Este trabajo fue apoyado por los nuevos fondos de inicio de la Facultad de la Universidad Estatal de Carolina del norte para Guozhou Xu.

Nota: Se utiliza un sistema de células de insecto/baculovirus con vectores de expresión modificada de expresión de la proteína secretora de la planta y la cristalización.
1. modificación de un Vector de expresión de Baculovirus con el péptido de señal GP67 para la expresión de la secreción de la proteína de planta
<ol><li>Sintetizar un fragmento de ADN que contiene una 5' BglII corte sitio13, la secuencia de señal GP67 secreción y un sitio de clonación múltiple con NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI y XhoI (figura 1A). Nota: Puesto que BglII y BamHI digestión DNA dio lugar a los mismos fines de adhesivo, el vector linearizado puede ligar al fragmento de ADN digerido mientras la BglII y BamHI sitios en la secuencia de ligadura recocido se mutó a una secuencia que no es divisible por BglII o BamHI14.</li>
	<li>Resumen 4 μg del ADN con BglII y XhoI y 4 μg de un vector de expresión ADN con BamHI y XhoI14. Mezclar 10 unidades de cada enzima de restricción con el ADN en un 1 x de tampón de reacción concentración (acetato de potasio de 50 mM, 20 mM Tris acetato, acetato de magnesio de 10 m m y 100 μg/mL de BSA, pH 7.9 a 25 ° C) e incubar la mezcla a 37 ° C durante 4 horas.<ol>
<li>Purificar el fragmento de ADN suprimido y el vector linearizado ADN por un kit de la extracción del gel de ADN15.</li>
	</ol>
</li>
	<li>Mezcla 100 ng lineal del vector de la DNA con 400 ng de ADN digerido del fragmento en una mezcla de reacción de la ligadura de 10 μl que contiene 1 x buffer de reacción T4 ADN ligasa (50 mM Tris HCl, 10 mM MgCl2, ATP de 1 mM y 10 mM DTT, pH 7.5 a 25 ° C) y 5 unidades de la DNA de T4 ligasa. Incubar la mezcla de reacción a 16 ° C por 16 h.</li>
	<li>Transformar 5 μl de la mezcla de ligadura en 100 μl de células competentes DH5α siguiendo un protocolo de transformación estándar y seleccione las colonias resultantes en una ampicilina-LB agar placa16. Recoger 5-10 colonias y crecimiento de cada colonia en 2 mL de medio LB con ampicilina de μg/mL 100 a 220 rpm y 37 ° C en un incubador de agitación por 16 h.</li>
	<li>Extraer cada ADN plásmido con una DNA miniprep kit17 y confirmar los clones por la secuencia de la DNA con una cartilla de AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>Amplificar por PCR el gen de a. thaliana TDR fragmento codificación residuos 30-642 de un gen sintético de TDR construir (hacia delante la cartilla: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, primer revés: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplificar el ADN de 30 ciclos en un tampón de reacción de polimerasa de la DNA que contiene una mezcla de dNTP de 0,5 mM, cebadores de μm 0,2, 0,1 μg de plantilla de ADN, 0,4 mM MgCl2y 1 unidad de reacción de polimerasa de la DNA.<ol>
<li>Para los pasos del ciclo de PCR, establecer la desnaturalización inicial a 95 ° C por 30 s y luego de 30 ciclos de desnaturalización a 95 ° C por 30 s, recocido a 55 ° C para 30 s y extensión a 72 ° C por 1 min, con una extensión final a 72 ° C durante 5 minutos.</li>
	</ol>
</li>
	<li>Digerir el fragmento de la polimerización en cadena y el vector modificado con enzimas de restricción endonucleasa NotI y BamHI. Ligar el fragmento del gen con el vector linearizado. Mezcla 100 ng lineal del vector de la DNA con 400 ng de ADN digerido del fragmento en una mezcla de reacción de la ligadura de 10 μl con T4 ADN ligasa reacción tampón y 5 unidades de ligase de la DNA de T4. Incubar la mezcla de reacción a 16 ° C por 16 h.</li>
