Name: mapping genome-wide accessible chromatin in primary human t lymphocytes by atac-seq
Uploaded: 2017-11-13T13:00:00.000+00:00
Duration: 9 min 8 s
Description: Watch this Scientific Journal Video about Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq at JoVE.com

Este trabajo es apoyado por la Israel Science Foundation (grant 748/14), Marie Curie de integración otorga (CIG) - FP7-gente-20013-CIG-618763 y I-CORE programa de planificación y Comisión de presupuesto y el Israel Science Foundation beca nº 41/11.

todos los procedimientos fueron aprobados por la Junta de revisión institucional de la Universidad de Bar Ilan y el protocolo sigue pautas proporcionadas por el Comité de aprobación de los experimentos de.
 1. purificación de ingenuo CD4 + las células humanas y polarización T Helper 1 (Th1) y las células Th2 Nota: aquí se describe el procedimiento a partir de las células mononucleares de sangre periférica humana congelada (PBMCs). El primer paso consiste en aislar las células CD4 + con microesferas y columnas que generalmente dan nosotros más del 95% de células CD4 +. Sin embargo, este paso puede variar según el protocolo recomendado: en cada laboratorio. El protocolo de activación de la célula T y la polarización fue modificado de Jenner et al. (2009) 18. aislamiento de CD4 + células de 10 millones de PBMCs de da lugar a 4 millones de células CD4 +. Se divide en dos matraces y cultivadas en Th1 y polarización Th2 condiciones rendimiento 3 millones células Th1 y Th2 en sólo una semana.
 Nota: enfriar el centrifugar a 4 ° C antes de empezar.
<ol><li>ML 1 descongelar de PBMCs humanos (10 7 células) en un tubo de 50 mL que contiene 10 mL de Medio RPMI suplementado con 1% de penicilina-estreptomicina, 2 mM L-glutamina y 10% suero bovino fetal inactivado por calor. Centrifugar a 500 x g por 5 min, retirar el sobrenadante y resuspender las células con una pipeta estéril 25 mL en 15 mL de Medio RPMI suplementado. Transferencia de las células (con una pipeta de 25 mL estéril) a un matraz de cultivo T75.</li>
	<li>Deja las células durante la noche en una incubadora humidificada (37 ° C, 5% CO 2).</li>
	<li>Transferir las células flotantes con una pipeta 25 mL estéril para tubo de 50 mL. Determinar el numero de celular y viabilidad por exclusión del azul tripán.</li>
	<li>Aislar CD4 + células de 10 millones vive no adherente PBMCs por selección positiva con CD4 + microesferas y columnas según el fabricante &#39; recomendaciones de s (véase Tabla de materiales y equipos) con las siguientes modificaciones: 10 7 PBMCs están marcados con 30 μl de microesferas de CD4 en 120 μl de 0.5% de BSA en PBS.</li>
	<li>Activan las células T CD4 + 72 h de rhIL-2 (10 ng/mL), enlazado a la placa anti-CD3 (5 μg/mL) y anti-CD28 soluble (2 μg/mL). Para la polarización Th1, añadir rhIL-12 (20 ng/mL) y anti-IL-4 (10 μg/mL). Para la polarización Th2, añadir rhIL-4 (40 ng/mL) y anti-IFN-γ (10 μg/mL).</li>
	<li>Las células de la cultura para otros 7 días en presencia de rhIL-2 (10 ng/mL) y las mismas citoquinas polarizantes (rhIL-12 de Th1 y Th2 rhIL-4).</li>
</ol> 2. Aislamiento de núcleos Nota: ATAC-seq se realiza con núcleos intactos. Lysis buffer que contiene 0,05% nonylphenyl polietilenglicol (véase Tabla de materiales y equipos) se calibró para aislar los núcleos de las células humanas primarias de la Th1 y Th2. Recomendamos este paso con las células y reactivos de laboratorio de calibración. Un exceso de células intactas de detergente insuficiente disminuye la eficiencia de la reacción de transposición. Eficacia de lisis de la célula es determinada por el número de núcleos (las células positivas trypan azul) con respecto al número total de células. 
Nota: Preparar el tampón de lisis (10 mM Tris-HCl, pH 7,5, 10 mM de NaCl, 3 mM MgCl 2). Enfriar una centrífuga con un rotor de columpio-cubo a 4 ° C. las células en una centrifugadora de swing-cubo en lugar de una centrífuga de ángulo fijo de granulación reduce la pérdida de núcleos de célula. Para evitar los núcleos o pérdida de la célula, pipetee cuidadosamente cuando descartando el sobrenadante.
<ol><li>Agregar nonylphenyl fresco polietilenglicol (a una concentración final de 0.05%) y 100 x inhibidores de la proteasa (para una concentración final de 1 x) en el búfer de lisis fría inmediatamente antes del uso. Mantener el buffer en hielo.</li>
	<li>Las células de T de conteo para determinar su cantidad y viabilidad utilizando el método de azul tripán. Viabilidad que es menor que 90% de resultados en mayor digestión inespecífica.</li>
	<li>Transferencia de 0.5 x 10 6 T células (Th1 o Th2) en microtubos de 1.5 mL. Desactivación a 500 x g durante 5 min a 4 ° C.</li>
	<li>Resuspender el precipitado de células en 1 mL de frío con tampón fosfato (PBS) una solución salina. Desactivación a 500 x g durante 5 min a 4 ° C.</li>
	<li>Resuspender el precipitado de células en 1 mL de tampón de lisis frío (contiene polietilenglicol nonylphenyl e inhibidores de la proteasa). Mantenga el tubo en hielo. Pipeta suavemente para evitar distorsionar los núcleos.</li>
	<li>Tomar 10 μl y contar las células con un contador de células automatizado mientras el microtubo con las células sometidas a lisis en hielo rápidamente. Este paso no debe exceder de cinco minutos para evitar daños en los núcleos. Por lo menos el 80% de las células debe ser lisis.</li>
	<li>Continuar inmediatamente con la reacción de transposición. Mantener los núcleos dispuestos en el hielo.</li>
</ol> 3. Reacción de transposición Nota: en este paso, núcleos aislados se incuban con procariótico Tn5 transposasa (TDE1) cargado con adaptadores para la secuencia de NGS. Hiperactiva Tn5 simultáneamente fragmentos de ADN y ligates adaptadores en regiones accesibles del genoma (proceso tagmentation). La relación entre núcleos y Tn5 transposasa es crítica para escote preferencial en cromatina accesible. Este protocolo está calibrado para 100.000 núcleos en un volumen de reacción de 100 μL. Sin embargo, la reacción puede ser reducida.
<ol><li>Temperatura en una coctelera termal a 37 ° C.</li>
