Name: combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae
Uploaded: 2018-01-10T15:00:00
Description: Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Diffraction data were collected at Southeast Regional Collaborative Access Team (SER-CAT) 22-ID and 22-BM beamlines at the Advanced Photon Source (APS), Argonne National Laboratory. The SAXS data was collected on the SIBYLS beamline at the Advance Light Source (ALS), Lawrence Berkeley National Laboratory. We would like to thank the staff at the SIBYLS beamline for their help with remote data collection and processing. We are grateful to the National Institute of Environmental Health Sciences (NIEHS) Mass Spectrometry Research and Support Group for help determining the protein domain boundaries. This work was supported by the US National Institute of Health Intramural Research Program; US National Institute of Environmental Health Sciences (NIEHS) (ZIA ES103247 to R. E. S.) and the Canadian Institutes of Health Research (CIHR, 146626 to M.C.P). Use of the APS was supported by the US Department of Energy, Office of Science, Office of Basic Energy Sciences under Contract No. W-31-109-Eng-38. Use of the Advanced Light Source (ALS) was supported by the Director, Office of Science, Office of Basic Energy Sciences, of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231. Additional support for the SIBYLS SAXS beamline comes from the National Institute of Health project MINOS (R01GM105404) and a High-End Instrumentation Grant S10OD018483. We would also like to thank Andrea Moon and Dr. Sara Andres for their critical reading of this manuscript.

1. Recombinant Protein Production and Purification of Nsa 1
<ol>
	<li>Nsa1 Expression Plasmid Design and Cloning
	<ol>
		<li>Obtain or purchase S. cerevisiae genomic DNA.</li>
		<li>PCR amplify the target sequences of Nsa1 (Nsa1FL, residues 1-463) and C-terminal truncated Nsa1 (Nsa1&#916;C, residues 1-434) with appropriate primers using genomic DNA isolated from S. cerevisiae and a melting temperature of approximately 60 &#176;C with an extension time of 1-2 min. The following pr...

Using this protocol, recombinant Nsa1 from S. cerevisiae was generated for structural studies by both X-ray crystallography and SAXS. Nsa1 was well-behaved in solution and crystallized in multiple crystal forms. During the optimization of these crystals, it was discovered that the C-terminus of Nsa1 was sensitive to protease degradation. The high resolution, orthorhombic crystal form could only be duplicated with C-terminal truncation variants of Nsa1, likely because the flexible C-terminus of Nsa1 prevented cry...

Ribosomes are large ribonucleoprotein machines that carry out the essential role of translating mRNA into proteins in all living cells. Ribosomes are composed of two subunits which are produced in a complex process termed ribosome biogenesis1,2,3,4. Eukaryotic ribosome assembly relies on the aid of hundreds of essential ribosomal assembly factors2,3,5. Nsa1 (Nop7 associated 1) is a eukaryotic ribosome assembly factor that is specifically required for the production of the large ribosomal subunit6, and is known as WD-repeat containing 74 (WDR74) in higher organisms7. WDR74 has been shown to be required for blastocyst formation in mice8and the WDR74 promoter is frequently mutated in cancer cells9. However, the function and precise mechanisms of Nsa1/WDR74 in ribosome assembly are still largely unknown. To begin to uncover the role of Nsa1/WDR74 during eukaryotic ribosome maturation, multiple structural analyses were performed, including X-ray crystallography and small angle X-ray scattering (SAXS)10.
X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, electron microscopy, and SAXS are all important techniques for studying macromolecular structure. Size, shape, availability, and stability of macromolecules influences the structural biology method for which a particular macromolecule will be best suited, however combining multiple techniques through a so-called &#34;hybrid&#34; approach is becoming an increasingly beneficial tool11. In particular X-ray crystallography and SAXS are powerful and complementary methods for structural determination of macromolecules12.
Crystallography provides high-resolution atomic structures ranging from small molecules to large cellular machinery such as the ribosome, and has led to numerous breakthroughs in the understanding of the biological functions of proteins and other macromolecules13. Furthermore, structure-based drug design harnesses the power of crystal structures for molecular docking by computational methods, adding a critical dimension to drug discovery and development14. Despite its broad applicability, flexible and disordered systems are challenging to assess by crystallography since crystal packing can be hindered or electron density maps may be incomplete or of poor quality. Conversely, SAXS is a solution-based and low-resolution structural approach capable of describing flexible systems ranging from disordered loops and termini to intrinsically disordered proteins12,15,16. Considering it is compatible with a broad range of particle sizes12, SAXS can work synergistically with crystallography to expand the range of biological questions that can be addressed by structural studies.
Nsa1 is suitable for a hybrid structural approach because it contains a well-structured WD40 domain followed by a functional, but flexible C-terminus which is not amenable to X-ray crystallography methods. Following is a protocol for the cloning, expression, and purification of S. cerevisiae Nsa1 for hybrid structural determination by X-ray crystallography and SAXS. This protocol can be adapted to study the structures of other proteins that are comprised of a combination of ordered and disordered regions.

