first transfect the HUVECs in a 24-well plate. Incubate the cells for 24 hours before washing and collecting the cells as described before.Re-suspend the cell pellet obtained from each well with 500 microliters of warmed sterile cell-sorting buffer. Apply the cell suspension to a magnetic sorting column fixed by the supplied magnet. Then wash the columns on the magnet three times with fresh cell-sorting buffer.Collect the flow-through as the magnetically unresponsive fraction. Remove the columns from the magnet and immediately collect the magnetically responsive cell fraction by pushing fresh cell-sorting buffer thought the column using a plunger. Centrifuge both Mag-and Mag+fractions at 300 times G for 10 minutes.After re-suspending the cell pellet in PBS, count the cells and evaluate cell viability with a trypan blue exclusion assay. Isolated from umbilical cords, HUVECs are characterized by the expression of the endothelial marker CD31 and by formation of tubes on a basement membrane matrix. HUVECs transfected with miR/PEI/MNP all take up tagged miR.And their survival remains unaffected 24 hours post-transfection. In addition super-resolution microscopy shows paranuclear localization of 3-color labeled transfection complexes. PEI toxicity is confirmed by the diminished functionality of miR/PEI transfected cells.Importantly, MNP restores cell properties. miR/PEI/MNP modified cells do not differ from untreated cells in terms of tube formation. Moreover, these cells maintain intercellular gap junctional communication as revealed through fluorescence recovery after photo-bleaching.Once a suspension of miR/PEI/MNP modified cells is seeded in the wells of a culture plate placed on the rotating shaker, cells tend to migrate and attach in the area of local magnet application. Representative images depict cell growth in the area with magnet application. Without magnet application.And in the center of the culture well where the flow of liquid was concentrating the cells. Once mastered, cell transfection can be performed in two hours. After watching this video you should have a very good impression on how to transiently but highly-efficiently modify endothelial cells including the magnetization.And also how to terminally characterize the cell product. While attempting this procedure, it is important to follow given numbers for cell-seeding amounts of components for the preparation of transfection complexes, incubation time, and the washing step after the transfection. We are very optimistic that this approach will be well-transferrable to other cell types for the treatment of other affected organs.Following this procedure in vivo studies with modified magnetized cells can be performed. They could answer additional questions whether iron-loading of cells is efficient to ensure their retention in the side of interest. And also to define the limits of detection with MRI in vivo.

Research

JoVE Journal

Medicine

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...