behavior

JoVE Behavior documents observational and experimental techniques that seek to understand human and animal behavior. Work in this field includes analysis of genetic causes and physiological responses to internal or external stimuli as well as the implicated brain regions.

Behavior

biochemistry

JoVE Biochemistry publishes experiments that investigate the structure, function, and interactions of biological molecules. The video articles in this section demonstrate methods to study nucleic acids, proteins, carbohydrates and lipids as well as enzyme function, protein folding, molecular interactions and biochemical reactions.

Biochemistry

bioengineering

JoVE Bioengineering merges both physical and life sciences to understand and predict biological processes. Applying physical science tools to life science questions allow for the discovery of better technologies to measure, diagnose, and clinically treat disease.

Bioengineering

biology

JoVE Biology welcomes all general biology research methodologies. Content in this section canvases all fields of cell, molecular, and organismal biology, ranging from new applications of standard techniques to novel approaches aimed at understanding the functions of life and living organisms. This diverse section includes, but is not limited to, techniques in physical biology, cellular biochemistry, genetics, physiology, systems biology and a combination of eukaryotic and prokaryotic model systems.

Biology

cancer research

JoVE Cancer Research illustrates experimental approaches in biomedical research and clinical practice aimed at understanding, detecting, treating and preventing cancer. The video articles in this section demonstrate methods to study the cellular and molecular mechanisms of cancer, animal models of cancer research, development of new therapies and diagnostics, tumor imaging, chemical and radiation treatments, surgical procedures and improvements in therapy. These video articles offer researchers and clinical practitioners an efficient way to learn the technologies and experimental methods in cancer research.

Cancer Research

chemistry

JoVE Chemistry surveys a broad scope of chemical disciplines. This collection includes fundamental and applied research that investigates molecular interactions, properties, and structure spanning in the following core divisions: analytical, organic, organometallic, inorganic, bioinorganic, and biochemistry. This section also includes the design and preparation of materials and small molecules for advanced or unique applications.

Chemistry

developmental biology

JoVE Developmental Biology publishes research methodologies in the field of developmental biology. This includes methods that are used to study biological development in vitro and in vivo at the molecular, cellular, tissue, organ and whole organism levels.

Developmental Biology

engineering

JoVE Engineering encompasses a broad range of experimental and instrumental techniques utilized in physics research. Investigations in this area strive to address and answer a broad range of scientific questions, such as device mechanisms and efficiencies, using physical tools. This approach often requires a combination of specialties, and research in this area tends to be interdisciplinary with contributions from mechanical, electrical, and chemical engineers.

Engineering

environment

JoVE Environment is dedicated to research methodologies that address environmental concerns and seek to better understand Earth's ecosystem.  Special consideration is given to experimental methodologies that assess society’s impact on the environment, suggest solutions for protecting Earth’s resources, and develop sustainable fuel sources. Moving towards an environmentally conscious planet is a collaborative effort with contributions from both life and physical scientists.

Environment

genetics

JoVE Genetics publishes video articles demonstrating experimental approaches to investigate gene function and regulation. This includes methods to study gene expression, mutagenesis, epigenetics, genetic determinants of development, genetic disorders, population genetics and evolution.

Genetics

immunology and infection

JoVE Immunology and Infection includes content from a variety of fields working toward a shared initiative of improving global health. Techniques evaluating the biological response to pathogens from the molecular to organismal level are presented as well as therapeutic agents and their efficacy in treating disease.

Immunology and Infection

medicine

JoVE Medicine serves as a connection between basic research and clinical applications. Articles may present medical procedures, case studies or clinical trial methodologies. Included studies are often modeled towards predictive, preventative, personalized, and practical approaches to treatment of disease. The goal of research methodologies in this section is to improve overall patient care and prognosis.

Medicine

neuroscience

JoVE Neuroscience is a multidisciplinary section devoted to investigations of the structure, function, physiology, and pathophysiology of the brain and nervous system. Included methodologies range from molecular and cellular level studies to full central and peripheral neural systems. Potential treatment platforms and surgical techniques for neurological diseases and disorders are also presented in this section.

Neuroscience

jove journal

JoVE Journal

Scientific video journal. Peer reviewed. Multi-disciplinary. Indexed in PubMed and Web of Science.

https://cloudfront.jove.com/files/banners/journal/journal_lander.jpg

Research

Pipe Flowrate Measurement

In pipe flow measurement, orifice, nozzle, and Venturi meters are commonly used to determine fluid flowrates by constricting the flow area, which increases fluid velocity and reduces pressure. This pressure difference, governed by Bernoulli&#39;s principle and adjusted for real-world conditions, is essential for calculating flowrate. Each meter type is suited to specific applications based on accuracy, efficiency, and compatibility with various flow conditions.
The orifice meter is a simple, cost-effective device consisting of a flat plate with a central hole that creates a measurable pressure drop. This device is popular in applications like water treatment, oil and gas processing, and general industrial use where moderate accuracy is acceptable. However, due to head loss from turbulent flow and area contraction, a discharge coefficient is used to correct the idealized flow equation. The flowrate through an orifice meter is proportional to the square root of the pressure difference, accounting for fluid density, orifice area, and the ratio of the hole diameter to the pipe diameter.
The nozzle meter improves on the orifice meter by using a contoured design that reduces flow separation and turbulence, resulting in a smoother flow and increased measurement accuracy. It is often used for high-velocity flows, such as in steam or gas pipelines, chemical processing, and power plants. With a higher discharge coefficient than the orifice meter, the nozzle meter provides improved precision with less energy loss.
The Venturi meter offers the highest accuracy among the three types. It is ideal for applications requiring minimal head loss and reliable measurements, such as water supply systems, natural gas pipelines, and wastewater management. Its smooth contraction and gradual expansion reduce flow separation, conserving energy and enabling accurate flowrate calculations even in low-pressure systems. The discharge coefficient for a Venturi meter, which depends on factors like the ratio of the throat to pipe diameter and flow characteristics, supports exact flow measurement but requires a more complex installation and is generally more costly.
Each meter type offers unique benefits, from essential flow monitoring to precise flow control, chosen based on the application&#39;s accuracy needs and specific conditions.

מדידת ספיקת צינור

Flow measurement devices&#8212;such as orifice, nozzle, and Venturimeters&#8212;operate by narrowing the flow area. This increases fluid velocity and ...

Design Example: Designing a Residential Plumbing System

The design of residential plumbing systems requires carefully evaluating water demand, flow rates, and pressure dynamics to ensure both efficiency and reliability. The nature of water flow within pipes is defined by its Reynolds number, which classifies flow as either laminar (smooth) or turbulent.
<img alt="Equation 1" src="/files/ftp_upload/18086/18086_Equation_1.svg" style="text-align: center; height: 42px;" />
This dimensionless value depends on factors such as water velocity and pipe. Residential plumbing systems are designed to meet specific water demand and flow rate requirements based on occupancy and fixture needs.
Determining the nature of water flow &#8212; laminar or turbulent &#8212; requires calculating the Reynolds number, which depends on variables like pipe diameter and water velocity. In residential settings, flow is often turbulent, leading to higher energy loss due to friction, which impacts system efficiency. Energy losses, or head losses, arise as water moves through pipes. These losses are classified as either major or minor. Major losses from friction along pipe walls are calculated using the Darcy-Weisbach equation.
<img alt="Equation 2" src="/files/ftp_upload/18086/18086_Equation_2.svg" style="text-align: center; height: 42px;" />
The Darcy-Weisbach equation requires a friction factor, which is obtained from the Moody chart. This chart accounts for pipe roughness and flow characteristics, which significantly affect turbulent flow friction levels. Minor losses, in contrast, are caused by fittings, bends, and valves, each of which contributes resistance to flow. Each fitting is assigned a loss coefficient that quantifies its resistance and is factored into the total head loss.
<img alt="Equation 3" src="/files/ftp_upload/18086/18086_Equation_3.svg" style="text-align: center; height: 48px;" />
By adding major and minor losses, the overall head loss can be determined and managed so as to maintain adequate pressure, avoiding potential leaks or damage. Flow measurement devices like Venturi or orifice meters ensure the plumbing system provides the necessary flow rates. These meters measure flow rates by detecting pressure differences across constrictions in the pipe, confirming that water flow meets design specifications and household needs.

דוגמה עיצובית: תכנון מערכת אינסטלציה למגורים

The residential plumbing system is designed by assessing the building&#39;s water demand and flow rate needs based on occupancy and fixture requirements.
...

Pipe Flowrate Measurement: Problem Solving

A spray tank system is engineered to uniformly distribute a pest-control liquid across plants by using a pressurized mechanism. The tank, pressurized to 150 kPa, holds the pesticide at a height of 0.80 meters. Liquid flows from the tank through a 1.9 meter pipe with a diameter of 0.015 meters, angled at 0.698 radians, ultimately reaching a 0.007 meter nozzle that sprays the pesticide. Accurate calculation of the system&#39;s flow rate is crucial to ensure uniform application, and this is achieved by first determining the flow velocity within the connecting pipe.
The design requires an understanding of fluid mechanics principles. At the outset, the velocity of the fluid in the tank at Point 1 is zero, with the pressure set to 150 kPa. Point 2, located at the nozzle, is assumed to be open to the atmosphere, with a pressure of zero. The height difference between Points 1 and 2, calculated using the 0.698-radian pipe angle and pipe length, determines the elevation change component in the Bernoulli equation. This height difference is found by multiplying the pipe length by the sine of the inclination angle.
To connect the parameters at Points 1 and 2, a modified Bernoulli equation is used, accounting for energy losses due to friction and the nozzle&#39;s loss coefficient. The equation expresses the pressure, velocity, and elevation terms for both points as follows:
<img alt="Equation 1" src="/files/ftp_upload/18085/18085_PT_equation_1.svg" style="text-align: center; height: 30px;" />
Here, p represents pressure, &#961; the fluid density, V the velocity, g the gravitational acceleration, z1 the height of the pesticide inside the tank, and z2&#160; the nozzle height above the bottom of the tank. With values substituted for these terms, the flow velocity in the pipe at Point 1 is solved.
After calculating the pipe&#39;s flow velocity, the flow rate, Q, is determined by multiplying this velocity by the cross-sectional area A of the pipe:
<img alt="Equation 2" src="/files/ftp_upload/18085/18085_PT_equation_2.svg" style="text-align: center; height: 11px;" />
Where A is:
<img alt="Equation 3" src="/files/ftp_upload/18085/18085_PT_equation_3.svg" style="text-align: center; height: 25px;" />
This flow rate calculation ensures that the pesticide is delivered at a consistent and effective rate, optimizing pest control application.

מדידת קצב זרימה בצנרת: פתרון בעיות

Consider a spray tank system designed to evenly apply pest-control liquid to plants.
The system includes a pressurized tank at 150 kPa filled with ...

Single Pipe Systems

In pipe flow analysis, problems are typically categorized into three types &#8212; Type I, Type II, and Type III &#8212; based on the known parameters and the desired outcome. Each type of problem addresses specific engineering requirements using fluid properties, pipe characteristics, and operational conditions.
In a Type I problem, fluid properties (density and viscosity), pipe characteristics (including diameter, length, and surface roughness), and the flow rate or average velocity are known. The objective is calculating the pressure drop or head loss needed to maintain the specified flow rate. For instance, in a heating system circulating hot water at 0.32 liters per second, knowing the system&#39;s fluid and pipe specifications allows engineers to determine the required pressure to achieve steady flow. Type I problems are common in designing HVAC systems, where maintaining consistent flow is essential for effective temperature control.
A Type II problem provides the applied pressure, fluid properties, and pipe details, to calculate the resulting flow rate. This type of analysis is used in applications such as garden irrigation, where engineers need to determine the water flow rate in a sprinkler system operating at a specified pressure, such as 276 kilopascals. Knowing the pipe dimensions and roughness, the flow rate reaching each sprinkler can be calculated to ensure adequate water distribution.
In a Type III problem, the known parameters include the pressure drop and desired flow rate, to determine the optimal pipe diameter to support efficient flow. This scenario is typical in cooling systems or industrial piping design, where engineers must size the pipe to achieve a flow rate of 0.19 liters per second, balancing efficiency with minimal energy loss. Choosing an appropriate pipe diameter in Type III problems ensures the required flow rate while minimizing pressure losses and pump energy demands.
By systematically categorizing pipe flow problems, engineers can streamline analysis and ensure optimal design and performance for fluid transport systems in heating, irrigation, and industrial applications.

מערכות צינור יחיד

In pipe flow problems, scenarios are grouped by known information and desired calculation and are typically classified as Type I, II, or III.
In a Type I ...

Minor Losses in Pipes

In pipe systems, minor losses refer to energy losses arising from components such as valves, bends, fittings, expansions, and other features that disrupt the steady flow of fluid. These disturbances cause energy dissipation through turbulence and resistance, which engineers quantify to manage system efficiency effectively.
Valves play a significant role in generating minor losses by obstructing or redirecting the fluid flow. When a valve is closed or partially closed, it restricts the flow path, creating additional resistance and inducing turbulence. The resulting energy dissipation depends on the valve&#39;s geometry, position, and flow path design. To quantify this effect, engineers use a loss coefficient, K, which scales with the square of the fluid velocity V as follows:
<img alt="Equation 1" src="/files/ftp_upload/18081/18081_Equation_1.svg" style="text-align: center; height: 30px;" />
where:
<ol style="list-style-type: circle;">
	<li>hLminor is the head loss due to the component,</li>
	<li>KL is the loss coefficient specific to the component geometry,</li>
	<li>V is the fluid velocity</li>
	<li>g is the acceleration due to gravity.</li>
</ol>
For ease of calculation, engineers often represent minor losses from fittings and valves as an equivalent length of straight pipe that would produce the same head loss.
At the entry point of a pipe, sharp edges or abrupt changes in flow area can cause the fluid to separate from the wall, creating turbulence and energy dissipation through viscous effects. This entrance loss contributes to the overall energy loss, depending on the pipe geometry and the flow velocity. When fluid exits a pipe, the kinetic energy disperses into the surrounding environment, creating an exit loss characterized by a unity loss coefficient, as all the kinetic energy is lost from the system.
Sudden expansions in the pipe create high-velocity jets that decelerate as they expand, dissipating energy through viscous effects. These expansions lead to additional energy losses as the fluid experiences abrupt pressure and velocity changes. Bends in the pipe also contribute to head loss, primarily due to flow separation and swirling motions induced by centripetal forces as the fluid changes direction. The frictional resistance over the length of the bend adds further to the overall head loss, with the degree of loss depending on the bend angle and radius.
Understanding these minor losses allows engineers to design pipe systems that manage energy dissipation effectively, optimizing flow efficiency and minimizing pressure drops across the system.

הפסדים קלים בצינורות

Minor losses in pipe systems arise from components like valves, bends, and fittings that disrupt fluid flow, causing energy dissipation through turbulence ...