	<li>Transformar 5 μl de la mezcla de ligadura en 100 μl de células competentes DH5α siguiendo un protocolo de transformación estándar y seleccione las colonias resultantes en una ampicilina-LB agar placa16. Para confirmar los clones correcta secuencia de la DNA.</li>
</ol>2. modificación de un Vector de expresión de Baculovirus con el péptido de señal Hemolin insectos para la expresión de la secreción de la proteína de planta
<ol><li>Sintetizar un fragmento de ADN que contiene una 5' BglII corte sitio13, la secuencia de la señal de secreción de insectos hemolin y un sitio de clonación múltiple con NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI y XhoI (figura 1B).</li>
	<li>Resumen 4 μg del ADN con BglII y XhoI y 4 μg de un vector de expresión ADN con BamHI y XhoI14. Mezclar 10 unidades de cada enzima de restricción con el ADN en un 1 x de tampón de reacción concentración (acetato de potasio de 50 mM, 20 mM Tris acetato, acetato de magnesio de 10 m m y 100 μg/mL de BSA, pH 7.9 a 25 ° C) e incubar la mezcla a 37 ° C durante 4 horas.<ol>
<li>Purificar el fragmento de ADN suprimido y el vector linearizado ADN por un kit de la extracción del gel de ADN15.</li>
	</ol>
</li>
	<li>Mezcla 100 ng lineal del vector de la DNA con 400 ng de ADN digerido del fragmento en una mezcla de reacción de la ligadura de 10 μl que contiene 1 x buffer de reacción T4 ADN ligasa (50 mM Tris HCl, 10 mM MgCl2, ATP de 1 mM y 10 mM DTT, pH 7.5 a 25 ° C) y 5 unidades de la DNA de T4 ligasa. Incubar la mezcla de reacción a 16 ° C por 16 h.</li>
	<li>Transformar 5 μl de la mezcla de ligadura en 100 μl de células competentes DH5α y seleccione las colonias en una placa de agar LB ampicilina. Recoger 5-10 colonias y crecimiento de cada colonia en un medio LB de 2 mL conteniendo 100 μg/mL de ampicilina a 37 ° C en un incubador de agitación por 16 h y 220 rpm.</li>
	<li>Extraer ADN de plásmido con una DNA miniprep kit17 y confirmar los clones por la secuencia de la DNA con una cartilla de AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>Amplificar por PCR a. thaliana polen del Receptor quinasa 3 (PRK3) fragmento genético codificación de residuos 20-237 de una construcción de genes sintética PRK3 (hacia delante la cartilla: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, primer revés: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplificar el ADN de 30 ciclos en un tampón de reacción de polimerasa de la DNA que contiene una mezcla de dNTP de 0,5 mM, cebadores de μm 0,2, 0,1 μg de plantilla de ADN, 0,4 mM MgCl2y 1 unidad de reacción de polimerasa de la DNA.<ol>
<li>Para los pasos del ciclo de PCR, establecer la desnaturalización inicial a 95 ° C por 30 s y luego de 30 ciclos de desnaturalización a 95 ° C por 30 s, recocido a 55 ° C para 30 s y extensión a 72 ° C por 30 s cada ciclo y la extensión final a 72 ° C durante 5 minutos.</li>
	</ol>
</li>
	<li>Digerir el fragmento de la polimerización en cadena y el vector modificado con enzimas de restricción endonucleasa NotI y BamHI. Ligar el fragmento del gen con el vector linearizado. Mezcla 100 ng lineal del vector de la DNA con 400 ng de ADN digerido del fragmento en una mezcla de reacción de la ligadura de 10 μl con T4 ADN ligasa reacción tampón y 5 unidades de ligase de la DNA de T4. Incubar la mezcla de reacción a 16 ° C por 16 h.</li>