	<li>100.000 transferencia de núcleos en un microtubo de 1.5 mL.</li>
	<li>Centrifugar a 500 x g por 10 min a 4 ° C y con cuidado quite el sobrenadante.</li>
	<li>Añadir los componentes de la reacción de transposición a los núcleos como especificado en la tabla 1.</li>
	<li>Resuspender mediante pipeteo suave.</li>
	<li>Incubar la reacción de transposición en una coctelera termal a 37 ° C por 30 min con suave agitación (500 rpm). 
	Nota: Limpieza de ADN se realiza por inmovilización reversible fase sólida granos 19 (véase Tabla de materiales y equipos) o PCR purificación columnas. Al final de la limpieza, eluir los fragmentos de ADN en 20 μl de 10 mM Tris-HCl, pH 8. Evitar el EDTA en el tampón de elución.</li>
</ol> 4. Enriquecimiento de la polimerización en cadena de ATAC-seq bibliotecas Nota: este paso se pretende amplificar los ATAC-seq biblioteca es decir, fragmentos de ADN con los adaptadores de insertado. Para permitir la mezcla de varias bibliotecas de ATAC-seq en el mismo carril de secuenciación de última generación (&#34; multiplexación &#34;) uso cartilla 1 (Ad1_noMx) 1 para todas las muestras y otra indexadas (con código de barras) cartilla 2 (Ad 2.1-2.24) 1 para cada muestra. Las secuencias de la cartilla se proporcionan en el suplido de Tabla de materiales y equipos.
<ol><li>Amplificación PCR inicial Nota: la concentración de trabajo de la cartilla 1 (Ad1_noMx) y Primer 2 es 25 μm. Los cebadores se diluyen de la acción original de 100 μm a 25 μm. En todas las reacciones de polimerización en cadena, utilice la cartilla 1 (Ad1_noMx) y sólo uno de los 2 Primer indexadas.
	<ol><li>Agregar los componentes de la reacción de PCR como especificado en la tabla 2 a un tubo estéril de la PCR.</li>
		<li>PCR lugar tubo en un termociclador y realizar la amplificación por PCR utilizando el ciclismo condiciones detalladas en la tabla 3.</li>
	</ol></li> <li>Evaluación del número de ciclos de amplificación adicional Nota: el número de ciclos PCR adicionales debe producir una cantidad suficiente de biblioteca fragmentos fo una secuencia de generación exitosa ejecutar, mientras que reduce al mínimo para evitar GC y tamaño diagonal 20. La determinación del número de ciclos PCR (N) necesaria para la amplificación del fragmento de biblioteca óptima se realiza por PCR cuantitativa (qPCR).
	<ol><li>Diluir cartillas 1 (Ad1_noMx) y 2 (utilizado para la amplificación inicial de la biblioteca) de 25 μm a 6,25 μm.</li>
		<li>Añadir los componentes ópticos tubos PCR o una placa como se indica en el cuadro 4.</li>
		<li>En un instrumento de qPCR y ciclo especificado en tabla 5.</li>
		<li>Para estimar el número de ciclos de amplificación adicional (N), parcela número del ciclo en el eje x y la fluorescencia relativa (RFU) en el eje y.</li>
		Ciclos de <li>la cantidad de amplificación adicional (N) es 1/3 del número de ciclos en que la reacción de qPCR alcanzó la meseta. figura 2 proporciona ejemplos para tres bibliotecas de ATAC-seq que alcanzaron la meseta ~ 2.350 unidades de fluorescencia relativa, RFU (línea verde gruesa). El número de ciclos PCR en el cual se amplifica un tercio de la cantidad máxima (RFU 783, marcado en el eje y) corresponde a 8 ciclos de dos de las bibliotecas (curvas de amplificación de rojo y azul) y 9 ciclos PCR para la tercer biblioteca (rosa).</li>
	</ol></li> <li>Amplificación PCR final <ol><li>amplificar las restantes 45 μl de la reacción de PCR. Coloque un tubo PCR que contiene la reacción de amplificación del paso 4.1.2 en un termociclador. Ejecute el programa PCR descrito en la tabla 6. Utilice el número previamente determinado (paso 4.2.5) de ciclos de amplificación (N).</li>
	</ol></li></ol> 5. Tamaño de selección de bibliotecas de ATAC-Seq Nota: en nuestra experiencia, selección del tamaño de bibliotecas de ATAC-seq amplificadas mejora resultados de secuenciación de próxima generación ya que elimina fragmentos de biblioteca de alto peso molecular de la Biblioteca de ATAC-seq final. 
Nota: Deje que las bolas magnéticas a temperatura ambiente 30 minutos antes de su uso. 
Preparar fresca 70% de etanol en agua libre de nucleasa.
<ol><li>Suspender las bolas magnéticas mediante la mezcla de.</li>
	<li>Añadir agua libre de nucleasa a las bibliotecas de ATAC-seq (obtenidas en paso 4.3.1.) y llevar hasta 100 μl.</li>
	<li>Añadir 50 μl (0,5 x) de granos magnéticos resuspendidos de ADN a 100 μl del amplificado bibliotecas. Mezclar mediante pipeteo arriba y abajo por lo menos 10 veces. Incubar las muestras durante 5 minutos a temperatura ambiente. Si es necesario, girar rápidamente por los microtubos.</li>
	<li>Coloque el tubo sobre un soporte magnético apropiado durante 2 min separar las bolas magnéticas en el sobrenadante. Después de 2 min, transferir el sobrenadante a un microtubo nuevo.</li>
	<li>Medir el volumen del sobrenadante mediante pipeteo y añadir 0,7 x de bolas magnéticas. Mezclar mediante pipeteo arriba y abajo por lo menos 10 veces.</li>
	<li>Incubar 5 min a temperatura ambiente. Lugar en un soporte magnético para 2 minutos</li>
	<li>Incubación de después de los 2 minutos, descartar el sobrenadante. Añadir etanol al 70% 200 μL recién hechos para lavar los granos mientras que los tubos están en el soporte magnético.</li>
	<li>Mantener el microtubo en el imán durante 30 s y descartar entonces el etanol. Repita el paso 5.7.for dos lavados de etanol final.</li>
	<li>Eliminar completamente el resto de etanol y dejar que los granos deje secar al aire durante 5 minutos mientras que el tubo está en el imán. Si es necesario, girar brevemente el microtubo. Eliminar los restos de etanol con una pipeta p10.</li>
	<li>Quitar el microtubo del imán y agregar 22 μL de 10 mM Tris-HCl, pH 8. No eluir las bibliotecas ATAC-seq en tampón que contiene EDTA.</li>
	<li>Incubar los tubos durante 2 min a temperatura ambiente y luego coloque en el soporte magnético.</li>
	<li>Cuando la solución esté clara, transferir μl 20 bibliotecas eluídas a un nuevo microtubo estéril.</li>
	<li>Tienda el tamaño seleccionado bibliotecas ATAC-seq-20 ° C.</li>