Multiple Pipe Systems

Multipipe systems consist of complex configurations of interconnected pipes designed to transport fluids efficiently across intricate networks. They are essential in engineering applications requiring precise control over flow distribution, pressure, and head loss. They are categorized into series, parallel, loop, and network configurations, each distinguished by unique flow characteristics and applications.
Series Configuration
In a series configuration, fluid flows sequentially from one pipe segment to the next, maintaining a constant flow rate throughout. This setup means each segment experiences the same flow rate, although head losses accumulate progressively across each section. The total head loss from an entry point A to an exit point B is the cumulative sum of head losses in each pipe, governed by the Darcy-Weisbach equation for head loss or similar empirical relationships. This configuration suits applications requiring a consistent flow rate along a fixed path, such as in specific water treatment processes.
Parallel Configuration
Parallel multipipe systems divide fluid flow across multiple paths, enabling a higher overall flow rate and reducing resistance across the network. Here, the total flow rate is the sum of the individual flow rates in each branch. However, a critical feature of parallel systems is that all paths experience the same pressure drop. Consequently, fluid particles in each path encounter identical head losses, regardless of the path taken. This arrangement is effective in systems needing efficient fluid distribution, such as in heating and cooling systems, where multiple paths ensure temperature control across large areas.
Loop and Network Configurations
In loop systems, the flow rate within one pipe is balanced by the combined flow rates of the other connected pipes, enabling fluid redistribution based on demand changes or localized resistance variations, such as in urban water distribution systems. Network configurations represent the most complex setup, involving numerous interconnected pipes with multiple inlets and outlets,such as in oil and gas pipeline networks. This flexibility allows for multiple flow directions, enhancing transport efficiency and adaptability to dynamic system demands.
Applications of Multipipe Systems
Multipipe systems are indispensable in several engineering sectors. Municipal water supply networks often use network configurations to ensure consistent pressure and reliable delivery across urban areas. In deepwater oil and gas pipelines, multipipe systems help manage the challenging pressures and flow conditions of underwater environments. Additionally, industrial cooling systems benefit from the controlled fluid distribution provided by parallel configurations, which improve heat dissipation and maintain optimal temperatures in manufacturing processes.

מערכות צינורות מרובות

Multiple pipe systems consist of interconnected pipes that regulate fluid flow across complex networks.
They can be arranged in series, parallel, loop, or ...

Major Losses in Pipes

When a fluid flows through a pipe, it experiences energy losses due to frictional resistance along the pipe walls, known as major losses. These energy losses result in a pressure drop, which varies based on the flow conditions &#8212; whether laminar or turbulent &#8212; and the specific physical properties of the fluid and pipe.
Fluid flow can be classified as laminar or turbulent, primarily based on the Reynolds number. This dimensionless number reflects the relative influence of inertial to viscous forces in the fluid. In laminar flow (Re &#60; 2000), the fluid flows in parallel layers, or streamlines, with minimal cross-stream mixing. Here, the pressure drop mostly depends on the fluid&#39;s viscosity and is generally lower. In contrast, turbulent flow (Re &#62; 4000) is characterized by chaotic eddies and swirling motions. In this regime, the pressure drop is influenced not only by viscosity but also by the roughness of the pipe wall, as these irregularities disrupt the flow further, increasing energy losses.
The pressure drop in a pipe depends on several factors: fluid properties, flow velocity, pipe characteristics, and dimensionless numbers.
The Darcy-Weisbach equation is the standard approach for quantifying the pressure drop due to frictional losses in pipe flow:
<img alt="Equation 1" src="/files/ftp_upload/18080/18080_Equation_1.svg" style="text-align: center; height: 30px;" />
Where:
<ol style="list-style-type: circle;">
	<li>&#916;P is the pressure drop,</li>
	<li>f is the friction factor,</li>
	<li>L is the length of the pipe,</li>
	<li>D is the pipe diameter,</li>
	<li>&#961; is the fluid density,</li>
	<li>v is the flow velocity.</li>
</ol>
The friction factor f is crucial for calculating pressure drops, especially in turbulent flow. It depends on the Reynolds number and the relative roughness of the pipe. Engineers often refer to the Moody chart, which provides empirical values of friction factors across flow regimes and roughness levels.
The Colebrook equation
<img alt="Equation 2" src="/files/ftp_upload/18080/18080_Equation_2.svg" style="text-align: center; height: 30px;" />
Where:
<ol style="list-style-type: circle;">
	<li>f is the friction factor,</li>
	<li>&#1013;/D is the relative roughness</li>
	<li>Re is the Reynolds number.</li>
</ol>
offers a precise method to calculate f for smooth and moderately rough pipes, but it is implicit and requires iterative solutions. To avoid iteration, approximations like the Haaland equation:
<img alt="Equation 3" src="/files/ftp_upload/18080/18080_Equation_3.svg" style="text-align: center; height: 30px;" />
Where:
<ol style="list-style-type: circle;">
	<li>f is the friction factor,</li>
	<li>&#1013;/D is the relative roughness</li>
	<li>Re is the Reynolds number.</li>
</ol>
are commonly used in practice, providing reasonably accurate friction factor values without extensive calculation. Understanding these dynamics enables engineers to design pipe systems that manage flow efficiently, compensating for potential pressure losses over time as pipe roughness increases.

הפסדים גדולים בצינורות

Consider &#160;a fluid flowing through a pipe; it encounters frictional resistance, causing energy losses known as major losses, resulting in a pressure ...

Turbulent Flow: Problem Solving

Carbonation is a process used to dissolve carbon dioxide gas in a liquid, commonly used in the production of carbonated beverages. Achieving efficient carbonation requires careful control of temperature, pressure, and flow conditions. By adjusting these parameters, carbonation efficiency can be maximized, producing a higher concentration of CO2&#160;in the liquid.
Temperature is a key factor in CO2 solubility. In this case, the CO2 gas and the liquid are cooled to 20&#176;C. Lower temperatures enhance the solubility of CO2, enabling a greater volume of gas to dissolve within the liquid. At this temperature, the CO2&#160;gas is pressurized to approximately 550 kPa. Elevated pressure increases the partial pressure of CO2&#160;over the liquid, further driving dissolution.
CO2 is pumped through a connecting pipe between two tanks, where the flow characteristics are crucial for maintaining steady carbonation. The high Reynolds number, defined as greater than 4000, indicates that the flow is turbulent rather than laminar. Turbulent flow improves gas-liquid contact by promoting mixing, which enhances CO2&#160;dissolution in the liquid. The Reynolds number (Re) is calculated using the equation:
<img alt="Equation 1" src="/files/ftp_upload/18079/18079_Equation_1.svg" style="text-align: center; height: 30px;" />
where:
<ol style="list-style-type: circle;">
	<li>&#961; is the density of CO2,</li>
	<li>v is the velocity of flow,</li>
	<li>D is the pipe diameter,</li>
	<li>&#956; is the dynamic viscosity of CO2.</li>
</ol>
The flow rate of CO2&#160;in this system is controlled by the pipe&#39;s cross-sectional area and the velocity of the gas. To maintain turbulent conditions, the flow velocity v is adjusted based on the desired Reynolds number, which allows the required pipe diameter to be calculated.
The Reynolds number equation can be rearranged to determine the pipe diameter for the required turbulent flow. The&#160;dynamic viscosity &#956; of CO2&#160;at 20&#176;C are obtained using physical property tables. The optimal pipe diameter can be calculated by substituting these values along with the target Reynolds number and flow velocity into the equation. This configuration ensures efficient CO2&#160;transport through the system, optimizing the liquid&#39;s carbonation conditions.

זרימה טורבולנטית: פתרון בעיות

Consider a liquid that needs to be carbonated. Both the liquid and the carbon dioxide gas are cooled. The temperature is selected as 20 degrees Celsius to ...

Turbulent Flow

Turbulent flow is characterized by unpredictable fluctuations in velocity and pressure, which result in a chaotic fluid movement distinct from the orderly patterns of laminar flow. While laminar flow is governed by smooth, parallel layers with minimal mixing, turbulent flow exhibits highly irregular, three-dimensional patterns. This behavior arises due to instabilities in the fluid&#39;s velocity profile, and amplifies as the flow velocity increases. Minor disturbances, known as turbulent spots, appear once the flow reaches a critical speed. When the Reynolds number &#8212; a dimensionless quantity expressing the ratio of inertial to viscous forces in a fluid &#8212; exceeds a threshold of around 4,000, these spots coalesce, generating fully developed turbulence.
Structure of Turbulent Flow in Pipes
In pipe systems, turbulent flow comprises three distinct regions: the viscous sublayer, the buffer layer, and the outer layer. The viscous sublayer forms close to the pipe wall, a thin boundary where viscous forces dominate, and the flow behaves similarly to laminar flow. Here, velocity follows a near-linear profile influenced by fluid viscosity, providing a stable region within the otherwise chaotic turbulent flow.
Above the viscous sublayer lies the buffer layer, a transitional zone where viscous and turbulent forces contribute to fluid motion. This region is marked by a logarithmic velocity profile that conforms to the logarithmic law of the wall, representing a balance between viscous and turbulent interactions. Further from the wall, turbulent eddies drive fluid movement in the outer layer, promoting rapid mixing and random motion across the flow.
Engineering Applications of Turbulent Flow
The chaotic nature of turbulent flow makes it advantageous in numerous engineering applications where mixing and energy dissipation are crucial. For instance, wastewater treatment systems rely on turbulent flow to enhance the mixing of chemicals, promoting efficient contaminant removal. In hydraulic engineering, turbulent flow dissipates energy in spillways, preventing structural damage by controlling water velocity. The turbulent mixing process also reduces river sediment buildup, maintaining navigable waterways and protecting aquatic ecosystems.

זרימה טורבולנטית

Turbulent flow is a fluid movement marked by chaotic shifts in pressure and velocity.
Unlike laminar flow, turbulent flow displays complex, irregular ...

General Characteristics of Pipe Flow II

When fluid enters a pipe, it first passes through the entrance region, where the velocity profile adjusts due to viscous effects. In this region, a boundary layer forms along the pipe walls and grows until it fully occupies the pipe&#39;s cross-section. Once the boundary layer merges, the flow becomes fully developed, with a steady velocity profile that remains consistent along the pipe&#39;s length.
The distance to reach a fully developed flow is called the entrance length and depends on the flow regime (laminar or turbulent) and the Reynolds number. Laminar flow typically has a shorter entrance length due to its smooth, gradual profile development, whereas turbulent flow requires a longer entrance length due to enhanced mixing and chaotic motion.
A pressure difference along the pipe&#39;s length drives fully developed flow in a constant-diameter pipe. In horizontal pipes, this pressure difference overcomes viscous forces, ensuring steady motion. The entrance region has a higher pressure gradient to account for acceleration as the velocity profile evolves. Once fully developed, the pressure gradient stabilizes, reflecting the energy needed to overcome viscosity.
Shear stress behaves differently in laminar and turbulent flows. In laminar flow, shear stress arises from molecular momentum transfer, resulting in smooth, orderly layers. Turbulent flow stems from momentum exchange between more significant, irregularly moving fluid particles, making it a macroscopic effect. These differences influence pressure distribution and flow characteristics.
For inclined pipes, gravity modifies the pressure gradient. Depending on the pipe&#39;s orientation, gravity can assist or resist flow, altering the force balance required for steady motion. The viscosity, pressure, and gravity interplay determine fluid behavior within the pipe.

מאפיינים כלליים של זרימת צינור II

As fluid enters a pipe, it first flows through an entrance region where the velocity profile adjusts, forming a boundary layer along the walls. This ...

Laminar Flow

Laminar flow represents a smooth, orderly fluid motion where particles move along parallel paths, resulting in minimal mixing between layers. Streamlined particle paths characterize this flow regime and occur under conditions where viscous forces dominate over inertial forces. The distinction between laminar, transitional, and turbulent flow is primarily determined by the Reynolds number, a dimensionless quantity calculated as:
<img alt="Equation 1" src="/files/ftp_upload/18076/18076_Equation 1.svg" style="text-align: center; height: 30px;" />
where &#961; is the fluid density, v is the flow velocity, D is the pipe diameter, and &#956; is the dynamic viscosity. A Reynolds number below approximately 2100 indicates laminar flow, while values above 4000 denote turbulent flow. Transitional flow occurs between these ranges as the fluid shifts from laminar to turbulent.
Velocity Profile and Entrance Length
In a pipe, fluid initially entering develops a velocity profile over a length known as the entrance length. During this phase, the flow transitions from a uniform profile at the inlet to a fully developed parabolic profile, where the velocity is highest at the center and gradually decreases toward the pipe walls due to viscous forces. The entrance length is a function of the Reynolds number and pipe characteristics, typically shorter in turbulent flow and longer in laminar flow. Once fully developed, the parabolic velocity profile remains stable unless disrupted by changes in pipe geometry, allowing consistent analysis of flow behavior along the pipe&#39;s length.
Energy Loss and Hagen-Poiseuille Law
Laminar flow is advantageous in minimizing energy loss, as the pressure drop along the pipe is dominated by viscous forces rather than turbulence. The relationship between pressure drop and flow rate in a fully developed laminar flow is defined by the Hagen-Poiseuille equation:
<img alt="Equation 2" src="/files/ftp_upload/18076/18076_Equation 2.svg" style="text-align: center; height: 30px;" />
where &#916;P is the pressure drop, &#956; is the dynamic viscosity, L is the pipe length, Q is the volumetric flow rate, and R is the pipe radius. This equation shows that the pressure drop in laminar flow is directly proportional to flow rate and fluid viscosity and inversely proportional to the fourth power of the pipe radius, highlighting the significant impact of pipe diameter on energy efficiency.
Applications of Laminar Flow
Laminar flow conditions are essential in applications that require smooth, predictable fluid motion with minimal mixing. Wastewater treatment systems, for example, benefit from laminar flow to avoid excessive energy loss and facilitate controlled fluid handling. In canal designs for irrigation, laminar flow promotes even distribution without turbulent disturbances, enhancing water delivery efficiency. Hydropower systems can also leverage laminar flow for more efficient energy conversion, particularly in sections where consistent, low-energy flow is needed.

זרימה למינרית

Laminar flow refers to the smooth, orderly motion of fluid particles in which each particle follows parallel paths with minimal mixing between layers.
The ...

Laminar Flow: Problem Solving

Laminar flow occurs when a fluid moves smoothly in parallel layers with minimal mixing and turbulence. In fluid mechanics, ensuring laminar flow within a pipe is essential for precise control of flow characteristics, especially in engineering applications. The key factor in determining whether flow remains laminar is the Reynolds number, a dimensionless quantity that depends on the fluid&#39;s velocity, density, viscosity, and the pipe&#39;s diameter. A Reynolds number of 2100 or lower indicates laminar flow, while higher values lead to turbulence.
For air flowing through a pipe at standard atmospheric conditions and a given mass flow rate, the velocity of the fluid must be controlled to maintain laminar conditions. Since velocity depends on the flow rate and the cross-sectional area of the pipe, the pipe diameter plays a crucial role. By substituting the velocity expression into the Reynolds number formula and solving for the diameter, it is possible to determine the minimum required pipe size.
Using standard values for air density and viscosity at 300 Kelvin, the volumetric flow rate can be computed. This, in turn, allows for the calculation of the necessary pipe diameter. To ensure a Reynolds number of 2100 or lower, the minimum allowable diameter for the pipe is found to be approximately 0.46 meters. This calculation ensures that the flow remains smooth and predictable, avoiding turbulence that could disrupt performance.