	<li>Transformar 5 μl de la mezcla de ligadura en 100 μl de células competentes DH5α siguiendo un protocolo de transformación estándar y seleccione las colonias resultantes en una ampicilina-LB agar placa16. Para confirmar los clones correcta secuencia de la DNA.</li>
</ol>3. producción y amplificación de Baculovirus construye albergando el casete de expresión de proteínas recombinantes
<ol><li>Uso 100 ng de plásmido construir transformar 40 μl de células competentes DH10Bac siguiendo el protocolo del sistema de expresión de baculovirus1. Incubar las placas a 37 ° C durante 48 h de transformación.</li>
	<li>Recoger dos colonias blancas de cada placa de transformación, inocular cada colonia en 2 mL de medio LB con kanamicina 50 de μg/mL, 7 gentamicina μg/mL y 10 μg/mL tetraciclina. Seguir el protocolo de los baculovirus expression sistema1 para extraer y verificar la bacmid de ADN. Alícuota cada DNA en dos tubos con 20 μl cada una y almacenar los tubos a-20 ° C. Nota: Los pasos siguientes requieren una operación aséptica.</li>
	<li>Crecer una monocapa de células Sf9 en los antibióticos de penicilina-estreptomicina de medios de cultivo con 10% suero bovino fetal (FBS) y 100 μg/mL (o 100 I.U./mL) a 27 ° C a 80% de confluencia en una placa de 6 pozos. Estimar el porcentaje de confluencia basado en el porcentaje de área cubierta en la placa de cultivo de tejidos.</li>
	<li>Preparar las siguientes soluciones en dos tubos de centrífuga de 1,5 mL estéril.<ol>
<li>Tubo 1: Para cada transfección, diluir 20 μl de ADN bacmid en 100 μl de medio sin suplemento de cultivo de celular Sf9 sin antibióticos. Mezclar suavemente la dilución por sacudiendo el lado del tubo.</li>
		<li>Tubo 2: Para cada transfección, diluir 8 μl de reactivo de transfección de lípidos en 100 μl de medio sin suplemento de cultivo de celular Sf9 sin antibióticos. Homogeneizar la dilución transfiriendo hacia arriba y hacia abajo para x 6.</li>
	</ol>
</li>
	<li>Combinar las dos soluciones, mezclar suavemente transfiriendo lentamente hacia arriba y hacia abajo para x 3 e incubar por 20-40 min a temperatura ambiente.</li>
	<li>Lave cada pocillo de la monocapa Sf9 células x 2 con 3 mL de medio sin suplemento de cultivo de celular Sf9 sin antibióticos. Para cada transfección, agregar 0,8 mL de medio sin suplemento de cultivo de celular Sf9 sin antibióticos a cada tubo que contiene la mezcla de lípidos-DNA. Mezclar suavemente el contenido de los tubos mediante pipeteo lentamente hacia arriba y hacia abajo para x 3. Aspire los medios de lavado de las placas y las muestras con la mezcla de la transfección del recubrimiento.</li>
	<li>Después de la adición de la mezcla de transfección, Incube la placa transfected de 5 horas a 27 ° C. Sustituir los medios de comunicación de la transfección con el completo Sf9 medio de cultivo celular que contenga 10% FBS y 100 μg/mL (o 100 I.U./mL) antibióticos de penicilina-estreptomicina. Incube la placa transfected a 27 ° C por 4 d.</li>
	<li>Cosecha y amplificar el baculovirus recombinante.<ol>
<li>Recoger el sobrenadante de la placa infectada en un tubo cónico de 15 mL estéril después de 4 d de incubación. Girar el sobrenadante a 1010 x g durante 5 min eliminar los restos celulares. Descarte el precipitado y decantar el sobrenadante a un tubo limpio y almacenar a 4 ° C hasta por 1 año. Nota: Este es el virus de P0. Puede ser alícuotas y almacenados a-80 ° C durante un tiempo.</li>