</ol> 6. Análisis de la calidad de las bibliotecas de ATAC-Seq <ol><li>validación de la calidad de las bibliotecas ATAC-seq por PCR en tiempo real Nota: es importante evaluar la relación señal a ruido de las bibliotecas de ATAC-seq antes de próxima generación secuencia. Esto se hace mediante la determinación de la cantidad relativa de fragmentos de ADN de loci accesibles e inaccesibles mediante PCR cuantitativa (qPCR). Los lugares inaccesibles (control negativo, chr1:48, 137, 860-48,137,934 y chr1:193, 093, 748-193,093,827) son amplificadas por pares de la cartilla 1 y 2. Los loci accesibles (control positivo, chr19:30, 336, 166-30,336,253 y chr19:11546154-11546237) son amplificadas por pares cartilla 3 y 4. Loci positivos y negativos se definieron perfiles de accesibilidad (DHS-seq) de la cromatina de células CD4 + humanas (ENCODE accesiones ENCSR000EQE y ENCSR000EQG). Primer negativo 1 está situado en una región intergénica heterochromatic grande (230 kb de TRADB2 y 88 kb de FOXD2). Control negativo región 2 está en el primer intrón del gen CDC73. Positivo primer par 3 es dentro de una región de cromatina abierta corriente abajo del gen ciclina E (CCNE1) mientras par primer positivo 4 se centra en el promotor de la proteína quinasa C sustrato 80K-H (PRKCSH). Lo importante, estos loci de control muestran un patrón similar de la accesibilidad en otros tipos de células humanas del proyecto ENCODE 3, sugiriendo que pueden ser aplicados para monitorear ATAC-seq bibliotecas de un amplio espectro de tipos de células humanas. Primer eficiencia y especificidad de todos los pares de la cartilla fue verificado por qPCR en una dilución seriada de la DNA genomic (a partir de células humanas de la Th) y un análisis de curva de fusión de productos amplificados obtenidos.
	<ol><li>Aislar ADN genómico utilizando comercialmente disponible kit (véase Tabla de materiales y equipos).</li>
		<li>Diluir la ATAC-seq amplificado biblioteca 1:10 (1 μl librería + 9 μl de agua libre de nucleasas) y el ADN genómico a ~ 5 ng/μl.</li>
		<li>Preparar la mezcla de reacción (Tabla 7) para cada par de la cartilla de control positivo y negativo, teniendo en cuenta que las reacciones se llevan a cabo por triplicado.</li>
		<li>Incubar en qPCR termociclador según el protocolo recomendado por qPCR master mix proveedor.</li>
		<li>Analizar los resultados en qPCR instrumento &#39; software de s (véase Tabla de materiales y equipos). Elegir el ADN genómico como una muestra de control. Los valores obtenidos representan un enriquecimiento de las regiones accesibles (amplificados por cartillas de control positivo). Un ejemplo se muestra en la Tabla 8. 
		Nota: Estimación del tamaño de la biblioteca media y concentración: la distribución de tamaño de fragmentos de ADN de ATAC-seq bibliotecas está determinada por sistemas de electroforesis automatizada de alta sensibilidad según el fabricante &#39; instrucciones. Es aconsejable medir la concentración de la muestra en un fluorómetro usando dsDNA kit de alta sensibilidad y por lo menos 2 μl de cada muestra de ADN. 
		Nota: Secuenciación de próxima generación - antes de las bibliotecas de la multiplexación, calcular la molaridad de cada biblioteca de ATAC-seq utilizando la fórmula: (ng/μl x 10 6) / (660 x media biblioteca fragmento de longitud). Busca &#62; Lee 30 millones de cada biblioteca de ATAC-seq para evaluar la cromatina abierta regiones de muestras humanas. Si desea determinar si la biblioteca es suficiente para la secuencia de NGS, inicialmente como objetivo Lee 10 millones (5% de la línea de la secuencia en instrumento de secuenciación de DNA en modo carrera rápido). Tenga en cuenta que para deducir nucleosoma posicionamiento, secuencia final emparejado es necesario 1.</li>
	</ol></li></ol> 7. Análisis de los resultados de secuenciación de próxima generación obtenidos <ol><li>deducir la calidad de las lecturas de secuenciación mediante la inspección de los archivos FastQC, por separado para cada biblioteca.</li>
	<li>Alinee la lee al genoma humano de referencia (hg19 Asamblea) utilizando Bowtie 21 software en el entorno Unix/Linux. El comando es &#39; pajarita -m 1 - q -S genoma directorio reads.fastq output_aligned.sam &#39;. Directorio de genoma representa la carpeta donde se almacenan los índices de genoma de corbatín. El parámetro -m 1 es para no permitir que la alineación de Lee a más de un lugar geométrico en genoma, - q es para el archivo de entrada que debe estar en formato fastq -S es para la salida que está en formato SAM.</li>
	<li>Quitar duplicado Lee con SAMtools 22 rmdup opción en el entorno Unix/Linux. Los comandos son &#39; samtools ve output_aligned.sam -b -S | samtools tipo -o-output_aligned &#62; output_aligned.bam &#39;, samtools rmdup -s output_aligned.bam output_aligned _rmdup.bam &#39;. El primer comando, vista, cambia el formato de SAM en formato de BAM que entonces se ordena. La opción de rmdup se aplica sobre el archivo clasificado de BAM. Opcionalmente se puede ajustar la Lee para el sitio de inserción del transposón, como se describe en el papel original de ATAC-seq 1. Esto se hace usando BEDtools comandos 23 en el entorno Unix/Linux. Los comandos son &#39; bamToBed -i output_aligned _rmdup.bam &#62; output_aligned _rmdup.bed &#39;, &#39; shiftBed -i genoma de output_aligned _rmdup.bed -p 4 - m-5 - g &#62; output_aligned _rmdup_adjusted.bed &#39;. El primer comando, bamTobed, cambia el formato de la BAM en formato de cama que puede utilizarse para el comando shiftBed. El genoma es un archivo delimitado de ficha que contiene la longitud de cada cromosoma en el genoma. El archivo se agrega generalmente en el directorio BEDtools.</li>
	<li>Realizar llamadas de pico mediante el análisis basado en el modelo de ChIP-seq (MACS2) 24 software en el entorno Unix/Linux el archivo cambiado de puesto de la cama con los siguientes parámetros:--nomodel--extsize 75--cambio -30. Estos parámetros se utilizan para ajustar las lecturas para que el sitio de inserción del transposón está en el centro de cada secuencia de la lectura.</li>
</ol>