זרימה למינרית: פתרון בעיות

Consider air flowing through the pipe at 300 Kelvin at standard atmospheric pressure, with a mass flowrate of 0.0163 kilograms per second. If the flow is ...

General Characteristics of Pipe Flow I

Pipe flow refers to the movement of fluids within fully enclosed conduits, typically cylindrical in shape, such as water pipes or hydraulic hoses. These conduits are designed to withstand high-pressure gradients that drive fluid movement, contrasting with open-channel flows, where gravity is the primary driving force. Rectangular conduits, like air conditioning and heating ducts, generally operate at lower pressures and are less suited for high-pressure applications.
The classification of fluid flow in pipes was pioneered by Osborne Reynolds through his foundational dye injection experiments. Reynolds identified three flow regimes &#8212; laminar, transitional, and turbulent &#8212; based on fluid velocity. At low velocities, the dye maintained a smooth streakline, indicating laminar flow, where fluid particles follow orderly, parallel paths. As velocity increased, the dye began to oscillate, marking the transitional regime, and at higher velocities, it dispersed unpredictably in the turbulent regime, where random, chaotic motion dominates.
These observations led to the development of the Reynolds number, a dimensionless quantity that indicates the balance of inertial and viscous forces in the flow. The Reynolds number is calculated based on fluid velocity, density, viscosity, and pipe diameter and serves as an indicator of flow type: laminar for values below 2100, turbulent for values above 4000, and transitional in the range between. In laminar flow, velocity remains steady over time, while turbulent flow exhibits unsteady, fluctuating velocities with random components perpendicular to the pipe axis. By calculating the Reynolds number, engineers can predict flow behavior in pipe systems, aiding in the design and optimization of pipelines, hydraulic systems, and fluid transport networks across various industries.

מאפיינים כלליים של זרימת צינור I

Pipe flow describes fluid movement through enclosed, fully-filled conduits, typically cylindrical pipes like water pipes or hydraulic hoses, engineered to ...

Design Example: Creating a Hydraulic Model of a Dam Spillway

Scaled hydraulic models of dam spillways provide a practical way to replicate and study the intricate flow dynamics of these structures. Often built to a 1:15 ratio, these models allow for observing critical water behavior, such as velocity distribution, flow patterns, and energy dissipation.
<img alt="Equation 1" src="/files/ftp_upload/18074/18074_Equation_1.svg" style="text-align: center; height: 38px;" />
Through this controlled setup, researchers can closely examine how water flows over the spillway, supporting a detailed analysis of its performance. A fundamental principle behind these models is using Froude number similarity, which preserves the proper balance between gravitational and inertial forces.
<img alt="Equation 2" src="/files/ftp_upload/18074/18074_Equation_2.svg" style="text-align: center; height: 38px;" />
This similarity is essential, as it ensures that free-surface flow characteristics, including wave formation, turbulence, and flow separation, behave as they would in the full-sized structure. By achieving this accurate representation, scaled models provide valuable insights into how water interacts with spillway features, helping to pinpoint areas where the design might benefit from adjustments to enhance safety or flow efficiency.
In the scaled model, adjustments are also applied to discharge rates, flow velocities, and timing to reflect real-world conditions without requiring extensive water volumes or prolonged test durations. The discharge rate, for example, is reduced by the scale factor to maintain manageable flow rates, enabling safe experimentation.
<img alt="Equation 3" src="/files/ftp_upload/18074/18074_Equation_3.svg" style="text-align: center; height: 36px;" />
Additionally, time is compressed so that events unfolding over an entire day in the full-scale structure can be examined in just a few hours within the model.
<img alt="Equation 4" src="/files/ftp_upload/18074/18074_Equation_4.svg" style="text-align: center; height: 48px;" />
This efficient scaling supports rapid testing and analysis of different flow conditions and potential structural responses. Overall, scaled modeling of spillways is crucial for assessing designs, identifying potential vulnerabilities, and confirming that the full-scale structure will perform reliably under various water flow conditions.

דוגמה עיצובית: יצירת מודל הידראולי של מברץ סכר

A hydraulic model of a dam spillway is often created by scaling down the design, typically to a 1:15 ratio, to replicate key flow characteristics such as ...

Dimensionless Groups in Fluid Mechanics

Dimensionless groups in fluid mechanics provide simplified ratios that help analyze fluid behavior without relying on specific units. The Reynolds number (Re), which represents the ratio of inertial to viscous forces, distinguishes between laminar and turbulent flows, making it essential in the design of pipelines and aerodynamic surfaces. The Froude number (Fr), the ratio of inertial to gravitational forces, is particularly useful in predicting wave formation and hydraulic jumps in open-channel flows and coastal engineering.
The Euler number (Eu) indicates the ratio of pressure forces to inertial forces and is used to calculate pressure drops in systems such as pipelines and across valves. The Cauchy number (Ca), representing the ratio of inertial to elastic forces, is critical in compressible fluid flow analysis and the study of shockwaves. The Mach number (Ma) compares the flow speed to the speed of sound, making it crucial for studies in supersonic flight and aeroelasticity.
The Strouhal number (St), which compares oscillatory frequency to inertial forces, finds applications in resonance studies, particularly vortex shedding around structures like bridge piers. Lastly, the Weber number (We), showing the ratio of inertial to surface tension forces, is vital in analyzing droplet formation, spray dynamics, inkjet printing, and fuel atomization processes. These groups enable the comparison of fluid behaviors across different scales and systems, supporting a broad range of fluid dynamics applications.

קבוצות חסרות ממד במכניקת זורמים

The dimensionless groups in fluid mechanics are ratios of physical quantities used to describe and analyze fluid behavior independently of units of ...

Correlation of Experimental Data

Dimensional analysis simplifies complex physical problems and guides experimental investigations, but it does not provide complete solutions. It identifies the dimensionless groups that influence a phenomenon, but experimental data is needed to establish the specific relationships and validate theoretical predictions.
For example, a spherical particle moving through a viscous fluid experiences drag. Dimensional analysis shows that the drag force depends on the particle&#39;s diameter, velocity, and the fluid&#39;s viscosity. These variables are grouped into dimensionless terms to form a relationship, but experimental data is needed to determine the exact nature of this relationship.
Researchers measure drag force while varying velocity to correlate the dimensionless groups, such as the Reynolds number. This correlation allows the relationship between drag and velocity to be expressed as a constant. Multiple tests verify this constant, confirming the dependency of drag on velocity.
If drag depends only on diameter, velocity, and viscosity, the relationship should be universal for any spherical particle in any fluid under consistent conditions. Multiple tests with different particles and fluids verify this universality, reducing the need for further experiments, as the derived constant remains valid under the specified conditions.

קורלציה של נתוני ניסוי

A key use of dimensional analysis is to efficiently manage, interpret, and correlate experimental data.
Dimensional analysis alone cannot fully solve a ...

Determination of Pi Terms

The Buckingham Pi theorem is a valuable method in dimensional analysis, reducing complex relationships between variables into dimensionless terms. Relevant variables in analyzing the lift force on an airplane wing include lift force, air density, wing area, aircraft velocity, and air viscosity. Expressing each variable in terms of fundamental dimensions &#8212; mass, length, and time &#8212; provides a consistent foundation for constructing these dimensionless terms.
The theorem indicates that the number of Pi terms equals the total variables minus the number of fundamental dimensions. In this example, five variables and three dimensions result in two Pi terms. Air density, velocity, and wing area are selected as repeating variables, as they independently cover all dimensions. These repeating variables combine with lift force and viscosity to form dimensionless Pi terms.
<img alt="Equation 1" src="/files/ftp_upload/18069/18069_Equation_1.svg" style="text-align: center; height: 100px;" />
The first Pi term expresses the efficiency of lift generation, representing how lift depends on density, velocity, and area. The second Pi term accounts for the relative impact of viscosity, revealing how viscous forces interact with the wing in relation to inertia.
Each Pi term is verified as dimensionless, allowing complex aerodynamic behavior to be represented in simplified expressions. This approach enables the prediction and optimization of lift under various conditions, capturing the essential dynamics without needing to examine each factor individually.

קביעת תנאי Pi

To determine Pi terms using the Buckingham Pi theorem, consider the example of analyzing lift force on an airplane wing.
Relevant variables here include ...

Modeling and Similitude

Scaled modeling is a fundamental technique in engineering, enabling the study of large and complex systems by creating smaller, manageable replicas that recreate critical characteristics of the original. In hydrology and civil infrastructure, for example, scaled models of dams help analyze water flow, turbulence, and pressure. This method allows for accurate predictions of real-world behavior within a controlled environment, significantly reducing the cost and time involved in full-scale testing, which is often impractical. These models provide valuable insights into system performance under various conditions by ensuring that essential design elements match.
For the model to yield valid insights, it must maintain similitude, meaning the replica accurately reflects the prototype&#39;s behavior through geometric, kinematic, and dynamic similarity. Geometric similarity ensures the scaled model retains the same proportional dimensions as the actual structure, while kinematic similarity requires that motion characteristics match between model and prototype. Dynamic similarity further demands that forces acting within the model accurately replicate those in the real system, accounting for any scaling effects.
In fluid dynamics, the Froude number is a key dimensionless parameter that matches scaled models to their full-sized counterparts, especially for applications like ship design. The Froude number is defined as:
<img alt="Equation 1" src="/files/ftp_upload/18072/18072_Equation_1.svg" style="text-align: center; height: 60px;" />
where V represents velocity, g is the gravitational acceleration, and L is a characteristic length, often the ship&#39;s length. By equating the Froude numbers for both the model and the full-scale ships, the gravitational and inertial forces align, allowing the scaled model to accurately predict behaviors such as maneuverability, stability, and wave formation.

דוגמנות ודמיון

A scaled model of a dam is tested in a controlled environment to observe how it will manage water flow, turbulence, and pressure.
This setup predicts the ...

Typical Model Studies

Fluid mechanics model studies often utilize scaled-down systems to predict fluid behavior in full-scale environments, such as river flows, dam spillways, and structures interacting with open surfaces. Maintaining Froude number similarity in river models is crucial, as it replicates surface flow features like wave patterns and velocities.
<img alt="Equation 1" src="/files/ftp_upload/18073/18073_Equation_1.svg" style="text-align: center; height: 48px;" />
Practical constraints, however, can introduce geometric distortions, impacting how accurately these models represent the real system. Adjustments, such as increased model roughness, help bridge this gap, aligning flow behaviors between the model and the actual river environment.
For hydraulic structures like spillways, the focus shifts to achieving high Reynolds numbers to maintain dynamic similarity. This approach emphasizes balancing inertial and gravitational forces to replicate the prototype&#39;s behavior closely.
<img alt="Equation 2" src="/files/ftp_upload/18073/18073_Equation_2.svg" style="text-align: center; height: 45px;" />
Larger models are generally preferred, as they capture critical force interactions more effectively in full-scale designs. Although exact similarity across all scales may not be feasible due to physical and financial limitations, these larger models still allow close approximations of essential conditions.
Verification tests and prototype comparisons are key for refining model accuracy. Adjusting variables and calibrating outcomes ensure that the model reliably mirrors actual fluid flow behaviors. This predictive capability supports planning and design adaptations, making these models indispensable tools for assessing performance before moving to full-scale implementation.

מחקרי מודל אופייניים

Typical model studies analyze scaled-down systems to predict fluid behavior, focusing on interactions with free surfaces and flow around immersed bodies.
...

Dimensional Analysis

Dimensional analysis is a valuable technique in fluid mechanics for simplifying complex problems by reducing them into dimensionless groups. These groups capture the essential relationships between the variables involved, allowing researchers and engineers to analyze fluid flow without dealing with each variable individually. This approach reduces the number of independent variables, allowing for easier analysis and better understanding of physical phenomena.
In fluid mechanics, dimensional analysis is used to understand the behavior of fluids in systems such as pipelines, channels, and other structures common in civil engineering. Consider the example of fluid flow through a long, smooth-walled, horizontal circular pipe, which is typical in the design of water distribution systems or sewage networks. The pressure drop per unit length along the pipe depends on variables such as pipe diameter, fluid density, fluid velocity, and viscosity. According to dimensional analysis, the pressure drop can be expressed as a function of these variables:
<img alt="Equation 1" src="/files/ftp_upload/18067/18067_Equation_1.svg" style="text-align: center; height: 12px;" />
This formulation involves five independent variables, which can complicate the analysis. To simplify this, we can use dimensional analysis to reduce the number of variables into two dimensionless groups, thus streamlining the problem. Two important dimensionless groups that emerge from this analysis are the Reynolds number, which characterizes the flow regime, and the friction factor, which correlates with the pressure drop.
<img alt="Equation 2" src="/files/ftp_upload/18067/18067_Equation_2.svg" style="text-align: center; height: 30px;" />
Engineers use the dimensionless groups to generate a universal curve that applies to any smooth-walled pipe and incompressible Newtonian fluid. This curve would allow them to predict the pressure drop for different pipe sizes and fluids without performing numerous experiments for each possible combination.
<img alt="Figure 1" src="/files/ftp_upload/18067/18067_PT_Figure.svg" style="text-align: center; height: 250px;" />
This approach minimizes the time and cost required for experimentation and allows for more straightforward design decisions. Whether designing water distribution networks or analyzing pressure losses in irrigation systems, dimensional analysis is critical for any civil engineer.

אנליזה ממדית

Dimensional analysis helps simplify fluid flow problems by using dimensionless groups, reducing complex variables into simpler terms that are easier to ...