		<li>Para amplificar cada virus recombinante, crecer una monocapa de células Sf9 en una placa de 150 mm a 80% de confluencia. Aspire los medios de comunicación de la placa, añadir 2 mL del virus P0 el adherente de las células a la placa e Incube la placa durante 1 hora en un incubador de 27 ° C. Roca de la placa cada 15 minutos para mezclar el medio con las células.<ol>
<li>Añadir 25 mL de medios de la gracia completa que contiene 10% FBS y 100 μg/mL (o 100 I.U./mL) antibióticos de penicilina-estreptomicina. Incube la placa para 3 d en un incubador de 27 ° C para obtener el virus paso de P1.</li>
		</ol>
</li>
		<li>Recoger el sobrenadante de la placa infectada en un tubo cónico estéril de 50 mL y centrifugado a 1010 x g durante 5 min eliminar los restos celulares. Decantar el sobrenadante a un tubo limpio y almacenar a 4 ° C hasta por 1 año. Nota: El virus P1 puede alícuotas y almacenados a-80 ° C durante un tiempo.</li>
		<li>Para amplificar el virus desde P1 a P2 paso, crecer una monocapa de células Sf9 en una placa de 150 mm a 90% de confluencia, aspirar los medios de comunicación de la placa, agregar 2 mL del virus P1 a la placa e incubar durante 1 h en un incubador de 27 ° C.</li>
		<li>Repita los pasos 3.8.2 y 3.8.3 para obtener los pasajes P2 y P3 de los virus. No guarde el virus P3 por más de 2 meses.</li>
	</ol>
</li>
</ol>4. proteína expresión, purificación y NiNTA, cristalización
<ol><li>1 L de Hi5 células de los insectos en los antibióticos de penicilina-estreptomicina de medios de cultivo con 100 μg/mL (o 100 I.U./mL) a una densidad de 2 x 106 a 100 rpm en un agitador incubador de 27 ° C de la cultura. Desactivación de las células a 570 x g durante 5 min, decantar el sobrenadante, resuspender las células en 20 mL de los virus recién producidos de P3 y mantenerlo a temperatura ambiente por 1 h. Agite suavemente la botella de vuelta para resuspender las células 1 x cada 15 min.</li>
	<li>Transferir las células a 1 L de medio de cultivo con 100 μg/mL (o 100 I.U./mL) antibióticos de penicilina-estreptomicina, cultura de las células a 100 rpm en una coctelera de la incubadora de 27 ° C por 72 h. vuelta hacia abajo de las células a 1.010 x g durante 5 min y recoger el sobrenadante.</li>
	<li>Tiras indicadoras de pH de uso para ajustar el pH del sobrenadante a 8.0 mediante la adición de 0.1 M HCl o 0,1 M NaOH y añadir el tampón de unión a una concentración final, conteniendo 20 mM de tampón Tris pH 8.0, 100 mM NaCl y el imidazol de 5 mM. Añadir una cierta cantidad de resina NiNTA (10-40 mL) basada en el rendimiento estimado de la proteína recombinante expresada su etiquetado.<ol>
<li>Mezcle la solución en una agitación magnética con velocidad baja a 4 ° C por 1 h. lavar la resina y eluir la proteína encuadernada siguiendo el estándar de protocolo de purificación de NiNTA18.</li>
	</ol>
</li>
	<li>Conforme la proteína purificada a intercambio iónico y cromatografía de filtración, así como otros métodos de purificación de proteínas, para obtener una muestra homogénea del gel. Nota: Para el ectodominio TDR, 20 mM Tris, pH 8, 100 mM NaCl fueron utilizados como búfer de filtración de gel. Para PRK3 ectodominio, bis-20 mM de Tris, pH 6, 100 mM NaCl fueron utilizados como el búfer de filtración recomendado: gel.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