<ol>
	<li>Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposition+of+native+chromatin+for+fast+and+sensitive+epigenomic+profiling+of+open+chromatin,+DNA-binding+proteins+and+nucleosome+position.">Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position.</a> Nat Methods. 10 (12), 1213-1218 (2013).</li><li>Buenrostro, J. D., Wu, B., Chang, H. Y., Greenleaf, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATAC-seq:+A+method+for+assaying+chromatin+accessibility+genome-wide.">ATAC-seq: A method for assaying chromatin accessibility genome-wide.</a> Curr Protoc Mol Biol. , 21.29.1-21.29.9 (2015).</li><li>Thurman, R. E., Rynes, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+accessible+chromatin+landscape+of+the+human+genome.">The accessible chromatin landscape of the human genome.</a> Nature. 489 (7414), 75-82 (2012).</li><li>Song, L., Crawford, G. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNase-seq:+a+high-resolution+technique+for+mapping+active+gene+regulatory+elements+across+the+genome+from+mammalian+cells.">DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells.</a> Cold Spring Harb Protoc. (2), (2010).</li><li>Simon, J. M., Giresi, P. G., Davis, I. J., Lieb, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+formaldehyde-assisted+isolation+of+regulatory+elements+(FAIRE)+to+isolate+active+regulatory+DNA.">Using formaldehyde-assisted isolation of regulatory elements (FAIRE) to isolate active regulatory DNA.</a> Nat Protoc. 7 (2), 256-267 (2012).</li><li>Cui, K., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-Wide+Approaches+to+Determining+Nucleosome+Occupancy+in+Metazoans+Using+MNase-Seq.">Genome-Wide Approaches to Determining Nucleosome Occupancy in Metazoans Using MNase-Seq.</a> Methods Mol Biol. 833, 413-419 (2012).</li><li>Qu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Individuality+and+Variation+of+Personal+Regulomes+in+Primary+Human+T+Cells.">Individuality and Variation of Personal Regulomes in Primary Human T Cells.</a> Cell Syst. 1 (1), 51-61 (2015).</li><li>Scharer, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATAC-seq+on+biobanked+specimens+defines+a+unique+chromatin+accessibility+structure+in+na&#239;ve+SLE+B+cells.">ATAC-seq on biobanked specimens defines a unique chromatin accessibility structure in na&#239;ve SLE B cells.</a> Sci Rep. 6, 27030 (2016).</li><li>Seb&#233;-Pedr&#243;s, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Dynamic+Regulatory+Genome+of+Capsaspora+and+the+Origin+of+Animal+Multicellularity.">The Dynamic Regulatory Genome of Capsaspora and the Origin of Animal Multicellularity.</a> Cell. 165 (5), 1224-1237 (2016).</li><li>Lu, Z., Hofmeister, B. T., Vollmers, C., DuBois, R. M., Schmitz, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combining+ATAC-seq+with+nuclei+sorting+for+discovery+of+cis-regulatory+regions+in+plant+genomes.">Combining ATAC-seq with nuclei sorting for discovery of cis-regulatory regions in plant genomes.</a> Nucleic Acids Res. 45 (6), e41 (2016).</li><li>Davie, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+Transcription+Factors+and+Regulatory+Regions+Driving+In+Vivo+Tumor+Development+by+ATAC-seq+and+FAIRE-seq+Open+Chromatin+Profiling.">Discovery of Transcription Factors and Regulatory Regions Driving In Vivo Tumor Development by ATAC-seq and FAIRE-seq Open Chromatin Profiling.</a> PLOS Genet. 11 (2), (2015).</li><li>Villar, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancer+Evolution+across+20+Mammalian+Species.">Enhancer Evolution across 20 Mammalian Species.</a> Cell. 160 (3), 554-566 (2015).</li><li>Lara-Astiaso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+state+dynamics+during+blood+formation.">Chromatin state dynamics during blood formation.</a> Science. 345 (6199), 943-949 (2014).</li><li>Prescott, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancer+Divergence+and+cis-Regulatory+Evolution+in+the+Human+and+Chimp+Neural+Crest.">Enhancer Divergence and cis-Regulatory Evolution in the Human and Chimp Neural Crest.</a> Cell. 163 (1), 68-83 (2015).</li><li>Wu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+landscape+of+accessible+chromatin+in+mammalian+preimplantation+embryos.">The landscape of accessible chromatin in mammalian preimplantation embryos.</a> Nature. 534 (7609), 652-657 (2016).</li><li>Buenrostro, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+chromatin+accessibility+reveals+principles+of+regulatory+variation.">Single-cell chromatin accessibility reveals principles of regulatory variation.</a> Nature. 523 (7561), 486-490 (2015).</li><li>Corces, M. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lineage-specific+and+single-cell+chromatin+accessibility+charts+human+hematopoiesis+and+leukemia+evolution.">Lineage-specific and single-cell chromatin accessibility charts human hematopoiesis and leukemia evolution.</a> Nat Genet. 48 (10), 1193-1203 (2016).</li><li>Jenner, R. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+T-bet+and+GATA-3+control+alternative+pathways+of+T-cell+differentiation+through+a+shared+set+of+target+genes.">The transcription factors T-bet and GATA-3 control alternative pathways of T-cell differentiation through a shared set of target genes.</a> Proc Natl Acad Sci USA. 106 (42), 17876-17881 (2009).</li><li>DeAngelis, M. M., Wang, D. G., Hawkins, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solid-phase+reversible+immobilization+for+the+isolation+of+PCR+products.">Solid-phase reversible immobilization for the isolation of PCR products.</a> Nucleic Acids Res. 23 (22), 4742-4743 (1995).</li><li>Aird, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+and+minimizing+PCR+amplification+bias+in+Illumina+sequencing+libraries.">Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries.</a> Genome Biol. 12 (2), R18 (2011).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Li, H., Handsaker, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+Analysis+of+ChIP-Seq+(MACS).">Model-based Analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Meyer, C. A., Shirley Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+and+mitigating+bias+in+next-generation+sequencing+methods+for+chromatin+biology.">Identifying and mitigating bias in next-generation sequencing methods for chromatin biology.</a> Nat Rev Genet. 15 (11), 709-721 (2014).</li><li>He, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refined+DNase-seq+protocol+and+data+analysis+reveals+intrinsic+bias+in+transcription+factor+footprint+identification.">Refined DNase-seq protocol and data analysis reveals intrinsic bias in transcription factor footprint identification.</a> Nat Methods. 11 (1), 73-78 (2013).</li><li>Madrigal, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+Accounting+for+Sequence-Specific+Bias+in+Genome-Wide+Chromatin+Accessibility+Experiments:+Recent+Advances+and+Contradictions.">On Accounting for Sequence-Specific Bias in Genome-Wide Chromatin Accessibility Experiments: Recent Advances and Contradictions.</a> Front Bioeng Biotechnol. 3, 1-4 (2015).</li><li>Qin, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChiLin:+a+comprehensive+ChIP-seq+and+DNase-seq+quality+control+and+analysis+pipeline.">ChiLin: a comprehensive ChIP-seq and DNase-seq quality control and analysis pipeline.</a> BMC Bioinformatics. 17 (1), (2016).</li><li>Bao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+ATAC-seq+approach+reveals+lineage-specific+reinforcement+of+the+open+chromatin+landscape+via+cooperation+between+BAF+and+p63.">A novel ATAC-seq approach reveals lineage-specific reinforcement of the open chromatin landscape via cooperation between BAF and p63.</a> Genome Biol. 16 (1), 284 (2015).</li><li>Maurano, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+localization+of+common+disease-associated+variation+in+regulatory+DNA.">Systematic localization of common disease-associated variation in regulatory DNA.</a> Science. 337 (6099), 1190-1195 (2012).</li></ol>