The Buckingham Pi Theorem

The Buckingham Pi theorem provides a structured method to simplify fluid dynamics problems by reducing complex systems of variables to dimensionless terms.
<img alt="Equation 1" src="/files/ftp_upload/18068/18068_Equation_1.svg" style="text-align: center; height: 34px;" />
In analyzing flow through a pipe, variables that define the system include the pipe&#39;s diameter, the fluid&#39;s velocity, its density, and viscosity. These can be combined into a single dimensionless term, the Reynolds number (Re), which captures their essential relationship.
<img alt="Equation 2" src="/files/ftp_upload/18068/18068_Equation_2.svg" style="text-align: center; height: 38px;" />
The first step in applying the Buckingham Pi theorem is identifying the fundamental dimensions of each variable. In fluid mechanics, these are typically mass, length, and time. Here, the diameter represents length, velocity combines length and time, density encompasses mass and volume, and viscosity incorporates mass, length, and time.
<img alt="Equation 3" src="/files/ftp_upload/18068/18068_Equation_3.svg" style="text-align: center; height: 140px;" />
The theorem suggests that the number of independent dimensionless groups, known as Pi terms, is the difference in the number of variables k and the number of fundamental dimensions r. Only one dimensionless term is needed with four variables and three dimensions, simplifying analysis.
<img alt="Equation 4" src="/files/ftp_upload/18068/18068_Equation_4.svg" style="text-align: center; height: 32px;" />
This single term, the Reynolds number, compares inertial forces to viscous forces in the fluid. Establishing this ratio reveals whether the flow is likely to be smooth and orderly, known as laminar flow, or chaotic and irregular, known as turbulent flow. Lower values indicate laminar flow, where viscous forces dominate, and the fluid moves in parallel layers. Higher values reflect turbulent flow, where inertial forces lead to chaotic motion. The Buckingham Pi theorem&#39;s application in this context reduces complex interactions to a single term, making it easier to generalize flow behavior under varying conditions.

משפט בקינגהאם פי

Consider the flow through a pipe, where key variables include the pipe&#39;s diameter D, fluid velocity V, density &#961;, and viscosity &#956;.
To ...

Navier&#8211;Stokes Equations

For incompressible Newtonian fluids, where density remains constant, stresses show a linear relationship with the deformation rate, defined by normal and shear stresses. Normal stresses depend on the pressure exerted on the fluid and the rate of deformation in specific directions, which determines how fluid flows under varying pressures. Shear stresses, on the other hand, act tangentially across fluid layers. They explain how adjacent fluid layers slide relative to one another, connecting tangential stress to velocity differences between layers. Normal and shear stresses define the internal forces within a fluid that influence its movement.
The Navier-Stokes equations are derived by incorporating these stress relationships into differential equations of motion.
<img alt="Equation 1" src="/files/ftp_upload/18062/18062_Equation_1.svg" style="text-align: center; height: 106px;" />
These equations balance inertial, pressure, and gravitational forces in a viscous fluid and are fundamental to predicting fluid behavior under various conditions. The inertia term in the Navier-Stokes equations accounts for fluid acceleration, representing the fluid&#39;s resistance to changes in velocity. This term is critical in capturing the momentum conservation of a moving fluid, as it demonstrates how fluids resist sudden shifts in speed or direction.
The pressure gradient term within the Navier-Stokes equations drives fluid movement by creating a net force from areas of high pressure to low pressure. Meanwhile, the viscous terms represent internal friction arising from molecular interactions within the fluid. Depending on the velocity gradients present, these viscous forces act to slow down the fluid movement.
Each directional Navier-Stokes equation captures internal forces like viscous stress and external forces like gravity. These equations allow for predicting fluid motion in various conditions, from simple to complex flows. For steady or laminar flow scenarios, where flow is smooth and orderly, the equations become more manageable, enabling more straightforward analysis. This simplification is useful in controlled scenarios like boundary layer flow, where flow near a surface has a structured layer, and in Couette flow, describing fluid between two parallel surfaces moving at different velocities.

משוואות נאוויה-סטוקס

In fluid motion under viscous conditions, shear stress is directly proportional to fluid deformation. In incompressible Newtonian fluids, this stress ...

Plane Potential Flows

Plane potential flows simplify fluid motion by assuming the fluid to be irrotational and incompressible. These characteristics allow these flows to be described by a velocity potential function, &#981;, representing the flow speed in a given direction, and a stream function, &#968;, that visualizes the flow path, both governed by Laplace&#39;s equation. These parameters help in estimating flow patterns, velocity distributions, and pressure fields around various hydraulic structures.
Uniform Flow
Uniform flow represents the simplest form of potential flow, with fluid moving in a straight line at a constant velocity. Streamlines are straight, parallel, and evenly spaced, clearly visualizing flow across channels or pipes with constant velocity. This flow type is essential in designing canals, pipelines and drainage systems, where the assumption of constant velocity aids in flow rate estimation and hydraulic design.
Source and Sink Flows
Source and sink flows describe radially symmetric flows originating from or converging to a point. In a source flow, fluid moves radially outward from a central point, while in a sink flow, it converges inward. These flows are modeled using a flow rate parameter to represent the strength of the source or sink. This model is widely used in groundwater hydrology, where source flows represent groundwater recharge, such as that from an injection well, and sink flows represent groundwater extraction in a pumping well.&#160; represent groundwater extraction from a pumping well., and sink flows simulate groundwater recharge .
Vortex Flow
Vortex flow involves fluid circulating a central point and appears in two forms: free and forced. In a free vortex, particles move in circular paths around a center point without external force, creating a whirlpool effect often observed in natural bodies of water. This model is used to design spillways and drainage systems that manage spiraling water flow to prevent clogging or turbulence. In a forced vortex, an external force drives the fluid&#39;s rotation, creating a scenario where the fluid rotates as a rigid body. Forced vortices are used in sedimentation tanks and certain hydraulic devices where uniform rotation aids in sediment separation and fluid mixing.
Flow Nets
In flow nets, streamlines represent the fluid flow path, while equipotential lines mark points of equal hydraulic potential. These lines intersect perpendicularly, creating a grid pattern that aids in identifying pressure distributions and potential seepage paths around structures. Flow nets are constructed to assess seepage in soil or porous media. Seepage rates are estimated by carefully analyzing the spacing and orientation of these lines and identifying potential areas of erosion or structural weakness.

זרימות פוטנציאליות מישוריות

Plane potential flows simplify fluid motion by assuming irrotational and incompressible flow, governed by a velocity potential function and a stream ...

Steady, Laminar Flow Between Parallel Plates

Understanding steady, laminar flow between parallel plates is essential for analyzing and designing flow in narrow rectangular channels, commonly found in various water conveyance and drainage systems. The Navier-Stokes equations govern fluid motion and are generally challenging to solve due to their nonlinearity. However, simplifications are possible in certain cases, like the steady laminar flow between parallel plates. For this scenario, we assume steady, incompressible, laminar flow.
Considering two horizontal plates aligned along the x-axis and spaced a distance &#39;2h&#39; apart, with the y-axis perpendicular to the plates, fluid motion is assumed to be parallel. Here, the continuity equation indicates no change in velocity along the x-axis, and the Navier-Stokes equations reduce as follows:
<img alt="Equation 1" src="/files/ftp_upload/18063/18063_Equation_1.svg" style="text-align: center; height: 30px;" />
The equations in the y and z directions show no pressure gradient along these axes, indicating that pressure varies hydrostatically in the y-direction, allowing integration to yield:
<img alt="Equation 2" src="/files/ftp_upload/18063/18063_Equation_2.svg" style="text-align: center; height: 12px;" />
For parallel plates with a pressure gradient along the x-axis, the equation simplifies:
<img alt="Equation 3" src="/files/ftp_upload/18063/18063_Equation_3.svg" style="text-align: center; height: 30px;" />
By integrating twice and applying boundary conditions (u = 0 at y = +h and y = -h), we obtain:
<img alt="Equation 4" src="/files/ftp_upload/18063/18063_Equation_4.svg" style="text-align: center; height: 30px;" />
This expression reveals that the velocity profile across the gap between the plates is parabolic, with maximum velocity at y = 0, midway between the plates. The volumetric flow rate through a unit width of the plates is obtained by integrating the velocity profile across the gap.
Understanding laminar flow between parallel plates has practical applications in groundwater flow, wastewater treatment, and lubrication. For instance, this model can approximate flow in soil layers, where water moves between soil particles like flow between plates. Knowing the flow rate and velocity distribution helps engineers design efficient drainage systems and predict groundwater movement.

זרימה יציבה ולמינרית בין לוחות מקבילים

Steady, laminar flow between two parallel plates describes fluid movement in a narrow, confined channel, often used to model simple fluid systems.
For ...

Creating a Winogradsky Column: A Method to Enrich the Microbial Species in a Sediment Sample

Source: Elizabeth Suter1, Christopher Corbo1, Jonathan Blaize1 
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, 10301
The Winogradsky column is a miniature, enclosed ecosystem used for enriching sediment microbial communities, especially those involved in sulfur cycling. The column was first used by Sergei Winogradsky in the 1880s and has since been applied in the study of many diverse microorganisms involved in biogeochemistry, such as photosynthesizers, sulfur oxidizers, sulfate reducers, methanogens, iron oxidizers, nitrogen cyclers, and more (1,2).
The majority of microorganisms on Earth are considered unculturable, meaning that they cannot be isolated in a test tube or on a petri dish (3). This is due to many factors, including that microorganisms depend on others for certain metabolic products. The conditions in a Winogradsky column closely mimic a microorganism&#39;s natural habitat, including their interactions with other organisms, and allows for them to be grown in a lab. Therefor, this technique permits scientists to study these organisms and understand how they are important to Earth&#39;s biogeochemical cycles without having to grow them in isolation.
Earth&#39;s environments are full of microorganisms which thrive in all types of habitats, such as soils, ocean water, clouds, and deep-sea sediments. In all habitats, microorganisms depend on each other. As a microorganism grows, it consumes particular substrates, including carbon-rich fuels like sugars as well as nutrients, vitamins, and respiratory gases like oxygen. When these important resources run out, different microorganisms with different metabolic needs can then bloom and thrive. For example, in the Winogradsky column, microbes first consume the added organic material while depleting the oxygen in the bottom layers of the column. Once the oxygen is used up, anaerobic organisms can then take over and consume different organic materials. This consecutive development of different microbial communities over time is called succession (4). Microbial succession is important in a Winogradsky column, where microbial activity changes the chemistry of the sediment, which then affects activity of other microbes and so on. Many microorganisms in soils and sediments also live along gradients, which are transitional zones between two different types of habitats based on the concentrations of substrates (5). At the correct spot in the gradient, a microbe can receive optimal amounts of different substrates. As a Winogradsky column develops, it begins to mimic these natural gradients, particularly in oxygen and sulfide (Fig. 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10506/10506fig1.jpg" /> 
Figure 1: A representation of the oxygen (O2) and sulfide (H2S) gradients that develop in a Winogradsky column.
In a Winogradsky column, mud and water from a pond or wetland are mixed in a transparent column and allowed to incubate, typically in the light. Additional substrates are added to the column to give the community sources of carbon, usually in the form of cellulose, and sulfur. Photosynthesizers typically start to grow in the top layers of the sediment. These photosynthetic microorganisms are largely composed of cyanobacteria, which produce oxygen and appear as a green or red-brown layer (Fig. 2, Table 1). While photosynthesis produces oxygen, oxygen is not very soluble in water and it decreases below this layer (Fig. 1). This creates a gradient of oxygen, ranging from high concentrations of oxygen in the top layers to zero oxygen in the bottom layers. The oxygenated layer is called the aerobic layer and the layer without oxygen is called the anaerobic layer.
In the anaerobic layer, many different microbial communities can proliferate depending on the type and amount of substrates that are available, the source of the initial microbes, and the porosity of the sediment. At the bottom of the column, organisms that anaerobically break down organic matter can thrive. Microbial fermentation produces organic acids from the breakdown of cellulose. These organic acids can then be used by sulfate reducers, which oxidize those organics using sulfate, and produce sulfide as a byproduct. The activity of sulfate reducers is indicated if the sediment turns black, because iron and sulfide react to form black iron-sulfide minerals (Fig. 2, Table 1). The sulfide also diffuses upward, creating another gradient in which sulfide concentrations are high in the bottom of the column and low in the top of the column (Fig. 1).
Near the middle of the column, sulfur oxidizers take advantage of the supply of oxygen from above and sulfide from below. With the right amount of light, photosynthetic sulfur oxidizers can develop in these layers. These organisms are known as green and purple sulfur bacteria, and often appear as green, purple, or purple-red filaments and blotches (Fig. 2, Table 1). Green sulfur bacteria have a higher tolerance for sulfide and usually develop in the layer directly below purple sulfur bacteria. Above the purple sulfur bacteria, purple nonsulfur bacteria may also develop. These organisms photosynthesize using organic acids as electron donors instead of sulfide and often appear as a red, purple, orange, or brown layer. Nonphotosynthetic sulfur oxidizers can develop above the purple nonsulfur bacteria, and these usually appear as white filaments (Fig. 2, Table 1). Additionally, bubbles may also form in the Winogradsky column. Bubbles in the aerobic layers indicates the production of oxygen by the cyanobacteria. Bubbles in the anaerobic layers are likely due to the activity of methanogens, organisms which anaerobically break down organic matter and form methane as a byproduct.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Position in Column</td>
			<td>Functional group</td>
			<td>Organism Examples</td>
			<td>Visual Indicator</td>
		</tr>
		<tr>
			<td>Top</td>
			<td>Photosynthesizers</td>
			<td>Cyanobacteria</td>
			<td>Green or reddish-brown layer. Sometimes bubbles of oxygen.</td>
		</tr>
		<tr>
			<td rowspan="5"></td>
			<td>Nonphotosynthetic sulfur oxidizers</td>
			<td>Beggiatoa, Thiobacilus</td>
			<td>White layer.</td>
		</tr>
		<tr>
			<td>Purple nonsulfur bacteria</td>
			<td>Rhodomicrobium, Rhodospirilum, Rhodopseuodmonas</td>
			<td>Red, purple, orange, or brown layer.</td>
		</tr>
		<tr>
			<td>Purple sulfur bacteria</td>
			<td>Chromatium</td>
			<td>Purple, or purple-red layer.</td>
		</tr>
		<tr>
			<td>Green sulfur bacteria</td>
			<td>Chlorobium</td>
			<td>Green layer.</td>
		</tr>
		<tr>
			<td>Sulfate Reducing Bacteria</td>
			<td>Desulfovibrio, Desulfotomaculum, Desulfobacter, Desulfuromonas</td>
			<td>Black layer.</td>
		</tr>
		<tr>
			<td>Bottom</td>
			<td>Methanogens</td>
			<td>Methanococcus, Methanosarcina</td>
			<td>Sometimes bubbles of methane.</td>
		</tr>
	</tbody>
</table>
Table 1: The main groups of bacteria that may appear in a classical Winogradsky column, from top to bottom. Examples of organisms from each group are given, and the visual indicators of each layer of organisms are listed. Based on Perry et al. (2002) and Rogan et al. (2005).

Winogradsky Column to Enrich Microbial Species in a Sample

יצירת טור וינוגרדסקי: שיטה להעשרת המינים המיקרוביאליים בדוגמת משקעים

Source: Elizabeth Suter1, Christopher Corbo1, Jonathan Blaize1
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, 
...