Los autores no tienen nada que revelar.

Dada la diversidad de tamaño y estabilidad de los miles de proteínas presentes en los sistemas biológicos, a menudo es empírica para la investigación de un laboratorio para decidir qué sistema de expresión heteróloga debe elegirse para la expresión de una proteína específica. El sistema de expresión de e. coli es a menudo la primera opción para la expresión de la proteína debido al corto ciclo de vida de las bacterias, bajo costos de los medios de cultivo y la relativa facilidad para escalar<sup c...

Es imprescindible para un laboratorio de investigación ser capaces de producir grandes cantidades de proteínas recombinantes homogéneas para caracterizaciones bioquímicas y biofísicas, especialmente para estudios cristalográficos de rayos x. Existen muchos sistemas de expresión heteróloga bien establecido como Escherichia coli, levaduras, células de los insectos, células de mamíferos, células de la planta, etc. entre ellos, el sistema de expresión celular de insecto baculovirus-mediada es uno de los más usan técnicas para producir grandes cantidades de proteínas eucarióticas recombinantes gran tamaño estructural plegadas para la cristalización de proteínas1.
Los vectores de expresión del sistema de expresión de baculovirus se han diseñado para contener una fuerte polyhedrin o promotor de P10 para producir un alto rendimiento de proteínas recombinantes intracelular2,3. Para hacer un baculovirus recombinante, se clona el gen de interés en un insecto vector que contiene el locus polyhedrin (polh) del genoma de nucleopolyhedroviral múltiple de Autographa californica . La construcción resultante luego se ordena y se verifica su marco correcto de lectura abierta (ORF). La construcción correcta es entonces introducida en la célula de insecto huésped a través del proceso de transfección. El gen de interés se inserta en el genoma viral por recombinación homóloga. Este evento resulta en la producción del genoma viral recombinante, que luego se replica en producir recombinantes reverdeció de partículas de virus1.
Las células de los insectos que comúnmente se utilizan en el sistema de expresión son Sf9 y cinco celdas (Hi5). Las células SF9 son un aislamiento clonal de Sf21, derivado de las células ováricas pupas de Spodoptera frugiperda, y células de Hi5 un aislamiento clonal derivado de la parental Trichoplusia ni ovárico de la célula línea TN-3684,5. Transfecciones Co, amplificación virus y ensayos de placa se llevan a cabo en las células Sf9, mientras que las células Hi5 típicamente se seleccionan para producir mayores cantidades de proteínas recombinantes6. Cabe destacar que las células de Hi5 no son adecuadas para la generación y amplificación de progenie del virus debido a su tendencia a producir virus mutantes. Tradicionalmente, un rango de temperatura de 25-30 ° C se considera buena para el cultivo de células de los insectos. Sin embargo, se ha reportado que 27-28 ° C es la temperatura óptima para el insecto célula crecimiento e infección7,8.
La introducción de una secuencia de señal fuerte precede el gene es necesario para la alta expresión de las proteínas secretadas. La secuencia de la señal guía eficientemente la proteína recombinante traducida en el retículo endoplásmico para la secreción de proteínas y modificaciones postraduccionales necesarias para el plegamiento correcto y estabilización3. Secuencias de péptidos de señal, tales como el baculovirus envuelven proteína GP64/67, abeja melitina y otros, han sido elegidas para facilitar la expresión de proteínas recombinantes secretores en los sistemas de expresión de baculovirus-mediada3. La introducción del péptido señal de GP67 ha demostrado para mejorar el rendimiento de la expresión de una proteína recombinante secretada, en comparación con usando el péptido señal intrínseca del objetivo gen9. Hemolin es una proteína de la hemolinfa de la polilla de seda gigante Hyalophora cecropia, inducida por bacterias infección10. Debido al relativamente alto nivel de expresión inducida, puede utilizarse la secuencia del péptido de señal del gen para mediar en la expresión de la secreción de proteínas recombinantes en el sistema de células de insecto baculovirus.
La a. thaliana Tracheary elementos diferenciación inhibidor Factor Receptor (TDR) y el polen del Receptor quinasa 3 (PRK3), ambos pertenecen a la Leucine-rich Repeat Receptor-como Kinase (LRR-RLK) familia de proteínas11,12 . Para estudiar la estructura y la función de esta familia de receptores proteínas vegetales, así como para facilitar la caracterización bioquímica y estructural de otras proteínas vegetales secretada, se ha modificado el sistema de expresión de baculovirus-insecto célula a mejorar el rendimiento de producción y calidad de proteína. Los dominios extracelulares de TDR y PRK3 se han expresado con éxito mediante dos vectores de expresión modificada en el sistema de expresión de células de insecto baculovirus. Tanto los dominios extracelulares de proteínas TDR y PRK3 han se ha cristalizado. Este artículo divulga la expresión y purificación de grandes cantidades de proteínas recombinantes secretadas planta con vectores de expresión de baculovirus modificados dos incorporando un GP67 o una secuencia de señal hemolin entre el promotor y múltiples sitios.