Los autores no tienen nada que revelar.

El protocolo de ATAC-seq descrito aquí se ha empleado con éxito para el análisis de la cromatina accesible en células primarias (humano Th1, Th2 células y células B) así como las líneas de cultivo de células (células de cáncer de mama humanas MCF10A y células de glioblastoma U261). Aplicación de ATAC-seq a otros tipos celulares puede requerir algunos optimización de protocolo, especialmente en el paso de lisis. Si la concentración de detergente no iónico es demasiado alta, puede haber un porcentaje mayor ...

ATAC-seq1,2 es un método robusto que permite la identificación del regulador3 regiones de cromatina abierta y posicionamiento de nucleosoma. Esta información se aplica para inferir la ubicación, identidad y actividad de factores de transcripción. Sensibilidad del método para la medición de las variaciones cuantitativas en la estructura de la cromatina permite el estudio de la actividad de factores de la cromatina, remodeladores de cromatina y modificadores, así como la actividad transcripcional del RNA polimerasa II1. Así ATAC-seq proporciona un enfoque imparcial y poderoso para descifrar los mecanismos que rigen la regulación transcripcional en cualquier tipo de célula de interés. Se describe la adaptación de ATAC-seq a células Th1 y Th2 humanas primarias.
En ATAC-seq, hiperactiva Tn5 transposasa cargado con adaptadores para secuenciación de próxima generación (NGS) parejas fragmentación del ADN con el marcaje de ADN con adaptadores (es decir, el proceso de "tagmentation")1. Tras amplificación por PCR, las bibliotecas de ADN resultantes están listas para secuenciación de próxima generación (figura 1). El tagmentation preferencial de la cromatina accesible es detectado por el análisis del enriquecimiento local de Lee de la secuencia seq ATAC.
El procedimiento experimental corto y el requisito de menos material de partida, en comparación con otros métodos para medir la accesibilidad de la cromatina y posicionamiento nucleosomal como DNasa-seq4, FAIRE-seq5y MNase-seq6, ha promovió el uso de ATAC-seq en varios sistemas biológicos como células primarias humanas1,7 y8de las muestras clínicas, así como organismos unicelulares9, plantas10, moscas de la fruta11 y varios mamíferos12.
La identidad de la transcripción de factores que están limitados a lugares accesibles pueden ser descubiertos por analizar el enriquecimiento de sus motivos de secuencia de unión o combinación de ATAC-seq con inmunoprecipitación de cromatina (ChIP) seguida de alto rendimiento (de secuenciación de ADN ChIP-seq). Este enfoque permitió la identificación de factores de transcripción específicos del linaje importantes de hematopoyesis en ratón13. El carácter imparcial y global de ATAC-seq permite estudiar la regulación de los genes en organismos que no están disponibles reactivos, tales como anticuerpos para el análisis de la viruta. Por ejemplo, variaciones evolutivas en cis-se han identificado regiones reguladoras mediante el estudio de las células de cresta neural craneal de los seres humanos y los chimpancés14, desarrollo variaciones en elementos reguladores durante temprano ratón embriogénesis de15, cambios en el panorama regulatorio durante un ciclo de vida de unicelulares owzarzaki C.9y la evolución de los promotores y potenciadores en mamíferos 20 especies12.
ATAC-seq también ha sido instrumental para la medición de accesibilidad de la cromatina en las células, así revela la variabilidad dentro de poblaciones celulares, que generalmente evade genoma estudios7,16. Además, ATAC-seq puede utilizarse para estudiar los cambios que se producen en regiones reguladoras de DNA en condiciones de enfermedad, en la cual las muestras son raras. Por ejemplo, ATAC-seq puede utilizarse para estudiar los cambios en el panorama regulatorio durante el inicio de la leucemia mieloide aguda (AML)17 o Ras-conducido de la oncogénesis11.