Serial Dilutions and Plating: Microbial Enumeration

Source: Jonathan F. Blaize1, Elizabeth Suter1, and Christopher P. Corbo1 
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, 10301
Quantitative assessment of prokaryotes can be onerous given their abundance, propensity for exponential proliferation, species diversity within a population, and specific physiological needs. Compounding this challenge, is the four-phase nature in which bacteria replicate (lag, log, stationary and death). The ability to accurately estimate microorganism concentration is necessary for successful identification, isolation, cultivation, and characterization (6). As such, microbiologists have employed serial dilution and various plating techniques for over a century to reliably quantify bacterial and viral load in clinical, industrial, pharmaceutical, and academic laboratory environments (2,4,6). Descriptions of this methodology first appeared in 1883 when the German scientist and physician Robert Koch published his work on infectious disease-causing agents (2). Often referred to as the father of modern bacteriology, Koch&#39;s forenamed techniques have become the gold standard for enumeration of microorganisms, culturable or otherwise, throughout the world.
Serial dilution is a systematic reduction of a known or unknown entity (a solute, organism, etc.) through successive re-suspension of an initial solution (solution0) into fixed volumes of a liquid diluent (blanks). These blanks usually consist of 0.45% saline, though the composition can be varied (7). While an experimenter can choose any volume for each diluent, it is most often a multiple of 10, facilitating logarithmic reduction of the sample. For example, solution0 contains a total of 100 E. coli cells suspended in 10 mL of nutrient broth. If 1 mL of solution0 is removed and added to 9 mL of saline (diluent1), the new solution (solution1) would contain 1/10th of the initial concentration of E. coli. In this example, the new solution (solution1) would contain 10 E. coli cells. Repeating this process by removing 1 mL of solution1 and adding it to another 9 mL of saline (diluent2) would yield solution2, containing only a single E. coli cell. Since each new solution (9 mL of diluent + 1 mL of solution) contains a total of 10mL, we can conclude that the dilution factor for this reduction is 10 or that this was a 10-fold serial dilution (Figure 1). Since we only began with 100 cells in this example and we are diluting by a factor of 10, only two steps are required to reach the absolute minimum concentration of 1 cell.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10507/10507fig1.jpg" /> 
Figure 1: Serial dilution of a stock solution. A 1 mL aliquot of the stock solution (solution0) is added to tube 1 which contains 9 mL of 0.45% saline (dilent1); the product of this mixture is solution1. Repeat by aliquoting 1 mL of the newly created solution1 and adding it to tube 2. Aliquoting and resuspension continues in this fashion until the final tube is reached, diluting the stock concentration by a factor of 10 each with each step. <a href="https://www.jove.com/files/ftp_upload/10507/10507fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Serial dilution is the simplest technique for obtaining manageable concentrations of a desired organism and it is complemented by petri dish streaking and spreading, just two of many plating techniques used by microbiologists. This benefit of this approach is that the experimenter can harvest pure strains of a single species or separate strains from a mixed population (7). Streaking is accomplished by introducing an organism to a solid medium (generally consisting of agarose) that it will grow upon if the appropriate nutrients are available. Gently sweeping a sterile inoculating loop across the medium (so that a subtle streak remains) in a rigid sinusoidal pattern will distribute the organism proportionally to the frequency of the experimenter&#39;s waveform. Dividing the Petri dish into thirds or fourths (quadrant streak) and decreasing the frequency of each streak as a new region of the dish is entered will gradually reduce the number of microorganisms that can occupy that region, producing single colonies instead of an unquantifiable bacterial lawn. Spread plating does not additionally dilute samples; a sterile glass spreader is used to distribute an aliquot of suspension media across an entire petri dish (Figure 2). The colonies that grow on the spread plate arise from a single cell and each colony on the dish can be counted to estimate the number of colony forming units per milliliter (CFU) in a given suspension, represented as CFU/mL (6) (Figure 3) Soft agar and replica plating are variations of the aforementioned techniques and allow for isolation of bacteriophage and mutant screening, respectively (1,7).
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10507/10507fig2.jpg" /> 
Figure 2: Plate streaking for bacterial enumeration and strain isolation. Label the bottom of a petri dish with identification information (bacteria name, date, media) and divide into thirds. After selecting an appropriate dilution of the stock sample, take a sterile (disposable or flamed) inoculating loop and submerge it the test tube (here, T3). Slightly raise the petri dish cover on one side so that only the inoculating loop can access the agar. Glide the inoculating loop across the top of the media in a zig-zag fashion being careful not to compromise the agar. Rotate the plate by roughly 1/3rd (~118&#176;) and reduce the frequency of zig-zag motion. Rotate a final time and reduce zig-zag frequency once more. <a href="https://www.jove.com/files/ftp_upload/10507/10507fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/10507/10507fig3.jpg" /> 
Figure 3: Spread plating. 1 g of the aerobic zone was resuspended in T1 and then serially diluted. A sterile glass or plastic disposable spreading rod is used to distribute inoculum throughout each dish. This was repeated with 1 g of the anaerobic zone. <a href="https://www.jove.com/files/ftp_upload/10507/10507fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
As with serial dilutions, a logarithmic scale is employed to express organismal concentration. The number of colonies grown in standard petri dishes measuring 100mm x15mm can be enumerated manually (or automated with the aid of computational processing) by identifying isolated clusters of growth. Counts that total fewer than 30 or greater than 300 should be defined as too few to count (TFTC) or too numerous to count (TNTC), respectively. In the case of the latter, a serial dilution should be performed to reduce concentration before restreaking a new petri dish. Averaging the number of self-contained colonies identified from three separate petri dishes and multiplying the mean by the dilution factor will yield CFU/mL; plotting the log10 of CFU/mL against time will reveal the mean generation time of the organism (7).

דילול סדרתי ו ציפוי: ספירה מיקרוביאלית

Source: Jonathan F. Blaize1, Elizabeth Suter1, and Christopher P. Corbo1
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island ...

Enrichment Cultures: Culturing Aerobic and Anaerobic Microbes on Selective and Differential Medias

Source: Christopher P. Corbo1, Jonathan F. Blaize1, Elizabeth Suter1 
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, 10301
Prokaryotic cells are able to inhabit nearly every environment on this planet. As a kingdom, they possess a great metabolic diversity, allowing them to use a wide variety of molecules for energy generation (1). Therefore, when cultivating these organisms in the lab, all necessary and specific molecules required to make energy must be provided in the growth media. While some organisms are metabolically diverse, others are able to survive in extreme environments such as high or low temperatures, alkaline and acidic pH, reduced or oxygen absent environments, or environments containing high salt (2,3,4). Termed &#34;extremophiles&#34;, these organisms often require these intense environments to proliferate. When scientists look to grow such organisms, the media components as well as any specific environmental conditions all need to be taken into account in order to successfully cultivate the organisms of interest.
Scientists are able to grow culturable organisms in the lab because they understand the specific requirements that those species need to grow. However, culturable organisms account for less than 1% of species estimated to be on the planet (5). Organisms that we have detected by gene sequencing but are not able to grow in the lab are considered unculturable (6). At this time, we do not know enough about the metabolism and growth conditions of these organisms to replicate their environment in the lab.
Fastidious organisms lie somewhere in between the former two. These organisms are culturable, but they require very specific growth conditions, such as specific growth media components and/or specific growth conditions. Two examples of such genera are Neisseria sp. and Haemophilus sp., both of which require partially broken-down red blood cells (also known as chocolate agar), as well as specific growth factors and an environment rich in carbon dioxide (7). Without all of the required specific components, these organisms will not grow at all. Often, even with all of their requirements, these organisms grow poorly.
Unlike eukaryotic cells, which are only able to grow in an aerobic, or oxygen containing, environment, prokaryotic cells are able to grow anaerobically using several fermentation pathways to generate ample energy (8). Other prokaryotes prefer a microaerophilic, or reduced oxygen environment, or even a capnophilic, or high carbon dioxide environment (9). These organisms are more challenging to enrich for, since the atmosphere must be altered. Scientists that frequently work with organisms sensitive to an oxygenated environment would normally work in an anaerobic chamber and incubator, where a heavy, inert gas such as argon is pumped in to displace the oxygen (10). Others make use of conventionally available sealed gas packet systems that use water to generate hydrogen and carbon dioxide, along with a catalyst like palladium to remove all atmospheric oxygen. These commercially available kits can create any of the above-mentioned atmospheric conditions (10).
Whether cultivating a pathogen to determine potential infection or looking to identify a specific species of bacteria present in a natural environment, one problem exists. No one bacterial species inhabits one habitat. Bacteria live as multicellular communities everywhere from the skin of humans to the oceans of our planet (11). When attempting to isolate one species of bacteria, scientists must work to exclude the numerous other organisms that are also inhabiting the isolated area. For this reason, enriched growth media for bacteria often carry out two functions. The first is to make the media selective. A selective agent will prevent some species from growing, while not inhibiting and often even promoting others to grow (12). The second function of media ingredients may be to work as differential agents. Such agents allow for the identification of a particular biochemical feature of an isolated organism. By pairing several different selective and differential medias along with appropriate growth conditions, scientists and diagnosticians are able to identify the presence of specific bacterial species from a particular isolate.
One example of a selective and differential media aiding in to identification is in the case of the clinically significant organism Staphylococcus aureus. This organism is typically cultured on mannitol salt agar. This media not only selects for only organisms which can live in a high salt environment, which include some gram positives like Staphylococcus, but it also inhibits any organisms sensitive to salt. The mannitol sugar is the differential component of this medium. Of all the clinically significant Staphylococcus species, only S. aureus is able to ferment mannitol. This fermentation reaction produces acid as a by-product which causes the red methyl red indicator in the media to turn yellow. Other Staphylococcus species (such as Staphylococcus epidermidis) although able to grow, will leave the media red in color.
This lab exercise demonstrates proper aseptic technique, as well as proper inoculation of growth media from broth. It also introduces the growth of common contaminant organisms on enrichment media, the use of a gas package anaerobic culture system for anaerobic bacteria, and the use of different selective and differential medias for the presumptive identification of gram positive and gram-negative bacteria.

Enrichment Cultures, Selective and Differential Media

תרביות העשרה: מיקרואורובים אירוביים ואנאירוביים פולחניים על מדיות סלקטיביות ודיפרנציאליות

Source: Christopher P. Corbo1, Jonathan F. Blaize1, Elizabeth Suter1
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, ...

Pure Cultures and Streak Plating: Isolation of Single Bacterial Colonies from a Mixed Sample

Source: Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Seemingly impossible to determine, microbial biodiversity is truly astounding with an estimated one trillion coexisting species (1,2). Although particularly harsh climates, like the acidic environment of the human stomach (3) or the subglacial lakes of Antarctica (4), may be dominated by a specific species, bacteria are typically found in mixed cultures. As each strain may influence the growth of another (5), the ability to separate and cultivate &#34;pure&#34; (consisting only of one type) colonies has become essential in clinical and academic settings alike. Pure cultures enable further genetic (6) and proteomic examinations (7), analysis of sample purity and, perhaps more noteworthy, the identification and characterization of infectious agents from clinical samples.
Bacteria have a wide range of growth requirements and there are numerous types of nutrient media designed to sustain both the un-demanding and the fastidious species (8). Growth media can be prepared either in liquid form (as a broth) or in a typically agar-based (a gelling agent derived from red algae) solid form. Whereas direct inoculation into broth carries the risk of generating a genetically diverse or even mixed bacterial population, plating and re-streaking creates a purer culture where each cell has a highly similar genetic makeup. The streak plate technique is based on progressive dilution of a sample (Figure 1), with the aim of separating individual cells from one another. Any viable cell (hereafter referred to as a colony forming unit, CFU) sustained by the media and designated environment can subsequently found an isolated colony of daughter-cells through binary fission. In spite of the rapid mutation rates within bacterial communities, this cell-group is generally regarded as clonal. Harvesting and re-streaking this population consequently ensures that subsequent work involves only a single bacterial type.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10509/10509fig1.jpg" /> 
Figure 1: A streak plate is based on progressive dilution of the original sample. I) The inoculum is initially dispersed using a zig-zag motion, creating an area with a relatively dense bacterial population. II-IV) Streaks are drawn from the preceding area, using a sterile inoculation loop each time, until the fourth quadrant is reached. V) A final zig-zag motion directed towards the middle of the plate forms a region where the inoculum has been markedly diluted, allowing colonies to appear separate from one another.
The streak plate technique can also be combined with the use of selective and/or differential media. A selective medium will inhibit the growth of certain organisms (e.g. through addition of antibiotics) whilst a differential medium will solely help distinguish one from another (e.g. through hemolysis on blood agar plates).
Underlying all work in microbiology is the use of aseptic (sterile) techniques. Every bacterial culture should be considered potentially pathogenic as there is a risk of unintended growth of treacherous strains, aerosol formation and contamination of equipment/personnel. To minimize these risks, all media, plastic-, metal- and glass-ware are typically sterilized through autoclaving before and after use, subjecting them to high-pressure saturated steam at around 121&#176;C that effectively wipes out any lingering cells. The work space is generally disinfected using ethanol both prior to, and after, use. Lab coat and gloves are always worn during work with infectious agents.

Pure Cultures and Streak Plating: Isolation of Bacterial Colonies

תרביות טהורות ו ציפוי פסים: בידוד מושבות חיידקיות בודדות מדגם מעורב

Source: Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 ...