<table>
	<tbody>
		<tr>
			<td>Molecular Cloning of Nsa1</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pMBP2 parallel vector</td>
			<td>Sheffield et al, Protein Expression and Purification 15, 34-39 (1999)</td>
			<td></td>
			<td>We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)</td>
		</tr>
		<tr>
			<td>S. cerevisiae genomic DNA</td>
			<td>ATCC</td>
			<td>204508D-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers for cloning Nsa1</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SC_Nsa1_FLFw</td>
			<td>IDT</td>
			<td></td>
			<td>CGC CAA AGG CCT 
			ATGAGGTTACTAGTCAGCTGTGT 
			GGATAG</td>
		</tr>
		<tr>
			<td>SC_Nsa1_FLRv</td>
			<td>IDT</td>
			<td></td>
			<td>AATGCAGCGGCCGCTCAAATTTT 
			GCTTTTCTTACTGGCTTTAGAAGC 
			AGC</td>
		</tr>
		<tr>
			<td>SC_Nsa1_DeltaCFw</td>
			<td>IDT</td>
			<td></td>
			<td>GGGCGCCATGGGATCCATGAGG 
			TTACTAGTCAGCTGTGTGG</td>
		</tr>
		<tr>
			<td>SC_Nsa1_DeltaCRv</td>
			<td>IDT</td>
			<td></td>
			<td>GATTCGAAAGCGGCCGCTTAAAC 
			CTTCCTTTTTTGCTTCCC</td>
		</tr>
		<tr>
			<td>Recombinant Protein Production and Purification of Nsa1</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Escherichia coli BL21 (DE3) Star Cells</td>
			<td>Invitrogen</td>
			<td>C601003</td>
			<td></td>
		</tr>
		<tr>
			<td>pMBP- NSA1 and various truncations</td>
			<td>Lo et al., 2017</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Selenomethionine</td>
			<td>Molecular Dimensions</td>
			<td>MD12-503B</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG, Dioxane-Free</td>
			<td>Promega</td>
			<td>V3953</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA Free Protease Inhibitor Cocktail</td>
			<td>Sigma-Aldrich</td>
			<td>4693159001</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Chloride</td>
			<td>Caledon Laboratory Chemicals</td>
			<td>7560-1-80</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Chloride hexahydrate</td>
			<td>Sigma-Aldrich</td>
			<td>M2670</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris Buffer, 1 M pH7.5</td>
			<td>KD Medical</td>
			<td>RGF-3340</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Invitrogen</td>
			<td>15514-029</td>
			<td></td>
		</tr>
		<tr>
			<td>beta-mercaptoethanol</td>
			<td>Sigma</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>1M Imidazole, pH 8.0</td>
			<td>Teknova</td>
			<td>I6980-06</td>
			<td></td>
		</tr>
		<tr>
			<td>Talon Affinity Resin</td>
			<td>Clonetech</td>
			<td>635503</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K)</td>
			<td>Millipore</td>
			<td>UFC901024</td>
			<td></td>
		</tr>
		<tr>
			<td>HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column</td>
			<td>GE-Healthcare</td>
			<td>28989335</td>
			<td></td>
		</tr>
		<tr>
			<td>TEV Protease</td>
			<td>Prepared by NIEHS Protein Expression Core</td>
			<td>Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)</td>
			<td></td>
		</tr>
		<tr>
			<td>4-15% Mini-PROTEAN TGX Precast Protein Gels</td>
			<td>BioRad</td>
			<td>456-8056</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystallization, Proteolytic Screening</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Screen</td>
			<td>Hampton Research</td>
			<td>HR2-110</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Screen 2</td>
			<td>Hampton Research</td>
			<td>HR2-112</td>
			<td></td>
		</tr>
		<tr>
			<td>Salt Rx</td>
			<td>Hampton Research</td>
			<td>HR2-136</td>
			<td></td>
		</tr>
		<tr>
			<td>Index&#160; Screen</td>
			<td>Hampton Research</td>
			<td>HR2-144</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG/Ion Screen</td>
			<td>Hampton Research</td>
			<td>HR2-139</td>
			<td></td>
		</tr>
		<tr>
			<td>JCSG+</td>
			<td>Molecular Dimensions</td>
			<td>MD1-37</td>
			<td></td>
		</tr>
		<tr>
			<td>Wizard Precipitant Synergy&#160;</td>
			<td>Molecular Dimensions</td>
			<td>MD15-PS-T</td>
			<td></td>
		</tr>
		<tr>
			<td>Swissci 96-well 3-drop UVP sitting drop plates</td>
			<td>TTP Labtech</td>
			<td>4150-05823</td>
			<td></td>
		</tr>
		<tr>
			<td>3inch Wide Crystal Clear Sealing Tape</td>
			<td>Hampton Research</td>
			<td>HR4-506</td>
			<td></td>
		</tr>