<table><tbody><tr><td>50 mL tubes</td><td>Lumitron</td><td>LUM-CFT011500-P</td><td>Can be from other vendors.</td></tr><tr><td>Microtubes</td><td>Axygen Inc</td><td>MCT-175-C</td><td>Can be from other vendors.</td></tr><tr><td>25 mL serological pipettes</td><td>Corning Costar</td><td>4489</td><td>Can be from other vendors.</td></tr><tr><td>Tissue culture flask</td><td>Lumitron</td><td>LUM-TCF-012-250-P</td><td>Can be from other vendors.</td></tr><tr><td>Countes Automated Cell Counter</td><td>Invitrogen</td><td>C10227</td><td></td></tr><tr><td>NucleoSpin Tissue</td><td>MACHEREY-NAGEL</td><td>740952.5</td><td></td></tr><tr><td>Peripheral blood mononuclear cells&amp;nbsp;(PBMC)</td><td>ATCC</td><td>&amp;nbsp;PCS&amp;shy;800&amp;shy;011</td><td>Can be from other vendors.</td></tr><tr><td>RPMI 1640 Medium</td><td>Biological Industries</td><td>01-103-1A</td><td>Can be from other vendors.</td></tr><tr><td>L-Glutamine Solution (200 mM)</td><td>Biological Industries</td><td>03-020-1B</td><td>Can be from other vendors.</td></tr><tr><td>Penicillin-Streptomycin</td><td>Biological Industries</td><td>03-031-1B</td><td>Can be from other vendors.</td></tr><tr><td>Fetal Bovine Serum (FBS),&amp;nbsp;Heat Inactivated, European Grade</td><td>Biological Industries</td><td>04-127-1</td><td>Can be from other vendors.</td></tr><tr><td>MACS CD4 microbeads, human</td><td>Miltenyi Biotec</td><td>130-045-101</td><td></td></tr><tr><td>MACS MS columns</td><td>Miltenyi Biotec</td><td>130-042-201</td><td></td></tr><tr><td>Anti-Human CD4 FITC</td><td>Biogems</td><td>06121-50</td><td></td></tr><tr><td>Mouse IgG1 Isotype Control FITC</td><td>Biogems</td><td>44212-50</td><td></td></tr><tr><td>Anti-Human CD3 (OKT3)</td><td>Tonbo biosciences</td><td>40-0037</td><td></td></tr><tr><td>Anti-Human CD28 SAFIRE Purified</td><td>Biogems</td><td>10311-25</td><td></td></tr><tr><td>Recombinant Human IL2</td><td>Peprotech</td><td>200-02</td><td></td></tr><tr><td>Recombinant Human IL4</td><td>Peprotech</td><td>200-04</td><td></td></tr><tr><td>Recombinant Human IL12 p70</td><td>Peprotech</td><td>200-12</td><td></td></tr><tr><td>In Vivo Ready Anti-Human IL-4 (MP4-25D2)</td><td>Tonbo</td><td>40-7048</td><td></td></tr><tr><td>LEAF&amp;nbsp;Purified anti-human IFN-&amp;gamma;</td><td>BioLegend</td><td>506513</td><td></td></tr><tr><td>NaCl, analytical grade</td><td>Carlo Erba</td><td>479687</td><td>Can be from other vendors.</td></tr><tr><td>Magnesium chloride, Hexahydrate, molecular biology grade</td><td>Calbiochem</td><td>442611</td><td>Can be from other vendors.</td></tr><tr><td>EDTA</td><td>MP Biomedicals</td><td>800682</td><td>Can be from other vendors.</td></tr><tr><td>Tris, ultra pure, 99.9% pure</td><td>MP Biomedicals</td><td>819620</td><td>Can be from other vendors.</td></tr><tr><td>NP-40 alternative (Nonylphenyl Polyethylene Glycol)</td><td>Calbiochem</td><td>492016</td><td>Can be from other vendors.</td></tr><tr><td>Protease Inhibitors</td><td>Sigma</td><td>P2714</td><td>this protease inhibitor coctail is a powder. To make 100 x solution dilute in 1 mL of molecular-biology grade water.</td></tr><tr><td>Magnetic solid phase reverse immobilization beads: AMPure XP beads</td><td>Beckman</td><td>63881</td><td></td></tr><tr><td>PCR purification kit</td><td>HyLabs</td><td>EX-GP200</td><td>Can be from other vendors.</td></tr><tr><td>Nextera DNA Library Preparation Kit (TDE1 transposase and TD buffer)</td><td>Illumina</td><td>FC-121-1030</td><td></td></tr><tr><td>NEBNext High-Fidelity 2 x PCR Master Mix</td><td>New England BioLabs</td><td>M0541</td><td></td></tr><tr><td>NEBNext Q5 Hot Start HiFi PCR Master Mix</td><td>New England BioLabs</td><td>M0543</td><td></td></tr><tr><td>SYBR Green I&amp;nbsp;</td><td>Invitrogen</td><td>S7585</td><td></td></tr><tr><td>&amp;nbsp;CFX Connect Real-Time PCR&amp;nbsp;Detection&amp;nbsp;System</td><td>Bio-rad</td><td>185-5200</td><td>Can be from other vendors.</td></tr><tr><td>CFX Manager Software</td><td>Bio-rad</td><td>1845000</td><td></td></tr><tr><td>master mix for qPCR: iTaq Universal SYBR Green Supermix</td><td>Bio-rad</td><td>172-5124</td><td>Can be from other vendors.</td></tr><tr><td>Qubit fluorometer 2.0</td><td>Invitrogen</td><td>Q32866</td><td></td></tr><tr><td>Qubit dsDNA HS Assay Kit</td><td>Invitrogen</td><td>Q32854</td><td></td></tr><tr><td>Magnet for eppendorf tubes</td><td>Invitrogen</td><td>12321D</td><td>Can be from other vendors.</td></tr><tr><td>Swing bucket cooling centrifuge with the buckets for 15 mL falcon tubes and eppendorf tubes</td><td>Thermo Scientific</td><td>75004527</td><td>Could be from other vendors. It is important that it has buckets for eppendorf tubes.</td></tr><tr><td>Thermo-shaker</td><td>MRC</td><td></td><td>Can be from other vendors.</td></tr><tr><td>High Sensitivity D1000 ScreenTape</td><td>Agilent Technologies</td><td>5067-5584</td><td></td></tr><tr><td>High Sensitivity D1000 Reagents</td><td>Agilent Technologies</td><td>5067-5585</td><td></td></tr><tr><td>4200 TapeStation system</td><td>Agilent Technologies</td><td>G2991AA</td><td>Tape-based platform for&amp;nbsp; electrophoresis</td></tr><tr><td>High Sensitivity DNA kit</td><td>Agilent Technologies</td><td>5067-4626</td><td>Reagent for high-sensitivity TapeStation analysis</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>Primer name and sequence</td><td>Company</td><td></td><td></td></tr><tr><td>Ad1_noMX: 5&#039;-AATGATACGGCGACCACCGAGA&lt;br/&gt; TCTACACTCGTCGGCAGCGTC&lt;br/&gt; AGATGTG-3&#039;</td><td>IDT</td><td></td><td>Ad1-noMx: 5&#039;-P5 sequence-transposase sequence-3&#039;</td></tr><tr><td>Ad2.1_TAAGGCGA: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[TCGCCTTA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.1_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.2_CGTACTAG: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[CTAGTACG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.2_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.3_AGGCAGAA: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[TTCTGCCT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.3_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.4_TCCTGAGC: 5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; AT[GCTCAGGA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.4_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.5_GGACTCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGAGTCC]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.5_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.6_TAGGCATG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CATGCCTA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.6_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.7_CTCTCTAC: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[GTAGAGAG]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.7_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.8_CAGAGAGG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CCTCTCTG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.8_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.9_GCTACGCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGCGTAGC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.9_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.10_CGAGGCTG: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[CAGCCTCG]GTCTCGTGG&lt;br/&gt; GCTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.10_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.11_AAGAGGCA: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[TGCCTCTT]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.11_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.12_GTAGAGGA: 5&#039;-CAAGCAGAAGACGGCATACG&lt;br/&gt; AGAT[TCCTCTAC]GTCTCGTGGG&lt;br/&gt; CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.12_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.13_GTCGTGAT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ATCACGAC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.13_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.14_ACCACTGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACAGTGGT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.14_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.15_TGGATCTG: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CAGATCCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.15_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.16_CCGTTTGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACAAACGG]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.16_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.17_TGCTGGGT: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[ACCCAGCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.17_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.18_GAGGGGTT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AACCCCTC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.18_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.19_AGGTTGGG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CCCAACCT]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.19_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.20_GTGTGGTG: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[CACCACAC]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.20_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>&amp;nbsp;Ad2.21_TGGGTTTC: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[GAAACCCA]GTCTCGTGGGC&lt;br/&gt; TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.21_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.22_TGGTCACA: 5&#039;- CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[TGTGACCA]GTCTCGTGGGC&lt;br/&gt;TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.22_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.23_TTGACCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGGTCAA]GTCTCGTGGGC&lt;br/&gt;TCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.23_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td>Ad2.24_CCACTCCT: 5&#039;-CAAGCAGAAGACGGCATACGA&lt;br/&gt; GAT[AGGAGTGG]GTCTCGTGGG&lt;br/&gt;CTCGGAGATGT-3&#039;</td><td>IDT</td><td></td><td>Ad2.24_expected index sequence read: 5&#039;-P7 sequence-[index sequence]-transposase sequence-3&#039;</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>F1: 5&#039;-CCTTTTTATTTGCCCATACACTC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R1: 5&#039;-CCCAGATAGAAAGTTGGAGAGG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F2: 5&#039;-TTGAGGGATGCCATAACAGTC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R2: 5&#039;-CTGCTGAACAACATCCTTCAC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F3: 5&#039;-GGTTTGCAGGTTGCGTTG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R3: 5&#039;-AGAGGAATCTGGGAGTGACG-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>F4: 5&#039;-TGCTCATTCCGTTTCCCTAC-3&#039;</td><td>IDT</td><td></td><td></td></tr><tr><td>R4: 5&#039;-AGCCGGAAAGAAAGTTCCTG-3&#039;</td><td>IDT</td><td></td><td></td></tr></tbody></table>

mapping genome-wide accessible chromatin in primary human t lymphocytes by atac-seq