16S rRNA Sequencing: A PCR-based Technique to Identify Bacterial Species

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Planet Earth is a habitat for millions of bacterial species, each of which has specific characteristics. Identification of bacterial species is widely used in microbial ecology to determine biodiversity of environmental samples and medical microbiology to diagnose infected patients. Bacteria can be classified using conventional microbiology methods, such as microscopy, growth on specific media, biochemical and serological tests, and antibiotic sensitivity assays. In recent decades, molecular microbiology methods have revolutionized bacterial identification. A popular method is 16S ribosomal RNA (rRNA) gene sequencing. This method is not only faster and more accurate than conventional methods, but also allows identification of strains that are difficult to grow in laboratory conditions. Furthermore, differentiation of strains at the molecular level enables discrimination between phenotypically identical bacteria (1-4).
16S rRNA joins with a complex of 19 proteins to form a 30S subunit of the bacterial ribosome (5). It is encoded by the 16S rRNA gene, which is present and highly conserved in all bacteria due to its essential function in ribosome assembly; however, it also contains variable regions which may serve as fingerprints for particular species. These features have made the 16S rRNA gene an ideal genetic fragment to be used in identification, comparison, and phylogenetic classification of bacteria (6).
16S rRNA gene sequencing is based on the polymerase chain reaction (PCR) (7-8) followed by DNA sequencing (9). PCR is a molecular biology method used to amplify specific fragments of DNA through a series of cycles that include:
i) Denaturation of a double stranded DNA template 
ii) Annealing of primers (short oligonucleotides) that are complementary to the template 
iii) Extension of primers by the DNA polymerase enzyme, which synthesizes a new DNA strand
A schematic overview of the method is shown in Figure 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10510/10510fig1.jpg" /> 
Figure 1: Schematic overview of the PCR reaction. <a href="https://www.jove.com/files/ftp_upload/10510/10510fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
There are several factors that are important for a successful PCR reaction, one of which is quality of the DNA template. Isolation of chromosomal DNA from bacteria can be performed using standard protocols or commercial kits. Special care should be taken to obtain DNA that is free of contaminants that can inhibit the PCR reaction.
Conserved regions of the 16S rRNA gene permit the design of universal primer pairs (one forward and one reverse) that can bind to and amplify the target region in any bacterial species. The target region can vary in size. While some primer pairs can amplify most of the 16S rRNA gene, others amplify only parts of it. Examples of commonly used primers are shown in Table 1 and their binding sites are depicted in Figure 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence (5&#39;&#8594;3&#39;)</td>
			<td>Forward/ reverse</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>8F b)</td>
			<td>AGAGTTTGATCCTGGCTCAG</td>
			<td>forward</td>
			<td>-1</td>
		</tr>
		<tr>
			<td>27F</td>
			<td>AGAGTTTGATCMTGGCTCAG</td>
			<td>forward</td>
			<td>-10</td>
		</tr>
		<tr>
			<td>515F</td>
			<td>GTGCCAGCMGCCGCGGTAA</td>
			<td>forward</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>911R</td>
			<td>GCCCCCGTCAATTCMTTTGA</td>
			<td>reverse</td>
			<td>-12</td>
		</tr>
		<tr>
			<td>1391R</td>
			<td>GACGGGCGGTGTGTRCA</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>1492R</td>
			<td>GGTTACCTTGTTACGACTT</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
	</tbody>
</table>
Table 1: Examples of standard oligonucleotides used in amplification of 16S rRNA genes a). 
a) The expected lengths of the PCR product generated using the different primer combinations can be estimated by calculating the distance between the binding sites for the forward and the reverse primer (see Figure 2), e.g. the size of the PCR product using primer pair 8F-1492R is ~1500 bp, and for primer pair 27F-911R ~900 bp. 
b) also known as fD1
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10510/10510fig2.jpg" /> 
Figure 2: Representative figure of the 16S rRNA sequence and the primer-binding sites. Conserved regions are colored in grey and variable regions are filled with diagonal lines. To allow for the highest resolution, primer 8F and 1492R (name based on location on rRNA sequence) are used to amplify the whole sequence, allowing for the sequencing of several variable regions of the gene. <a href="https://www.jove.com/files/ftp_upload/10510/10510fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Cycling conditions for PCR (i.e. the temperature and time required for the DNA to be denatured, annealed with primers, and synthesized) are dependent on the type of polymerase that is used and the properties of the primers. It is recommended to follow the manufacturer&#39;s guidelines for a particular polymerase.
After the PCR program is completed, the products are analyzed by agarose gel electrophoresis. A successful PCR yields a single band of expected size. The product must be purified prior to sequencing to remove residual primers, deoxyribonucleotides, polymerase, and buffer which were present in the PCR reaction. The purified DNA fragments are usually sent for sequencing to commercial sequencing services; however, some institutions perform DNA sequencing at their own core facilities.
The DNA sequence is automatically generated from a DNA chromatogram by a computer and must be carefully checked for quality, as manual editing is sometimes needed. Following this step, the gene sequence is compared with sequences deposited in the 16S rRNA database. The regions of similarity are identified, and the most similar sequences are delivered.

16S rRNA Sequencing: Identifying Bacterial Species by PCR

ריצוף rRNA 16S: טכניקה מבוססת PCR לזיהוי מינים חיידקיים

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, ...

Growth Curves: Generating Growth Curves Using Colony Forming Units and Optical Density Measurements

Source: Andrew J. Van Alst1, Rhiannon M. LeVeque1, Natalia Martin1, and Victor J. DiRita1 
1 Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, Michigan, United States of America
Growth curves provide valuable information on bacterial growth kinetics and cell physiology. They allow us to determine how bacteria respond in variable growth conditions as well as to define optimal growth parameters for a given bacterium. An archetypal growth curve progresses through four stages of growth: lag, exponential, stationary, and death (1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10511/10511fig1.jpg" /> 
Figure 1: Bacterial growth curve. Bacteria grown in batch culture progress through four phases of growth: lag, exponential, stationary, and death. Lag phase is the period of time it takes for the bacteria to reach a physiological state capable of rapid cell growth and division. Exponential phase is the stage of fastest cell growth and division during which DNA replication, RNA transcription, and protein production all occur at a constant, rapid rate. Stationary phase is characterized by a slowing down and plateauing of bacterial growth due to nutrient limitation and/or toxic intermediate accumulation. Death phase is the stage during which cell lysis occurs as a result of severe nutrient limitation.
Lag phase is the period of time it takes for the bacteria to reach a physiological state capable of rapid cell growth and division. This lag occurs because it takes time for bacteria to adjust to their new environment. Once the necessary cellular components are generated in lag phase, bacteria enter the exponential phase of growth where DNA replication, RNA transcription, and protein production all occur&#160;at a constant, rapid rate (2). The rate of rapid cell growth and division during the exponential phase is calculated as the generation time, or doubling time, and is the fastest rate at which the bacteria can replicate under the given conditions (1). The doubling time can be used to compare different growth conditions to determine which is more favorable for bacterial growth. The exponential growth phase is the most reproducible growth condition as bacterial cell physiology is consistent throughout the entire population (3). Stationary phase follows the exponential phase where cell growth plateaus. Stationary phase is brought on due to nutrient depletion and/or accumulation of toxic intermediates. Bacterial cells continue to survive in this stage, although the rate of replication and cell division is drastically reduced. The final phase is death, where severe nutrient depletion leads to the lysing of cells. Features of the growth curve that provide the most information include the duration of lag phase, the doubling time, and the maximum cell density reached.
Quantification of bacteria in batch culture can be determined using both colony forming units and optical density measurements. Enumeration by colony forming units (CFU) provides a direct measurement of bacterial cell counts. The standard unit of measure for CFU is the number of culturable bacteria present per 1 mL of culture (CFU/mL) determined by serial dilution and spread plating techniques. For each timepoint, a 1:10 dilution series of the batch culture is performed and 100 &#181;l of each dilution is spread plated using a cell spreader.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10511/10511fig2.jpg" /> 
Figure 2. Serial dilution plating schematic. General flowthrough for dilution plating from batch culture. The batch culture is serially diluted 1:10 by transferring 1 mL &#160;of the previous dilution into the subsequent tube containing 9ml PBS. From each dilution tube, 100 &#181;l is spread plated using a plate spreader which is an additional dilution of 1:10 as it is 1/10th the volume of 1 mL volume when calculating CFU/mL. Plates are incubated and enumerated once clonal colonies grow on the plates.
The plates are then incubated overnight and clonal colonies enumerated. The dilution plate which grew 30-300 colonies is used to calculate the CFU/mL for the given timepoint (4, 5). Stochastic variation in colony counts under 30 are subject to greater error in the calculation of CFU/mL and counting colonies greater than 300 can be underestimated due to colony crowding and overlapping. Using the dilution factor for the given plate, the CFU of the batch culture can be calculated for each timepoint.
Optical density gives an instant approximation of bacterial cell count measured using a spectrophotometer. The optical density is a measure of absorbance of light particles that pass through 1cm of culture and detected by a photodiode sensor (6). The optical density of a culture is measured in relation to a media blank and increases as bacterial density increases. For bacterial cells, a wavelength of 600 nm (OD600) is typically used when measuring optical density (4). By generating a standard curve relating colony forming units and optical density, the optical density measurement can be used to readily approximate the bacterial cell count of a batch culture. However, this relationship begins to deteriorate as early as 0.3 OD600 as cells begins to change shape and accumulate extracellular products in the media, influencing the optical density reading as it relates to CFU (7). This error becomes more pronounced during stationary and death phases.
Here, Escherichia coli is grown in Luria-Bertani (LB) broth at 37&#176;C over the course of 30 hours (7). Both CFU/mL and optical density growth curves have been generated&#160;as well as the standard curve relating optical density to CFU.&#160;
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/10511/10511fig3.jpg" /> 
Figure 3. Escherichia coli optical density at 600 nm wavelength (OD600) growth curve. Optical density values were taken directly from the spectrophotometer after blanking with sterile LB media. OD600 values greater than 1.0 were diluted 1:10 by combining 100 &#181;l culture with 900 &#181;l fresh LB, again measured, and then multiplied by 10 to obtain the OD600 value. This step is taken as the accuracy in measurement of the spectrophotometer is reduced at high cell density. From the curve, lag phase extends to around 1h of growth, transitions to exponential phase from 2h to 7h, then begins to plateau, entering stationary phase. Death phase is not a stark transition, however, as optical density gradually begins to decline after 15h.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/10511/10511fig4.jpg" /> 
Figure 4. Escherichia coli colony forming unit per milliliter (CFU/mL) growth curve. CFU/mL values for each timepoint were calculated from the dilution plate that contained 30-300 colonies. From the curve, lag phase extends out to around 2h of growth, transitions to exponential phase from 2h to 7h, then begins to plateau, entering stationary phase. Death phase is not a stark transition, however, as CFU/mL gradually begins to decline after 15h from a peak of 2 x 109 to approximately 5 x 108 at 30 hours.
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/10511/10511fig5.jpg" /> 
Figure 5. Standardization curve for CFU/mL versus OD600. A linear regression can be used to relate these units so that optical density may be used to approximate bacterial cell density. Optical density can be used to provide and instant approximation of the CFU/mL of the batch culture. Here, only the first six timepoints are plotted as the relationship between OD600 and CFU/mL is less accurate beyond 1.0 OD600 as cell shape and extracellular products begin to accumulate as the bacteria enter stationary phase, which occurs shortly after reaching 1.0 OD600. Changes in cell shape and extracellular products in the media influence the optical density reading and therefore the relationship between optical density and the number of bacteria in the culture is also impacted.
The doubling time has also been determined to be 15 minutes and 19 seconds. From this data, the capacity for growth in LB for E. coli can be visualized and be used for comparison between different media or bacteria.

Growth Curves, CFU and Optical Density Measurements

עקומות צמיחה: יצירת עקומות צמיחה באמצעות יחידות יוצרות מושבה ומדידות צפיפות אופטית

Source: Andrew J. Van Alst1, Rhiannon M. LeVeque1, Natalia Martin1, and Victor J. DiRita1
1 Department of Microbiology and Molecular Genetics, Michigan ...

Antibiotic Susceptibility Testing: Epsilometer Tests to Determine MIC Values of Two Antibiotics and Evaluate Antibiotic Synergy

Source: Anna Bl&#228;ckberg1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund Sweden
Knowledge of the interactions between antibiotics and bacteria is important in understanding how microbes evolve antibiotic resistance. In 1928, Alexander Fleming discovered penicillin, an antibiotic that exerts its antibacterial function by interfering with cell wall regeneration (1). Other antibiotics with diverse mechanisms of action have subsequently been discovered, including drugs that inhibit DNA replication and protein translation in bacteria; however, no new antibiotics have been developed in recent years. Resistance to current antibiotics has been increasing, resulting in severe infectious diseases that cannot be effectively treated (2). Here, we describe several methods to assess antibiotic resistance in bacterial populations. Each of these methods works, regardless of the mechanism of action of the antibiotics used, because bacterial death is the measured outcome. Antibiotic resistance is not only rapidly disseminated specifically through hospital settings, but also throughout society. In order to investigate such means of resistance, different methods have been developed including the Epsilometer test (E-test) and the broth dilution test (3).
The E-test is a well-established method and is a cost-effective tool that quantifies Minimal Inhibitory Concentration (MIC) data, the lowest concentration of an antimicrobial that inhibits visible growth of a microorganism. Depending on the bacterial strain and antibiotics used, the MIC value can vary between sub &#956;g/mL to &#62;1000 &#956;g/mL (4). The E-test is performed using a plastic strip containing a predefined antibiotic gradient, which is imprinted with the MIC reading scale in &#956;g/mL. This strip is directly transferred on the agar matrix when applied to the inoculated agar plate. After incubation, a symmetrical elliptic inhibition zone is visible along the strip as bacterial growth is prevented. MIC is defined by the area of inhibition, which is the endpoint where the ellipse intersects the strip. Another common method to determine MIC is the microbroth dilution method. Microbroth dilution incorporates different concentrations of the antimicrobial agent added to a broth medium containing inoculated bacteria. After incubation, MIC is defined as the lowest concentration of antibiotic that prevents visible growth (5). It is also a quantitative method and can be applied to several bacteria. Disadvantages of this method include the possibility of errors when preparing the concentrations of the reagents and the large number of reagents required for the experiment. Measuring antibiotic resistance is imperative from both a clinical and research perspective, and these in vitro methods of investigating resistance are discussed and showcased below.
The profile of resistance for a specific bacterium can be applied in order to optimize antibiotic treatment to determine whether a patient would benefit from combination treatment versus single therapy. For the usage of more than one antibiotic at a single time, it is imperative to know their interactions with each other and if they have an additive, synergistic, or antagonistic effect. An additive effect can be seen when the joint effect of the antibiotics equals the potency of the individual antibiotics given at an equal dose. Synergy between antibiotics, on the other hand, is present when the joint effect of the antibiotics is more potent than if the drug would be given alone (6). Applying combinations of antimicrobial treatment is used to avoid the occurrence of antimicrobial resistance thus to enhance the effect of the individual antibiotic treatment (7). Knowledge of antagonism is also as important to prevent unnecessary use of antimicrobial combinations. E-test methodology offers simple and several ways to determine possible synergy and antagonism between different antimicrobial agents. In order to face the proliferation of antibiotic resistant pathogens, knowledge of possible synergistic and antagonistic mechanisms of certain antibiotics is important resulting in clinical efficacy and battling multidrug-resistance.
Determination of synergy using E-tests can be divided into two broad approaches: cross and non-cross testing. While both synergy tests rely on the previous knowledge of individual MIC values, the two approaches are slightly different in methodology and conceptual approach. In a non-cross synergy test, the first antibiotic in the pair to be tested is placed on an agar plate inoculated with bacteria. After allowing the antibiotics from the first strip infuse the plate (e.g. after 1 hour), the strip is removed and a new strip containing the second antibiotic is placed on the exact same spot as the first, making sure to place the two individual MIC values on top of each other. The resulting inhibition zone can then be analyzed as described above, and synergy calculated based on the Equation 1.
Equation 1 - Fractional Inhibitory Concentrations (FIC)
<img src="/files/ftp_upload/10512/10512eq1.jpg" />
Values &#62;0.5 demonstrates synergy.
While rewarding the examiner with easy-to-analyze plates, the method is somewhat laborious and time-consuming due to the change of strips, as well as the need of using two plates per experiment. Instead, a cross test is often employed. Instead of adding the two different E-test strips subsequently on top of each other (after removal of the first), both are placed simultaneously but in the form of a cross (<img align="center" src="/files/ftp_upload/10512/10512eq3.jpg" /> 90&#176; angle), with the two previously determined MIC values forming the 90&#176; angle. By this approach only one plate is needed per synergy test, as well as less work, making it a preferred choice despite being slightly more difficult to analyze. The new MIC values in the combined antibiotics approach can be visualized as the modified inhibition zones, after which synergy can be determined by Equation 1.
Instead of using an agar plate approach, a microbroth approach can often be preferential due to its higher flexibility (e.g. ability to choose specific concentrations of antibiotics outside the limits of an E-test strip). Further, microbroth tests are suggested to be more sensitive due to their even distribution of antibiotics in a liquid solution, not depending on the dissociation within a solid phase (agar plate). Wells in a 96-well microplate will be inoculated with a set number of bacteria (106 cfu/mL: bacterial concentration can be estimated by OD600 nm measurements, turbidity standards, or by spread plating samples from 10x bacterial serial dilutions), and antibiotics in different dilutions will be added to the wells. Similarly, to the E-test strips MIC is determined as the intersection (well/spot) with the lowest concentration of antibiotics inhibiting visible growth of bacteria.
Experimental Aim
<ul>
	<li>The project below describes strategies to determine MIC-values of penicillin G and gentamicin of Streptococcus group G by two different methods, E-test and microbroth dilution. For E-test, Mueller-Hinton agar plates inoculated with Streptococcus group G were used in combination with gradient strips of penicillin G and/or gentamicin; while MH-broth with 50% lysed horse blood and 20 mg/mL &#946;-NAD were used with soluble antibiotics together with Streptococcus group G in a microbroth approach.</li>
</ul>
Materials
<ul>
	<li>Bacterial colonies on a blood agar plate, stored &#60;7 days in 4&#176;C</li>
	<li>Blood agar plates</li>
	<li>0.5 McFarland standard
	<ul>
		<li>1% BaCl2</li>
		<li>1% H2SO4</li>
	</ul>
	</li>
	<li>Saline tube (2 mL)</li>
	<li>Cotton tipped applicator</li>
	<li>Mueller-Hinton agar plates (MHA plates)</li>
	<li>MH broth with 50% lysed horse blood and 20 mg/mL &#946;-NAD (MH-F)</li>
	<li>E-test penicillin/gentamicin (or antibiotics of interest) (BioMerieux, Marcy l&#39;Etoile, France, Sweden)</li>
	<li>Antibiotics penicillin/gentamicin (or antibiotics of interest (powder/solution))</li>
</ul>
Note: The specific media used for bacterial growth may vary for different species.