		<tr>
			<td>Proti-Ace Kit</td>
			<td>Hampton Research</td>
			<td>HR2-429</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG 1500</td>
			<td>Molecular Dimensions</td>
			<td>MD2-100-6</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG 400</td>
			<td>Molecular Dimensions</td>
			<td>MD2-100-3</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES/sodium hydroxide pH 7.5</td>
			<td>Molecular Dimensions</td>
			<td>MD2-011-</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Citrate tribasic</td>
			<td>Molecular Dimensions</td>
			<td>MD2-100-127</td>
			<td></td>
		</tr>
		<tr>
			<td>22 mm x 0.22 mm Siliconized Coverslides</td>
			<td>Hampton Research</td>
			<td>HR3-231</td>
			<td></td>
		</tr>
		<tr>
			<td>24 Well Plates with sealant (VDX Plate with Sealant)</td>
			<td>Hampton Research</td>
			<td>HR3-172</td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM)</td>
			<td>Hampton Research</td>
			<td>HR4-945, HR4-947, HR4-970, HR4-971</td>
			<td></td>
		</tr>
		<tr>
			<td>Seed Bead Kit</td>
			<td>Hampton Research</td>
			<td>HR2-320</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Crystal Caps</td>
			<td>Hampton Research</td>
			<td>HR4-779</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Cryo Wand</td>
			<td>Hampton Research</td>
			<td>HR4-729</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryogenic Foam Dewar</td>
			<td>Hampton Research</td>
			<td>HR4-673</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Puck System</td>
			<td>MiTeGen</td>
			<td>M-CP-111-021</td>
			<td></td>
		</tr>
		<tr>
			<td>Full Skirt 96 well Clear Plate</td>
			<td>VWR</td>
			<td>10011-228</td>
			<td></td>
		</tr>
		<tr>
			<td>AxyMat Sealing Mat</td>
			<td>VWR</td>
			<td>10011-130</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>UVEX-m</td>
			<td>JAN Scientific, Inc.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nanodrop Lite Spectrophotometer</td>
			<td>Thermo-Fisher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Mosquito Robot</td>
			<td>TTP Labtech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Software/Websites</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HKL2000</td>
			<td>Otwinoski and Minor, 1997</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phenix</td>
			<td>Adams et al., 2010</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Coot</td>
			<td>Emsley et al., 2010</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ATSAS</td>
			<td>Petoukhov et al., 2012</td>
			<td></td>
			<td>https://www.embl-hamburg.de/biosaxs/atsas-online/</td>
		</tr>
		<tr>
			<td>Scatter</td>
			<td>Rambo and Tainer, 2013</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pymol</td>
			<td>The PyMOL Molecular Graphics System, Version 1.8 Schr&#246;dinger, LLC.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BUNCH</td>
			<td>Petoukhov and Svergun, 2005</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CRYSOL</td>
			<td>Svergun et al, 1995</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PRIMUS</td>
			<td>Konarev et al, 2003</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>EOM</td>
			<td>Tria et al, 2015</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the disordered and protease labile C-terminus of the protein. This manuscript describes the methods to purify recombinant Nsa1 from S. cerevisiae for structural analysis by both X-ray crystallography and SAXS. X-ray crystallography was utilized to solve the structure of the well-ordered N-terminal WD40 domain of Nsa1, and then SAXS was used to resolve the structure of the C-terminus of Nsa1 in solution. Solution scattering data was collected from full-length Nsa1 in solution. The theoretical scattering amplitudes were calculated from the high-resolution crystal structure of the WD40 domain, and then a combination of rigid body and ab initio modeling revealed the C-terminus of Nsa1. Through this hybrid approach the quaternary structure of the entire protein was reconstructed. The methods presented here should be generally applicable for the hybrid structural determination of other proteins composed of a mix of structured and unstructured domains.