<table>
	<tbody>
		<tr>
			<td>Incubator shaker</td>
			<td>VWR</td>
			<td>Model Excella E25</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>VWR</td>
			<td>Model 2005</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>BECKMAN</td>
			<td>Model J-6</td>
			<td>with a swing bucket rotor</td>
		</tr>
		<tr>
			<td>Herculase II Fusion DNA Polymerase</td>
			<td>Agilent</td>
			<td>600677-51</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>BIO-RAD</td>
			<td>Model C1000 Touch</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Incubator shaker</td>
			<td>New Brunswick Scientific</td>
			<td>Model I 24</td>
			<td>For growing baceria culture</td>
		</tr>
		<tr>
			<td>Customer DNA synthesis</td>
			<td>GENSCRIPT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3136S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>BglII</td>
			<td>New England Biolabs</td>
			<td>R0144S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>NotI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3189S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>New England Biolabs</td>
			<td>R0146S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td>DNA ligation</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td>DNA purification from Agorase gel</td>
		</tr>
		<tr>
			<td>QIAprep Spin Miniprep Kit</td>
			<td>Qiagen</td>
			<td>27104</td>
			<td>Plasmid DNA purification from bacteria culture</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Thermo Fisher Scientific</td>
			<td>15510-019</td>
			<td>For DNA gel electropherosis</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH5&#945; competen cell</td>
			<td>Invitrogen</td>
			<td>18-258-012</td>
			<td>For transformation of DNA ligation mixture</td>
		</tr>
		<tr>
			<td>Lennox L LB Broth</td>
			<td>Research Product International Corp.</td>
			<td>L24066-5000.0</td>
			<td>For making bacteria culture</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Thermo Fisher Scientific</td>
			<td>11593-019</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Thermo Fisher Scientific</td>
			<td>15160-054</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Thermo Fisher Scientific</td>
			<td>64-75-5</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15710-064</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH10Bac competent cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>10361-012</td>
			<td>For making bacmid DNA</td>
		</tr>
		<tr>
			<td>S.O.C. Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>15544-034</td>
			<td>For DNA transformation</td>
		</tr>
		<tr>
			<td>CellFECTIN II Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>10362-101</td>
			<td>Insect cell transfection reagent</td>
		</tr>
		<tr>
			<td>Bac-to-Bac Expression System</td>
			<td>Thermo Fisher Scientific</td>
			<td>10359-016</td>
			<td>Baculovirus-insect cells expression kit</td>
		</tr>
		<tr>
			<td>Bluo-gal</td>
			<td>Thermo Fisher Scientific</td>
			<td>15519-028</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Thermo Fisher Scientific</td>
			<td>15529-019</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>pFastBac1</td>
			<td>Thermo Fisher Scientific</td>
			<td>10360014</td>
			<td>Baculorirus expression vector</td>
		</tr>
		<tr>
			<td>Sf9 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>11496015</td>
			<td>Sf9 monolayer cells</td>
		</tr>
		<tr>
			<td>Hi5 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>B85502</td>
			<td>High Five insect cells</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, unsupplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11595030</td>
			<td>Sf9 cell transfection minimum medium</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, supplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11605102</td>
			<td>Sf9 monolayer cell culture complete medium</td>
		</tr>
		<tr>
			<td>Sf-900 II SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10902104</td>
			<td>Sf9 suspension cell culture medium without FBS</td>
		</tr>
		<tr>
			<td>Express Five SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10486025</td>
			<td>Hi5 cell culture medium</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td>100 ml (10,000 I.U./ml)</td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>25030081</td>
			<td>100 ml</td>
		</tr>
		<tr>
			<td>FBS Certified</td>
			<td>Thermo Fisher Scientific</td>
			<td>16000-044</td>
			<td>500 ml</td>
		</tr>
		<tr>
			<td>6-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>08-772-1B</td>
			<td>Flat-bottom</td>
		</tr>
		<tr>
			<td>150 mm plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>353025</td>
			<td>100/case</td>
		</tr>
		<tr>
			<td>1.5 ml Microcentrifuge Tubes</td>
			<td>USA Scientific</td>
			<td>1415-2500</td>
			<td>500 tubes/bag</td>
		</tr>
		<tr>
			<td>15 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1475-0511</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>50 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1500-1211</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>Ni-NTA Superflow</td>
			<td>Qiagen</td>
			<td>30430</td>
			<td>NiNTA resin</td>
		</tr>
		<tr>
			<td>pH-indicator strips</td>
			<td>EMD Millipore Corporation</td>
			<td>1.09535.0001</td>
			<td>pH 0 - 14</td>
		</tr>
	</tbody>
</table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

Ha sido un reto para los científicos expresar proteínas recombinantes de eucariotas secretores para estudios estructurales y bioquímicos. El sistema de expresión celular de insecto baculovirus-mediada es uno de los sistemas utilizados para expresar proteínas secretoras eucarióticas recombinantes con algunas modificaciones poste-de translación. Las proteínas secretoras que deba canalizarse a través de las vías secretoras de glycosylation de la proteína, formación de enlaces disulfuro y otras modificaciones poste-de translación. Para mejorar la expresión de células de insectos existentes de proteínas secretoras de vegetales, un vector de expresión de baculovirus se modifica por la adición de un GP67 o una secuencia de péptido señal hemolin entre el promotor y la clonación de múltiples sitios. Este sistema de nuevo diseño vector modificado había producido con éxito un alto rendimiento de proteínas de receptor soluble recombinante planta secretada de Arabidopsis thaliana. Dos de las proteínas de la planta expresada, los dominios extracelulares de los receptores de membrana plasmática de Arabidopsis TDR y PRK3, se cristalizaron para estudios cristalográficos de rayos x. El sistema vector modificado es una herramienta mejorada que potencialmente puede ser utilizada para la expresión de proteínas recombinantes secretores en el reino animal también.