Antibiotic Susceptibility Testing, MIC and Antibiotic Synergy

בדיקת רגישות אנטיביוטית: בדיקות אפסילומטר לקביעת ערכי המיקרופון של שתי אנטיביוטיקות והערכה של סינרגיה אנטיביוטית

Source: Anna Bl&#228;ckberg1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 ...

Microscopy and Staining: Gram, Capsule, and Endospore Staining

Source: Rhiannon M. LeVeque1, Natalia Martin1, Andrew J. Van Alst1, and Victor J. DiRita1 
1 Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, Michigan, United States of America
Bacteria are diverse microorganisms found nearly everywhere on Earth. Many properties help distinguish them from each other, including but not limited to Gram-staining type, shape and arrangement, production of capsule, and formation of spores. To observe these properties, one can use light microscopy; however, some bacterial characteristics (for example size, lack of coloration, and refractive properties) make it hard to distinguish bacteria solely with a light microscope (1, 2). Staining bacteria is necessary when distinguishing bacterial types with light microscopy. The two main types of light microscopes are simple and compound. The main difference between them is the number of lenses used to magnify the object. Simple microscopes (for example a magnifying glass) have only one lens to magnify an object, while compound microscopes have several lenses to enhance magnification (Figure 1). Compound microscopes have an objective lens close to the object which collects light to create an image of the object. This is then magnified by the eyepiece (ocular lens) which enlarges the image. Combining the objective lens and eyepiece allows for higher magnification than using a single lens alone. Typically, compound microscopes have multiple objective lenses of varying powers to allow for different magnification (1, 2). Here, we will discuss visualizing bacteria with Gram stains, Capsule stains, and Endospore stains.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10513/10513fig1.jpg" /> 
Figure 1: A typical compound microscope. The most important parts of the microscope are labeled.
The Gram stain, developed in 1884 by the Danish bacteriologist Hans Christian Gram (1), differentiates bacteria based on the composition of the cell wall (1, 2, 3, 4). Briefly, a bacterial smear is placed on a microscope slide and then heat-fixed to adhere the cells to the slide and make them more readily accepting of stains (1). The heat-fixed sample is stained with Crystal Violet, turning the cells purple. The slide is flushed with an Iodine solution, which fixes the Crystal Violet to the cell wall, followed by a decolorizer (an alcohol) to wash away any non-fixed Crystal Violet. In the final step, a counterstain, Safranin, is added to color cells red (Figure 2). Gram-positive bacteria stain purple due to the thick peptidoglycan layer which is not easily penetrated by the decolorizer; Gram-negative bacteria, with their thinner peptidoglycan layer and higher lipid content, destain with the decolorizer and are counterstained red when Safranin is added (Figure 3). Gram staining is used to differentiate cells into two types (Gram-positive and Gram-negative) and is also useful to distinguish cell shape (spheres or cocci, rods, curved rods, and spirals) and arrangement (single cells, pairs, chains, groups, and clusters) (1, 3).

<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10513/10513fig2.jpg" /> 
Figure 2: Schematic of the Gram Staining Protocol. The left column shows how Gram-negative bacteria react at each step of the protocol. The right column shows how Gram-positive bacteria react. Also, shown are two typical bacterial cell shapes: the bacilli (or rods) and the cocci (or spheres).

<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/10513/10513fig3.jpg" /> 
Figure 3: Gram Staining Results. A Gram stain of a mixture of Staphylococcus aureus (Gram-positive purple cocci) and Escherichia coli (Gram-negative red rods).
Some bacteria produce an extracellular viscous outer layer called a capsule (3, 5). Capsules are protective structures with various functions, including but not limited to adherence to surfaces and other bacteria, protection from desiccation, and protection from phagocytosis. Capsules are typically composed of polysaccharides containing more than 95% water, but some may contain polyalcohols and polyamines (5). Due to their mostly non-ionic composition and tendency to repel stains, simple staining methods do not work with capsule; instead, capsule staining uses a negative staining technique which stains the cells and the background, leaving the capsule as a clear halo around the cells (1, 3) (Figure 4). Capsule staining involves smearing a bacterial sample into an acidic stain on a microscope slide. Unlike Gram staining, the bacterial smear is not heat-fixed during a Capsule Stain. Heat-fixing can disrupt or dehydrate the capsule, leading to false negatives (5). Furthermore, heat-fixing can shrink cells resulting in a clearing around the cell which can be mistaken as a capsule, leading to false positives (3). The acidic stain colors the slide background; while follow up with a basic stain, Crystal Violet, colors the bacterial cells themselves, leaving the capsule unstained and appearing as a clear halo between the cells and the slide background (Figure 5). Traditionally, India ink has been used as the acidic stain because these particles cannot penetrate the capsule. Therefore, neither the capsule nor the cell is stained by India ink; instead, the background is stained. Congo Red, Nigrosin, or Eosin can be used in place of India ink. Capsule staining can help doctors diagnose bacterial infections when looking at cultures from patient samples and guide appropriate patient treatment. Common diseases caused by encapsulated bacteria include pneumonia, meningitis, and salmonellosis.

<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/10513/10513fig4.jpg" /> 
Figure 4: Schematic of the Capsule Staining Protocol. The top panel shows the slide smear prior to any stain application. The middle panel shows how the slide and bacteria look after the primary stain, Congo Red. The final panel shows how the slide and bacteria look after the counterstain, Crystal Violet.

<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/10513/10513fig5.jpg" /> 
Figure 5: Capsule Staining Results. Capsule staining of encapsulated Acinetobacter baumannii (denoted with black arrows) and non-encapsulated Escherichia coli (denoted with white arrows). Notice the background is dark and A. baumannii cells are stained purple. The capsule around A. baumannii cells is evident as a halo, while E. coli has no halo.
In adverse conditions (for example nutrient limitation, extreme temperatures, or dehydration), some bacteria produce endospores, metabolically inactive structures that are resistant to physical and chemical damage (1, 2, 8, 9). Endospores allow the bacterium to survive harsh conditions by protecting the genetic material of the cells; once conditions are favorable for growth, spores germinate, and bacterial growth continues. Endospores are difficult to stain with standard staining techniques because they are impermeable to dyes typically used for staining (1, 9). The technique routinely used to stain endospores is the Schaeffer-Fulton Method (Figure 6), which uses the primary stain Malachite Green, a water soluble stain that binds relatively weakly to cellular material, and heat, to allow the stain to break through the cortex of the spore (Figure 7). These steps color the growing cells (termed vegetative cells in the context of endospore biology), as well as endospores and any free spores (those no longer within the former cell envelope). Vegetative cells are washed with water to remove Malachite Green; endospores retain the stain due to heating the Malachite Green within the spore. Finally, the vegetative cells are counterstained with Safranin to visualize (Figure 8). Staining for endospores helps differentiate bacteria into spore formers and non-spore formers, as well as determines whether spores are present in a sample which, if present, could lead to bacterial contamination upon germination.

<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/10513/10513fig6.jpg" /> 
Figure 6: Schematic of the Endospore Staining Protocol. The left column shows how spore forming bacteria react at each step of the protocol. The right column shows how non-spore forming bacteria react.

<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/10513/10513fig7.jpg" /> 
Figure 7: Diagram of Endospore Structure. Bacterial cell containing an endospore with the various spore structures labeled.

<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/10513/10513fig8.jpg" /> 
Figure 8: Endospore Staining Results. A typical staining of endospores of Bacillus subtilis. The vegetative cells (denoted with the white arrows) are stained red, while the endospores (denoted with the black arrows) are stained green.

Microscopy and Staining Techniques in Bacteria

מיקרוסקופיה וכתמים: גרם, כמוסה וכתמים אנדוספור

Source: Rhiannon M. LeVeque1, Natalia Martin1, Andrew J. Van Alst1, and Victor J. DiRita1
1 Department of Microbiology and Molecular Genetics, Michigan ...

Plaque Assay: A Method to Determine Viral Titer as Plaque Forming Units (PFU)

Source: Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Viruses that infect prokaryotic organisms, called bacteriophages or simply phages, were identified in the early 20th century by Twort (1) and d&#39;H&#233;relle (2) independently. Phages have since been widely recognized for their therapeutic value (3) and their influence on human (4), as well as global, ecosystems (5). Current concerns have fueled a renewed interest in the use of phages as an alternative to modern antibiotics in treatment of infectious disease (6). Essentially all phage research relies on the ability to purify and quantify viruses, also known as a viral titer. Initially described in 1952, this was the purpose of the plaque assay (7). Decades and multiple technological advancements later, the plaque assay remains one of the most reliable methods for determination of viral titer (8).
Bacteriophages subsist by injecting their genetic material into host cells, hijacking the machineries for production of new phage particles, and eventually causing the host to release numerous progeny virions through cell lysis. Because of their minute size, bacteriophages cannot be observed using solely light microscopy; therefore, scanning electron microscopy is required (Figure 1). Additionally, phages cannot be cultivated on nutritional agar plates like bacteria, as they need host cells to prey on.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10514/10514fig1.jpg" /> 
Figure 1: The morphology of a bacteriophage, here exemplified by an E. coli phage, can be studied using scanning electron microscopy. Most bacteriophages belong to Caudovirales (tailed bacteriophages). This particular phage has a very short tail structure and an icosahedral head, placing it in the family of Podoviruses.
The plaque assay (Figure 2) is based on incorporation of host cells, preferentially in log-phase growth, into the medium. This creates a dense, turbid layer of bacteria able to sustain viral growth. An isolated phage can subsequently infect, replicate within, and lyse one cell. With each lysed cell, multiple adjacent ones become immediately infected. Several cycles in, a clear zone (a plaque) can be observed in the otherwise turbid plate (Figure 2B/Figure 3A), indicating the presence of what was initially a single bacteriophage particle. The number of plaque forming units per volume (i.e. PFU/mL) of a sample, can thus be determined from the number of plaques generated.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10514/10514fig2.jpg" /> 
Figure 2: Testing for plaque forming units (PFU) is a common method for determining the number of bacteriophages in a sample. (A) The base of a sterile Petri dish is covered with an appropriate solid nutrient medium, followed by a mixture of soft media, susceptible host cells and a dilution of the original bacteriophage sample. Note that the phage-suspension could, in some cases, also be evenly spread-out across the surface of already solidified soft agar. (B) Growth of the host bacteria forms a lawn of cells in the top agar layer. Bacteriophage replication generates clear zones, or plaques, caused by host cell lysis.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/10514/10514fig3.jpg" /> 
Figure 3: Results from PFU-testing show multiple plaques generated by bacteriophages. Due to lysis of susceptible host cells, plaques can be seen as clearing zones in the bacterial lawn, either with (A) full clearance, or (B) partial re-growth caused by generation of resistant bacteria (or possibly by temperate phages in the lysogenic cycle).
Certain temperate phages can adopt what is referred to as a lysogenic lifecycle, in addition to the formerly described lytic growth. In lysogeny, the virus assumes a latent state through incorporation of its genetic material into the genome of the host cell (9), often conferring resistance to further phage infections. This is sometimes revealed through a slight clouding of the plaque (Figure 3B). It is worth noting however, that plaques can also appear blurred due to re-growth of bacteria that have evolved resistance to the phage independent of previous phage infections.
Viruses can attach, or adsorb, to only a limited range of host bacteria (10). Host ranges are further limited by intracellular anti-viral strategies such as the CRISPR-Cas system (11). The resistance/sensitivity towards specific phages displayed by bacterial subgroups has historically been used to categorize bacterial strains into different phage types (Figure 4). Although the effectiveness of this method has now been surpassed by novel sequencing techniques, phage typing can still provide valuable information about bacteria-phage interactions, for instance, facilitating the design of a phage cocktail for clinical usage.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/10514/10514fig4.jpg" /> 
Figure 4: Phage sensitivity of different bacterial strains. Soft agar plates with Cutibacterium acnes strain (A) AD27 and (B) AD35, were spotted with 21 different C. acnes bacteriophages. Only phage 11 were able to infect and kill AD27 while strain AD35 showed sensitivity towards all phages. This technique, termed phage typing, can be used to divide bacterial species and strains into different subgroups based on phage susceptibility.