Nsa1 was PCR amplified from S. cerevisiae genomic DNA and subcloned into a vector containing an N-terminal 6x-Histidine affinity tag followed by MBP and a TEV protease site. Nsa1 was transformed into E. coli BL21(DE3) cells and high yields of protein expression were obtained following induction with IPTG and growth at 25 &#176;C overnight (Figure 1A). Nsa1 was affinity-purified on immobilized cobalt affinity resin, followed by MBP cleavage w...

Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

This method describes the cloning, expression, and purification of recombinant Nsa1 for structural determination by X-ray crystallography and small-angle X-ray scattering (SAXS), and is applicable for the hybrid structural analysis of other proteins containing both ordered and disordered domains.

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the ...

The overall goal of this procedure is to produce a recombinant protein that is composed of a mixture of ordered and disordered domains for hybrid structural analysis by both x-ray crystallography and small angle x-ray scattering. This method can help to answer key questions in structural biology about putting biological function so that the determination of all solutions stay structure of protein. The main advantage of this technique is that it can be used to model dynamic regions of a protein or macro-molecule that cannot be resolved by x-ray crystallography.Generally, individuals new to this method will struggle at the beginning with learning how to properly assess the quality of their SAXS data. To begin the procedure, transform an Nsa1 expression plasmid into a suitable E.coli expression strain. Culture the cells, induce Nsa1 expression, and harvest the cells.Resuspend the cells in 25 milliliters of lysis buffer, pre-chill to four degrees Celsius, containing one EDTA-free protease inhibitor tablet. Sonicate the cells at four degrees Celsius for seven minutes, with a cycle of two seconds on, two seconds off. Then, centrifuge the lysate at 26, 900 times gravity for 45 minutes at four degrees Celsius.Ensure that the mixture does not freeze during centrifugation. Next, equilibrate a gravity flow column containing 10ml of immobilized cobalt affinity resin with lysis buffer. Load the clarified lysate onto the column and allow it to flow through the resin at four degrees Celsius.Then, wash the resin twice with 100ml portions of lysis buffer. Elute Nsa1 from the column with 20ml of elution buffer. Run a 15mcl aliquot of the eluere on a four to 15%SDS-PAGE gel to confirm the elution of the protein.Then, add 1ml of the 1mg/ml TEV protease stock solution to the eluere. Incubate the eluere at four degrees Celsius overnight to remove the MBP tag. Then, use a 10 kilodalton centrifugal filter unit to concentrate the MBP-cleaved Nsa1 to about 5ml, being careful not to over-concentrate.Purify the concentrated protein on a gel filtration column pre-equilibrated with Buffer A.One of the critical steps in this procedure is ensuring you remove all aggregates during the purification. Aggregates will interfere with crystallization and SAXS data acquisition and analyses. Analyze 15mcl samples from each column fraction with SDS-PAGE to confirm the separation of MBP from Nsa1.Combine the Nsa1 containing fractions. Use a 10 kilodalton centrifugal filter unit to concentrate the combined fractions to about 8mg/ml. Measure the absorbance at 289 nanometers and calculate the protein concentration.Immediately proceed to proteolytic screening and crystallization trials. To begin the proteolytic screening, prepare 1mg/ml stock solutions of Alpha-comotrypsin, trypsin, elastase, capayin, septilisin, and Endoproteinase GluC. Dilute each stock solution with dilution buffer to 1:10, 1:100, and 1:1, 000.Dilute the 8mg/ml solution of Nsa1 to 1mg/ml with Buffer A.Then, for each protease dilution, combine 1mcl of the protease dilution with 9mcl of the diluted protein stock. Incubate the solutions at 37 degrees Celsius for one hour. Then, add 10mcl of 2x SDS-PAGE sample to buffer to each solution and heat the solutions at 95 degrees Celsius for five minutes.Run the solutions on a four to 15%SDS-PAGE gel to identify protease resistant domains. Create truncated expression constructs that exclude protease labile regions. Express and purify these proteins for crystallization optimization.After acquiring SAXS data for the Nsa1 protein over a range of concentrations, set the terminal shell file path to the directory containing the data. Then, launch the analysis software. Load the scattering curves into the analysis software.Use the auto RG tool to determine the radius of gyration and the forward-scattering intensity for each curve. Then, generate Kratky plots for each scattering curve to determine the degree of compactness. Use the autonome tool to calculate the pair-wise distribution function for each curve, using a starting maximum dimension of 3x the radius of gyration.Optimize the maximum dimension to obtain a smooth, pair-wise distribution function curve that is consistent with the experimental scattering curve. Compare the structural parameters across concentrations to verify the absence of radiation damage or concentration-dependent effects. It is critical to compare key structural parameters, including radius of gyration, molecular mass, forward scattering and pair distance distribution functions across a concentration series.And that's to ensure there's no radiation damage or concentration effects. Next, run the ensemble optimization method utility using the starting protein crystal structure file, the target protein sequence file, and the experimental SAXS data file. Compare the chi squared values from the starting crystal structure file to the ensemble file to determine whether the ensemble model fits the experimental data well.Use molecular visualization software to overlay the crystal structure with the generated conformers. Note the total number of conformers and the fraction of occupancy for each conformer contributing to the scattering curve. Proteolytic cleavage of the protease labile C terminus of Nsa1 resulted in the formation of orthorhombic crystals.The freshly purified Nsa1 formed cubic crystals, but the crystal structure still lacked electron density for the labile c terminus. The n-terminal seven blated beta propeller WD-40 domain of Nsa1 was well-resolved in both structures. The Nsa1 WD-40 domain alone was not a good fit for the experimental SAXS data.A combination of rigid-body modeling and abinitial reconstruction of the C terminus significantly improved the goodness of fit. Ensemble modeling provided an even greater improvement in goodness of fit, revealing the confirmational sampling of the C-terminal tail in solution. While SAXS is a low-resolution structural technique, it compliments very well high-resolution structural studies, like x-ray crystallography.So you can model flexible and disordered regions. By collecting and analyzing SAXS data of macromolecule, you can begin to understand confirmational change that occurred upon After watching this video, you should have a good understanding of how to solve the structure of a protein composed of ordered and disordered regions by both x-ray crystallography and SAXS.