Como se muestra en la figura 1, se utilizaron dos vectores de expresión de baculovirus modificados pFastBac1 para expresar las proteínas secretadas con la GP67 o la secuencia de señal hemolin para reemplazar la secuencia de la señal intrínseca de la gene de la blanco. GP67 viral y los genes de insectos hemolin han demostrado tener niveles de expresión de alta secreción en las células. Se espera que las proteínas de fusión con cualquiera de estas dos...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Modificación de vectores de expresión de Baculovirus para producir secretado proteínas vegetales en células de los insectos

Aquí, presentamos los protocolos para la utilización de la célula y baculovirus proteína expresión sistema insecto para producir grandes cantidades de proteínas vegetales segregada para la cristalización de proteínas. Un vector de expresión de baculovirus se ha modificado con GP67 o insectos hemolin péptido señal para la expresión de la secreción de la proteína de planta en células de los insectos.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Research

JoVE Journal

Biochemistry

11.4K vistas.  North Carolina State University. Aquí, presentamos los protocolos para la utilización de la célula y baculovirus proteína expresión sistema insecto para producir grandes cantidades de proteínas vegetales segregada para la cristalización de proteínas. Un vector de expresión de baculovirus se ha modificado con GP67 o insectos hemolin péptido señal para la expresión de la secreción de la proteína de planta en células de los insectos.

Video: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

Termoestabilización, Expresión, purificación y cristalización del transportador de serotonina humano enlazado a<em&gt; S</em&gt; citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Investigación

Bioquímica

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

Aislamiento y medidas respiratoria de las mitocondrias de Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

Extracción de cafeína, la actividad enzimática y la expresión del gen de la sintasa de cafeína de suspensiones celulares de plantas

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Dissipative Microgravimetry to Study the Binding Dynamics of the Phospholipid Binding Protein Annexin A2 to Solid-supported Lipid Bilayers Using a Quartz Resonator

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic properties of the absorbed/immobilized mass on sensor surfaces, allowing the measurements of the interaction of proteins with solid-supported surfaces, such as lipid bilayers, in real-time and with a high sensitivity. Annexins are a highly conserved group of phospholipid-binding proteins that interact reversibly with the negatively charged headgroups via the coordination of calcium ions. Here, we describe a protocol that was employed to quantitatively analyze the binding of annexin A2 (AnxA2) to planar lipid bilayers prepared on the surface of a quartz sensor. This protocol is optimized to obtain robust and reproducible data and includes a detailed step-by-step description. The method can be applied to other membrane-binding proteins and bilayer compositions.

Here, we present an experimental protocol that can be employed to determine the binding affinities and mode of interaction of label-free phospholipid-binding protein annexin A2 with immobilized solid-supported bilayers (SLB) by simultaneously measuring the mass uptake and the viscoelastic properties of the protein annexin A2.

Microgravimetry disipativo para estudiar la dinámica de unión de la fosfolípido vinculante proteínas anexina A2 a bicapas de lípidos respaldados por el sólido utilizando un resonador de cuarzo

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic ...

How to Quantify the Fraction of Photoactivated Fluorescent Proteins in Bulk and in Live Cells

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells and protein ensembles. Thus far, no method has been available to quantify in bulk and in live cells how many of the PA-FPs expressed are photoactivated to fluoresce.
Here, we present a protocol involving internal rulers, i.e., genetically coupled spectrally distinct (photoactivatable) fluorescent proteins, to ratiometrically quantify the fraction of all PA-FPs expressed in a cell that are switched on to be fluorescent. Using this protocol, we show that different modes of photoactivation yielded different photoactivation efficiencies. Short high-power photoactivation with a confocal laser scanning microscope (CLSM) resulted in up to four times lower photoactivation efficiency than hundreds of low-level exposures applied by CLSM or a short pulse applied by widefield illumination. While the protocol has been exemplified here for (PA-)GFP and (PA-)Cherry, it can in principle be applied to any spectrally distinct photoactivatable or photoconvertible fluorescent protein pair and any experimental set-up.