Ensayo de cromatina transposasa accesible con secuenciación de alto rendimiento (ATAC-seq) es un método utilizado para la identificación de regiones (accesibles) abiertas de la cromatina. Estas regiones representan ADN elementos reguladores (por ejemplo, promotores, potenciadores, locus control regiones, aisladores) a que transcripción factores unen. Cartografía del paisaje de la cromatina accesible es un enfoque poderoso para descubrir elementos reguladores activos en todo el genoma. Esta información sirve como un enfoque imparcial para descubrir la red de factores de transcripción relevantes y mecanismos de la estructura de la cromatina que regulan programas de expresión génica. ATAC-seq es una alternativa robusta y sensible a la ADNasa I Análisis de hipersensibilidad junto con la secuenciación de próxima generación (DNasa-seq) y asistido por el formaldehído aislamiento de elementos reguladores (FAIRE-seq) para el análisis del genoma de la cromatina accesibilidad y a la secuenciación de sitios sensibles a la nucleasa micrococcal (MNase-seq) para determinar el posicionamiento del nucleosoma. Presentamos un protocolo detallado de ATAC-seq optimizado para humano inmune primario de las células por ejemplo CD4 + linfocitos (helper T 1 (Th1) y las células Th2). Este protocolo integral comienza con la cosecha de la célula, luego describe el procedimiento molecular de la cromatina tagmentation, preparación de muestras para secuenciación de próxima generación y también incluye métodos y consideraciones para el análisis computacional utilizado para interpretar los resultados. Además, para ahorrar tiempo y dinero, introducido medidas de control de calidad para evaluar la biblioteca ATAC-seq antes de la secuencia. Lo importante, los principios presentados en este protocolo permiten su adaptación a otros las células humanas inmunes y no inmunes primarios y líneas celulares. Estas pautas también será útiles para laboratorios que no son expertos en métodos de secuenciación de próxima generación.

El resultado final de este protocolo es una biblioteca de ATAC-seq de típicamente 3-20 ng/μl. Cuando se ejecuta en un sistema de análisis de integridad de ADN (véase Tabla de materiales y equipos), muestran apariencia de escalera2 (Figura 3A). El tamaño promedio de fragmentos de ADN es típicamente ~ 450-530 bp.
Adecuado control de calidad de las bibliot...

Watch this Scientific Journal Video about Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq at JoVE.com

Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

Ensayo para cromatina transposasa accesible junto con secuenciación de alto rendimiento (ATAC-seq) es un método de genoma cromatina accesible de descubrir. Se trata de un protocolo de ATAC-seq paso a paso, desde el molecular al final análisis computacional, optimizado para los linfocitos humanos (Th1/Th2). Este protocolo puede ser adoptada por los investigadores sin experiencia previa en métodos de secuenciación de próxima generación.

Asignación de genoma cromatina accesible en linfocitos T humanos primarios por ATAC-Seq

Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) is a method used for the identification of open (accessible) regions ...

mapping-genome-wide-accessible-chromatin-primary-human-t-lymphocytes

Research

JoVE Journal

Genetics

17.9K vistas.  Bar-Ilan University. Ensayo para cromatina transposasa accesible junto con secuenciación de alto rendimiento (ATAC-seq) es un método de genoma cromatina accesible de descubrir. Se trata de un protocolo de ATAC-seq paso a paso, desde el molecular al final análisis computacional, optimizado para los linfocitos humanos (Th1/Th2). Este protocolo puede ser adoptada por los investigadores sin experiencia previa en métodos de secuenciación de próxima generación.

Video: Mapping Genome-wide Accessible Chromatin in Primary Human T Lymphocytes by ATAC-Seq

An Integrated Platform for Genome-wide Mapping of Chromatin States Using High-throughput ChIP-sequencing in Tumor Tissues

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of associated loci. In addition, the presence of specific modifications has been used to determine the position and identity non-coding functional elements such as enhancers. In recent years, chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) has become a powerful tool in determining the genome-wide profiles of individual histone modifications. However, it has become increasingly clear that the combinatorial patterns of chromatin modifications, referred to as Chromatin States, determine the identity and nature of the associated genomic locus. Therefore, workflows consisting of robust high-throughput (HT) methodologies for profiling a number of histone modification marks, as well as computational analyses pipelines capable of handling myriads of ChIP-Seq profiling datasets, are needed for comprehensive determination of epigenomic states in large number of samples. The HT-ChIP-Seq workflow presented here consists of two modules: 1) an experimental protocol for profiling several histone modifications from small amounts of tumor samples and cell lines in a 96-well format; and 2) a computational data analysis pipeline that combines existing tools to compute both individual mark occupancy and combinatorial chromatin state patterns. Together, these two modules facilitate easy processing of hundreds of ChIP-Seq samples in a fast and efficient manner. The workflow presented here is used to derive chromatin state patterns from 6 histone mark profiles in melanoma tumors and cell lines. Overall, we present a comprehensive ChIP-seq workflow that can be applied to dozens of human tumor samples and cancer cell lines to determine epigenomic aberrations in various malignancies.

Here, we describe an optimized high-throughput ChIP-sequencing protocol and computational analyses pipeline for the determination of genome-wide chromatin state patterns from frozen tumor tissues and cell lines.

Una plataforma integrada para la asignación de todo el genoma de cromatina Estados mediante secuenciación del ChIP de alto rendimiento en los tejidos del Tumor

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of ...

Investigación

Investigación sobre el cáncer

ATAC-seq Assay with Low Mitochondrial DNA Contamination from Primary Human CD4+ T Lymphocytes

ATAC-seq has become a widely used methodology in the study of epigenetics due to its rapid and simple approach to mapping genome-wide accessible chromatin. In this paper we present an improved ATAC-seq protocol that reduces contaminating mitochondrial DNA reads. While previous ATAC-seq protocols have struggled with an average of 50% contaminating mitochondrial DNA reads, the optimized&#160;lysis buffer introduced in this protocol reduces mitochondrial DNA contamination to an average of 3%. This improved ATAC-seq protocol allows for a near 50% reduction in the sequencing cost. We demonstrate how these high-quality ATAC-seq libraries can be prepared from activated CD4+ lymphocytes, providing step-by-step instructions from CD4+ lymphocyte isolation from whole blood through data analysis. This improved ATAC-seq protocol has been validated in a wide range of cell types and will be of immediate use to researchers studying chromatin accessibility.

Here, we present a protocol to perform an assay for transposase-accessible chromatin sequencing (ATAC-seq) on activated CD4+ human lymphocytes. The protocol has been modified to minimize contaminating mitochondrial DNA reads from 50% to 3% through the introduction of a new lysis buffer.

Ensayo de ATAC-seq con ADN mitocondrial baja contaminación primaria humana CD4 + linfocitos T

ATAC-seq has become a widely used methodology in the study of epigenetics due to its rapid and simple approach to mapping genome-wide accessible ...

Genética

Adipocyte-Specific ATAC-Seq with Adipose Tissues Using Fluorescence-Activated Nucleus Sorting

Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) is a robust technique that enables genome-wide chromatin accessibility profiling. This technique has been useful for understanding the regulatory mechanisms of gene expression in a range of biological processes. Although ATAC-seq has been modified for different types of samples, there have not been effective modifications of ATAC-seq methods for adipose tissues. Challenges with adipose tissues include the complex cellular heterogeneity, large lipid content, and high mitochondrial contamination. To overcome these problems, we have developed a protocol that allows adipocyte-specific ATAC-seq by employing fluorescence-activated nucleus sorting with adipose tissues from the transgenic reporter Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) mouse. This protocol produces high-quality data with minimal wasted sequencing reads while reducing the amount of nucleus input and reagents. This paper provides detailed step-by-step instructions for the ATAC-seq method validated for the use of adipocyte nuclei isolated from mouse adipose tissues. This protocol will aid in the investigation of chromatin dynamics in adipocytes upon diverse biological stimulations, which will allow for novel biological insights.