Determining Viral Titer as Plaque Forming Units PFU

פלאק אסאי: שיטה לקביעת טיטר ויראלי כיחידות יוצרות פלאק (PFU)

Transformation of E. coli Cells Using an Adapted Calcium Chloride Procedure

Source: Natalia Martin1, Andrew J. Van Alst1, Rhiannon M. LeVeque1, and Victor J. DiRita1 
1 Department of Microbiology and Molecular Genetics, Michigan State University
Bacteria have the ability to exchange genetic material (DeoxyriboNucleic Acid, DNA) in a process known as horizontal gene transfer. Incorporating exogenous DNA provides a mechanism by which bacteria can acquire new genetic traits that allow them to adapt to changing environmental conditions, such as the presence of antibiotics or antibodies (1) or molecules found in natural habitats (2). There are three mechanisms of horizontal gene transfer: transformation, transduction, and conjugation (3). Here we will focus on transformation, the ability of bacteria to take up free DNA from the environment. In the laboratory, the transformation process has four general steps: 1) Preparation of competent cells, 2) Incubation of competent cells with DNA, 3) Recovery of cells, and 4) Plating of the cells for growth of the transformants (Figure 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10515/10515fig1.jpg" /> 
Figure 1: General steps of the transformation process. The transformation process has four general steps: 1) Preparation of competent cells, 2) Incubation with DNA, 3) Recovery of the cells and 4) Plating cells for growth of the transformants.
For transformation to occur, the recipient bacteria must be in a state known as competence. Some bacteria have the ability to become naturally competent in response to certain environmental conditions. However, many other bacteria do not become competent naturally, or the conditions for this process are yet unknown. The ability to introduce DNA into bacteria has a range of research applications: to generate multiple copies of a DNA molecule of interest, to express large amount of proteins, as a component in cloning procedures, and others. Because of the value of transformation to molecular biology, there are several protocols aimed to make cells artificially competent when conditions for natural competence are unknown. Two main methods are used to prepare artificially competent cells: 1) through chemical treatment of cells and 2) exposing the cells to electric pulses (electroporation). The former uses different chemicals depending on the procedure to create attraction between the DNA and the cell surface, while the latter uses electric fields to generate pores in the bacterial cell membrane through which DNA molecules can enter. The most efficient approach for chemical competence is incubation with divalent cations, most notably calcium (Ca2+) (4,5) Calcium-induced competence is the procedure that will be described here (6). This method is mainly used for transformation of Gram-negative bacteria, and that will be the focus of this protocol.
The procedure of chemical transformation involves a series of steps in which cells are exposed to cations to induce chemical competence. These steps are subsequently followed by a temperature change - heat shock - that favors the uptake of foreign DNA by the competent cell (7). The bacterial cell envelopes are negatively charged. In Gram-negative bacteria like Escherichia coli, the outer membrane is negatively-charged due to the presence of lipopolysaccharide (LPS) (8). This results in repulsion of the similarly negatively-charged DNA molecules. In chemical competence induction, positively-charged calcium ions neutralize this charge repulsion enabling DNA absorbance onto the cell surface (9). Calcium treatment and incubation with DNA are done on ice. Subsequently, an incubation at higher temperatures (42&#176;C), the heat shock, is performed. This temperature imbalance further favors the DNA uptake. Bacterial cells need to be at the mid-exponential growth phase to withstand the heat shock treatment; in other growth stages the bacterial cells are too sensitive to the heat resulting in loss of viability which significantly decreases transformation efficiency.
Different DNA sources can be used for transformation. Typically, plasmids, small circular, double-stranded DNA molecules, are used for transformation in most laboratory procedures in E. coli. For plasmids to be maintained in the bacterial cell after transformation, they need to contain an origin of replication. This allows them to be replicated in the bacterial cell independently from the bacterial chromosome. Not all the bacterial cells get transformed during the transformation procedure. Thus, transformation yields a mixture of transformed cells and non-transformed cells. To distinguish between these two populations, a selection method to identify the cells that have acquired the plasmid is used. Plasmids usually contain selectable markers, which are genes encoding a trait that confers an advantage for growth (i.e. resistance to an antibiotic or chemical or rescue from a growth auxotrophy). After transformation, bacterial cells are plated on selective media, which only allows for growth of the transformed cells. In the case of cells transformed with a plasmid conferring resistance to a given antibiotic, the selective media will be growth media containing that antibiotic. Several different methods can be used to confirm that the colonies grown in the selective media are transformants (i.e. have incorporated the plasmid). For example, plasmids can be recovered from these cells using plasmid preparation methods (10) and digested to confirm plasmid size. Alternatively, colony PCR can be used to confirm the presence of the plasmid of interest (11).
The aim of this experiment is to prepare E. coli DH5&#945; chemically competent cells, using an adaptation of the calcium chloride procedure (12), and to transform them with the plasmid pUC19 to determine transformation efficiency. The E. coli strain DH5&#945; is a commonly used strain in molecular biology applications. Because of its genotype, specifically the recA1 and endA1, this strain allows for increased insert stability and improve the quality of plasmid DNA in subsequent preparations. Since the transformation efficiency decreases with increasing size of the DNA, the plasmid pUC19 was used in this protocol because of its small size (2686 bp) (see https://www.mobitec.com/cms/products/bio/04_vector_sys/standard_cloning_vectors.html for a vector map). pUC19 confers resistance to ampicillin and thus, this was the antibiotic used for selection.

Transformation of E. coli: Adapted Calcium Chloride Procedure

טרנספורמציה של תאי E. coli באמצעות הליך סידן כלוריד מותאם

Source: Natalia Martin1, Andrew J. Van Alst1, Rhiannon M. LeVeque1, and Victor J. DiRita1
1 Department of Microbiology and Molecular Genetics, Michigan ...

Conjugation: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1 
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases Laboratories, Boston, MA
First discovered by Lederberg and Tatum in 1946, conjugation is a form of horizontal gene transfer between bacteria that relies on direct physical contact between two bacterial cells (1). Unlike other forms of gene transfer, such as transformation or transduction, conjugation is a naturally occurring process in which DNA is secreted from a donor cell to a recipient cell in a unidirectional manner. This directionality and the ability for this process to increase the genetic diversity of bacteria has given conjugation the reputation as a form of bacterial &#34;mating,&#34; which is believed to have contributed greatly to the recent rise in antibiotic resistant bacteria (2, 3). By using selective pressures, for example the use of antibiotics, conjugation has been manipulated for use in the laboratory setting, making it a powerful tool for horizontal gene transfer between bacteria, and in some cases from bacteria to yeast, plant, and animal cells (4). Apart from applications in the laboratory, bacterium-eukaryote gene transfer by conjugation is an exciting avenue of DNA transfer with a multitude of possible biotechnical applications and naturally occurring implications (5).
Conjugation is thought to work by a &#34;two-step mechanism&#34; (6). First, before any DNA can be transferred, the donor cell must make direct cell-to-cell contact with the recipient. This process has been characterized best in gram-negative bacteria, the most studied of which is Escherichia coli. Cell-to-cell contact is established by the presence of a complex network of extracellular filaments on the donor known as the sex pilus, a conjugative element encoded for by the transferable gene known as the F (fertility) factor (7, 8). In addition to establishing contact between donor and recipient, several proteins are transported via the sex pilus to the recipient cytoplasm, forming a type IV secretion system (T4SS) conduit between the two cells, a necessary structure for the second step of conjugation, DNA transfer (6). By combining this function of the sex pilus with rolling circle replication of DNA, the donor cell is able to transfer DNA in the form of a transposable element, such as a plasmid or transposon, to the recipient by a &#34;shoot and pump&#34; model (6). In this case, the &#34;shooting&#34; is the transport of the pilot protein, with linked DNA, by the T4SS into the recipient cell, and the &#34;pumping&#34; is the active transport of DNA to the recipient, a process reliant on the T4SS and catalyzed by coupling proteins (6). The machinery used in this this process is composed of an origin of transfer sequence (oriT), which must be provided by the DNA in cis and trans genes, which encode a relaxase, mate pair formation complex, and type IV coupling protein, and can be present in cis or trans (9). This relaxase cleaves the nic site within the oriT sequence and covalently attaches to the 5&#39; end of the transferred strand to produce the relaxosome, a single-stranded DNA-relaxase complex with other auxiliary proteins (9). Once formed, the relaxosome connects to the mating pair formation complex, via the type IV coupling protein, which allows for the transfer of the ssDNA-relaxase complex into recipient cells by the T4SS (10). Once in the cytoplasm of the recipient, the DNA can integrate into the recipient genome or exist separately in the form of a plasmid, either of which allow for the expression of its genes.
In this experiment, the widely used conjugation donor strain E. coli WM3064 was used to transfer the gene encoding for ampicillin resistance to the recipient strain E. coli J53. While both strains of the gram-negative bacteria were resistant to tetracycline, only the donor strain WM3064 had the gene for ampicillin resistance, encoded for in the pWD2-oriT shuttle vector, and was auxotrophic to diaminopimelic acid (DAP) (11-13). This experiment consisted of two main steps, the preparation of donor and recipient strains, followed by the transfer of the ampicillin resistance gene from donor to recipient by conjugation (Figure 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10516/10516fig1.jpg" /> 
Figure 1: Conjugation schematic. This schematic shows the successful transfer of a plasmid, only one example of a transposable DNA element, from a donor cell to a recipient cell using conjugation. Upon contact with the recipient cell by the donor cell via the sex pilus, the plasmid replicates by rolling circle replication, moves through the multiprotein complex joining the two cells, and forms a new full-length plasmid in the recipient cell.
By incubating a mixture of donor and recipient cells, then successively plating these cells in the presence of tetracycline and DAP, this allowed for the successful transfer of the ampicillin resistance gene. Successively plating cells grown from this mixture in the presence of tetracycline and ampicillin, removed all donor cells due to the lack of DAP and any recipient cells that may not have gained the ampicillin resistance gene, yielding strictly recipient J53 strain bacteria that acquired ampicillin resistance (Figure 2). Once carried out, the successful transfer of the ampicillin resistance gene was confirmed by PCR. Since conjugation was successful, the J53 strain of E. coli contained pWD2-oriT and was resistant to ampicillin, and the gene encoding for this resistance is detectable by PCR. However, if unsuccessful there would have been no detection of the ampicillin resistance gene and ampicillin would still function as an effective antibiotic against the J53 strain.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10516/10516fig2.jpg" /> 
Figure 2: Protocol schematic. This schematic shows an overview of the presented protocol.
<img alt="Figure 3A" class="xfigimg" src="/files/ftp_upload/10516/10516fig3a.jpg" /> 
Figure 3A: The confirmation of successful conjugation by PCR. A) Freezer stocks of the conjugated and negative control samples were streaked out on agar plates and a colony was selected (red) for DNA isolation.

Conjugation: Transferring Ampicillin Resistance in E. coli

הטיות: שיטה להעברת עמידות אמפיצ'ין מתורם לנמען E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases ...

Phage Transduction: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1 
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases Laboratories, Boston, MA
Transduction is a form of genetic exchange between bacteria that utilizes bacteriophages, or phages, a class of virus that infects exclusively prokaryotic organisms. This form of DNA transfer, from one bacterium to another by way of a phage, was discovered in 1951 by Norton Zinder and Joshua Ledererg, who termed the process &#34;transduction&#34; (1). Bacteriophages were first discovered in 1915 by British bacteriologist Frederick Twort, then independently discovered again in 1917 by French-Canadian microbiologist Felix d&#39;Herelle (2). Since then, the structure and function of these phages have been widely characterized (3), dividing these phages into two classes. The first of these classes are the lytic phages which upon infection multiply within the host bacterium, disrupting the bacterial metabolism, lysing the cell, and releasing progeny phage (4). As a result of this anti-bacterial activity and the increasing prevalence of antibiotic-resistant bacteria, these lytic phages have recently proved useful as a substitute treatment for antibiotics. The second of these classes are the lysogenic phages which can either multiply within the host via the lytic cycle or enter a quiescent state in which their genome is integrated into that of the host (Figure 1), a process known as lysogeny, with the ability for phage production to be induced in multiple later generations (4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10517/10517fig1.jpg" /> 
Figure 1: Infection of host cell by bacteriophage. Adsorption by the phage to the bacterial cell wall via interactions between the tail fibers and receptor (purple). Once on the cell surface, the phage is irreversibly attached to the bacterial cell using the base plate (black) which is moved to the cell wall by the contractile sheath (yellow). Phage genome (red) then enters the cell and integrates into the host cell genome.
While bacterial transduction is a naturally occurring process, using modern technology it has been manipulated for the transfer of genes into bacteria in the laboratory setting. By inserting genes of interest into the genome of a lysogenic phage, such as phage, one is able to transfer these genes into the genomes of bacteria and consequently express them within these cells. While other methods of gene transfer, such as transformation, use a plasmid for gene transfer and expression, the insertion of the phage genome into that of the recipient bacterium not only has the potential to confer new traits to this bacterium, but also allows for naturally occurring mutations and other factors of the cellular environment to alter the function of the transferred gene.
Compared to other methods of horizontal gene transfer, such as conjugation, transduction is fairly flexible in the criteria required for donor and recipient cells. Any genetic element that can fit inside the genome of the phage being used can be transferred from any strain of donor bacteria to any strain of recipient bacteria as long as both are permissive to the phage, requiring the expression of necessary phage receptors on the cell surfaces. Once this gene is moved out of the donor genome and packaged into the phage, it can be transferred to the recipient. Following transduction, it is necessary to select for recipient bacteria that contain the gene of interest have to be selected for. This could be done by use of a genetic marker, such as a FLAG-tag or polyhistidine-tag, to mark the gene of interest, or the intrinsic function of the gene, in the case of genes that encode for antibiotic resistance. Additionally, PCR could be used to further confirm successful transduction. By using primers for a region within the gene of interest and comparing signal to a positive control, bacteria that has the gene of interest, and a negative control, bacteria that underwent the same steps as the transduction reaction with no phage. While bacterial transduction is a useful tool in molecular biology, it has and continues to play an important role in the evolution of bacteria, particularly with regard to the recent rise of antibiotic resistance.
In this experiment, bacterial transduction was used to transfer the gene encoding for resistance to the antibiotic ampicillin from the W3110 strain of E.coli to the J53 strain via the P1 bacteriophage (5). This experiment consisted of two main steps. First, the preparation of P1 phage containing the ampicillin resistance gene from the donor strain. Second, the transfer of this gene to the recipient strain by transduction with the P1 phage (Figure 1). Once carried out, the successful transfer of the ampicillin resistance gene could be determined by qPCR (Figure 2). If transduction was successful, the J53 strain of E. coli would be resistant to ampicillin, and the gene conferring this resistance detectable by qPCR. If unsuccessful, there would be no detection of the ampicillin resistance gene and ampicillin would still function as an effective antibiotic against the J53 strain.

<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10517/10517fig2.jpg" /> 
Figure 2: The confirmation of successful transduction by qPCR. By comparing the Cq values detected for the gene of interest from the transduction reaction and the negative control reaction, and normalizing these values against a housekeeping gene, one was able to confirm that bacterial transduction was successful.

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

@media screen and (min-width: 320px){.css-u03n47{font-size:var(--chakra-fontSizes-xs);}}Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)

Science Education (Advanced Biology)