Here, we present a protocol that involves genetically coupled spectrally distinct photoactivatable and fluorescent proteins. These fluorescent protein chimeras permit quantification of the PA-FP fraction that is photoactivated to be fluorescent, i.e., the photoactivation efficiency. The protocol reveals that different modes of photoactivation yield different photoactivation efficiencies.

Cómo cuantificar la fracción de proteínas fluorescentes fotoactivado a granel y en células vivas

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

Uso en transferencia de energía de resonancia de la fluorescencia de Vitro para el estudio de la dinámica de los complejos de la proteína en una escala de tiempo de milisegundos

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

Expresión, purificación, cristalización y ensayos enzimáticos de proteínas que contienen el dominio de la hidrolasa fumarilacetoacetato

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Obtaining High-Quality Transcriptome Data from Cereal Seeds by a Modified Method for Gene Expression Profiling

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality RNA is often hindered by high starch and sugar content. These compounds can reduce both the yield and the quality of the extracted total RNA. The deterioration in quantity and quality of total RNA can subsequently have a significant impact on the downstream transcriptomic analyses, which may not accurately reflect the spatial and/or temporal variation in the gene expression profile of the samples being tested. In this protocol, we describe an optimized method for extraction of total RNA with sufficient quantity and quality to be used for whole transcriptome analysis of cereal grains. The described method is suitable for several downstream applications used for transcriptomic profiling of developing, germinating, and mature cereal seeds. The method of transcriptome profiling using a microarray platform is shown. This method is specifically designed for gene expression profiling of cereals with described genome sequences. The detailed procedure from microarray handling to final quality control is described. This includes cDNA synthesis, cRNA labelling, microarray hybridization, slide scanning, feature extraction, and data quality validation. The data generated by this method can be used to characterize the transcriptome of cereals during germination, in various stages of grain development, or at different biotic or abiotic stress conditions. The results presented here exemplify high-quality transcriptome data amenable for downstream bioinformatics analyses, such as the determination of differentially expressed genes (DEGs), characterisation of gene regulatory networks, and conducting transcriptome-wide association study (TWAS).

A method for transcriptome profiling of cereals is presented. The microarray-based gene expression profiling starts with the isolation of high-quality total RNA from cereal grains and continues with the generation of cDNA. After cRNA labelling and microarray hybridization, recommendations are given for signal detection and quality control.

Obtención de datos de transcriptoma de alta calidad de Cereal Seeds mediante un método modificado para la generación de perfiles de expresión génica

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality ...

Transverse Sectioning of Mature Rice (Oryza sativa L.) Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm phenotyping can be used to classify genotypes based on SG morphotype using scanning electron microscopic (SEM) analysis. SGs can be visualized using SEM by slicing through the kernel (pericarp, aleurone layers, and endosperm) and exposing the organellar contents. Current methods require the rice kernel to be embedded in plastic resin and sectioned using a microtome or embedded in a truncated pipette tip and sectioned by hand using a razor blade. The former method requires specialized equipment and is time-consuming, while the latter introduces a new host of problems depending on rice genotype. Chalky rice varieties, particularly, pose a problem for this type of sectioning due to the friable nature of their endosperm tissue. Presented here is a technique for preparing translucent and chalky rice kernel sections for microscopy, requiring only pipette tips and a scalpel blade. Preparing the sections within the confines of a pipette tip prevents rice kernel endosperm from shattering (for translucent or &#8216;vitreous&#8217; phenotypes) and crumbling (for chalky phenotypes). Using this technique, endosperm cell patterning and the structure of intact SGs can be observed.

Transverse Sectioning of Mature Rice Oryza sativa L. Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

This protocol allows for the preparation of transverse sections of cereal seeds (e.g., rice) for the analysis of endosperm and starch granule morphology using scanning electron microscopy.

Seccionamiento transversal de arroz maduro (Oryza sativa L.) Núcleos para imágenes de microscopía electrónica de barrido utilizando puntas de pipeta como soporte de inmovilización

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm ...

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

Modificación de vectores de expresión de Baculovirus para producir secretado proteínas vegetales en células de los insectos

PLAYLIST