We present a protocol for assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) specifically on adipocytes using nucleus sorting with adipose tissues isolated from transgenic reporter mice with nuclear fluorescence labeling.

ATAC-Seq específico de adipocitos con tejidos adiposos mediante clasificación de núcleos activados por fluorescencia

Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) is a robust technique that enables genome-wide chromatin ...

CATCH-UP: A High-Throughput Upstream-Pipeline for Bulk ATAC-Seq and ChIP-Seq Data

Assay for transposase-accessible chromatin (ATAC) and chromatin immunoprecipitation (ChIP), coupled with next-generation sequencing (NGS), have revolutionized the study of gene regulation. A lack of standardization in the analysis of the highly dimensional datasets generated by these techniques has made reproducibility difficult to achieve, leading to discrepancies in the published, processed data. Part of this problem is due to the diverse range of bioinformatic tools available for the analysis of these types of data. Secondly, a number of different bioinformatic tools are required sequentially to convert raw data into a fully processed and interpretable output, and these tools require varying levels of computational skills. Furthermore, there are many options for quality control that are not uniformly employed during data processing. We address these issues with a complete assay for transposase-accessible chromatin sequencing (ATAC-seq) and chromatin immunoprecipitation sequencing (ChIP-seq) upstream pipeline (CATCH-UP), an easy-to-use, Python-based pipeline for the analysis of bulk ChIP-seq and ATAC-seq datasets from raw fastq files to visualizable bigwig tracks and peaks calls. This pipeline is simple to install and run, requiring minimal computational knowledge. The pipeline is modular, scalable, and parallelizable on various computing infrastructures, allowing for easy reporting of methodology to enable reproducible analysis of novel or published datasets.

ATAC-seq and ChIP-seq allow detailed investigation of gene regulation; however, processing these data types is challenging and often inconsistent between research groups. We present CATCH-UP: an easy-to-use computational pipeline that allows standardized and reproducible data processing and analysis of new and published ATAC/ChIP-seq datasets.

Assay for transposase-accessible chromatin (ATAC) and chromatin immunoprecipitation (ChIP), coupled with next-generation sequencing (NGS), have ...

ATAC-Seq Optimization for Cancer Epigenetics Research

The assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) probes deoxyribonucleic acid (DNA) accessibility using the hyperactive Tn5 transposase. Tn5 cuts and ligates adapters for high-throughput sequencing within accessible chromatin regions. In eukaryotic cells, genomic DNA is packaged into chromatin, a complex of DNA, histones, and other proteins, which acts as a physical barrier to the transcriptional machinery. In response to extrinsic signals, transcription factors recruit chromatin remodeling complexes to enable access to the transcriptional machinery for gene activation. Therefore, identifying open chromatin regions is useful when monitoring enhancer and gene promoter activities during biological events such as cancer progression. Since this protocol is easy to use and has a low cell input requirement, ATAC-seq has been widely adopted to define open chromatin regions in various cell types, including cancer cells. For successful data acquisition, several parameters need to be considered when preparing ATAC-seq libraries. Among them, the choice of cell lysis buffer, the titration of the Tn5 enzyme, and the starting volume of cells are crucial for ATAC-seq library preparation in cancer cells. Optimization is essential for generating high-quality data. Here, we provide a detailed description of the ATAC-seq optimization methods for epithelial cell types.

ATAC-seq is a DNA sequencing method that uses the hyperactive mutant transposase, Tn5, to map changes in chromatin accessibility mediated by transcription factors. ATAC-seq enables the discovery of the molecular mechanisms underlying phenotypic alterations in cancer cells. This protocol outlines optimization procedures for ATAC-seq in epithelial cell types, including cancer cells.

Optimización ATAC-SEQ para la investigación epigenética del cáncer

The assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) probes deoxyribonucleic acid (DNA) accessibility using the ...

Aislamiento de núcleos de células progenitoras cardíacas de ratón con resolución de una sola célula

Nuclei Isolation from Mouse Cardiac Progenitor Cells for Epigenome and Gene Expression Profiling at Single-Cell Resolution

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene expression and chromatin state of individual cells allows the identification of the cell type and state. Single-cell sequencing approaches have revealed a number of important characteristics of cardiac progenitor cell heterogeneity. However, these methods are generally restricted to fresh tissue, which limits studies with diverse experimental conditions, as the fresh tissue must be processed at once in the same run to reduce the technical variability. Therefore, easy and flexible procedures to produce data from methods such as single-nucleus RNA sequencing (snRNA-seq) and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing (snATAC-seq) are needed in this area. Here, we present a protocol to rapidly isolate nuclei for subsequent single-nuclei dual-omics (combined snRNA-seq and snATAC-seq). This method allows the isolation of nuclei from frozen samples of cardiac progenitor cells and can be combined with platforms that use microfluidic chambers.

Autor destacado: Aislamiento de núcleos de células progenitoras cardíacas de ratón para el perfil de epigenoma y expresión génica a resolución de una sola célula  

Here, we present a protocol describing cell nuclei preparation. After microdissection and enzymatic dissociation of cardiac tissue into single cells, the progenitor cells were frozen, followed by isolation of pure viable cells, which were used for single-nucleus RNA sequencing and the single-nucleus assay for transposase-accessible chromatin with high-throughput sequencing analyses.

Aislamiento de núcleos de células progenitoras cardíacas de ratón para epigenoma y perfil de expresión génica a resolución de una sola célula

The developing heart is a complex structure containing various progenitor cells controlled by complex regulatory mechanisms. The examination of the gene ...

Biología del Desarrollo

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

Generación de Plantilla ADN Immunoprecipitation cromatina alta calidad para la secuenciación de alto rendimiento (chip-ss)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Biología

Multiplexed Analysis of Retinal Gene Expression and Chromatin Accessibility Using scRNA-Seq and scATAC-Seq

Powerful next generation sequencing techniques offer robust and comprehensive analysis to investigate how retinal gene regulatory networks function during development and in disease states. Single-cell RNA sequencing allows us to comprehensively profile gene expression changes observed in retinal development and disease at a cellular level, while single-cell ATAC-Seq allows analysis of chromatin accessibility and transcription factor binding to be profiled at similar resolution. Here the use of these techniques in the developing retina is described, and MULTI-Seq is demonstrated, where individual samples are labeled with a modified oligonucleotide-lipid complex, enabling researchers to both increase the scope of individual experiments and substantially reduce costs.

Here, the authors showcase the utility of MULTI-seq for phenotyping and subsequent paired scRNA-seq and scATAC-seq in characterizing the transcriptomic and chromatin accessibility profiles in retina.

Análisis multiplexado de la expresión génica de la retina y la accesibilidad a la cromatina utilizando scRNA-Seq y scATAC-Seq

Powerful next generation sequencing techniques offer robust and comprehensive analysis to investigate how retinal gene regulatory networks function during ...

Asignación de genoma cromatina accesible en linfocitos T humanos primarios por ATAC-Seq

Resumen

Explorar más videos

PLAYLIST