Research

JoVE Journal

Biochemistry

Characterization of Glycoproteins with the Immunoglobulin Fold by X-Ray Crystallography and Biophysical Techniques

Glycoproteins on the surface of cells play critical roles in cellular function, including signalling, adhesion and transport. On leukocytes, several of ...

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Ion Exchange Chromatography (IEX) Coupled to Multi-angle Light Scattering (MALS) for Protein Separation and Characterization

Ion Exchange Chromatography IEX Coupled to Multi-angle Light Scattering MALS for Protein Separation and Characterization

Ion-exchange chromatography with multi-angle light scattering (IEX-MALS) is a powerful method for protein separation and characterization. The combination ...

Characterization of Proteins by Size-Exclusion Chromatography Coupled to Multi-Angle Light Scattering (SEC-MALS)

Characterization of Proteins by Size-Exclusion Chromatography Coupled to Multi-Angle Light Scattering SEC-MALS

Analytical size-exclusion chromatography (SEC), commonly used for the determination of the molecular weight of proteins and protein-protein complexes in ...

An All-in-one Sample Holder for Macromolecular X-ray Crystallography with Minimal Background Scattering

Macromolecular X-ray crystallography (MX) is the most prominent method to obtain high-resolution three-dimensional knowledge of biological macromolecules. ...

Cell Culture on Silicon Nitride Membranes and Cryopreparation for Synchrotron X-ray Fluorescence Nano-analysis

Very little is known about the distribution of metal ions at the subcellular level. However, those chemical elements have essential regulatory functions ...

X-Ray Crystallography to Study the Oligomeric State Transition of the Thermotoga maritima M42 Aminopeptidase TmPep1050

X-Ray Crystallography to Study the Oligomeric State Transition of the Thermotoga maritima M42 Aminopeptidase TmPep1050

The M42 aminopeptidases form functionally active complexes made of 12 subunits. Their assembly process appears to be regulated by their metal ion ...

Fixed Target Serial Data Collection at Diamond Light Source

Serial data collection is a relatively new technique for synchrotron users. A user manual for fixed target data collection at I24, Diamond Light Source is ...

Motility of Single Molecules and Clusters of Bi-Directional Kinesin-5 Cin8 Purified from S. cerevisiae Cells

Motility of Single Molecules and Clusters of Bi-Directional Kinesin-5 Cin8 Purified from S. cerevisiae Cells

The mitotic bipolar kinesin-5 motors perform essential functions in spindle dynamics. These motors exhibit a homo-tetrameric structure with two pairs of ...