Method Article
The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.
The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.
מבחני כתב מקבילים מסיבי (MPRA) מאפשרים מדידה מרובבת של פעילות הרגולטורית תעתיק של אלפים למאה אלפי רצפי DNA 1 7. ביישום הנפוץ ביותר שלהם, ריבוב מושגת על ידי צימוד כל רצף של עניין לגן כתב סינטטי המכיל תג זיהוי רצף במורד הזרם של מסגרת קריאה פתוחה (ORF; איור 1). בעקבות transfection, בידוד RNA ורצף עמוק של קצוות "3 של תעתיקי גן הכתב, הפעילויות היחסית של הרצפים בשילוב ניתן להסיק מהשפע היחסי של תגי זיהוי שלהם.
איור 1 סקירה כללית של MPRA. ספרייה של כתב MPRA בונה בנויה על ידי צימוד רצפים רגולטוריים המשוערת לסינטטיגני כתב שיכללו "אינרטי" ORF (כגון GFP או לוציפראז) ואחריו תג זיהוי רצף. הספרייה היא transfected בהמוניהם לאוכלוסייה של תאים בתרבית וmRNA הכתב עיבד הוא התאושש לאחר מכן. רצף עמוק משמש לספירת מספר המופעים של כל תג בקרב mRNAs הכתב ופלסמידים transfected. היחס של mRNA סופר על יכול לשמש ספירת פלסמיד להסיק הפעילות של רצף הרגולציה המתאים. מותאם באישור מלניקוב, et al 2.
ניתן להתאים MPRA למגוון רחב של עיצובים ניסיוניים, כולל 1 mutagenesis) המקיף של יסודות רגולציה גן בודד, 2 סריקה) לאלמנטים רגולטוריים רומן על פני מוקד של עניין, 3) בודק את ההשפעה של שונות גנטיות טבעיות בקבוצה של משוער יזמים, משפרי או משתיקי קול, ו4) הנדסה למחצה רציונאלית של אלמנטים רגולטוריים סינטטיים. ליbraries של גרסאות רצף יכול להיות שנוצר תוך שימוש במגוון של שיטות, כולל סינתזת ספריית oligonucleotide (OLS) על microarrays תכנות 2,3,6,7, הרכבה של oligonucleotides המנוון 1,4, קשירה קומבינטורית 8 ופיצול של הדנ"א הגנומי 5.
פרוטוקול זה מתאר בנייה של ספרייה של אמרגן גרסאות באמצעות OLS ווקטורי pMPRA1 וpMPRAdonor1 (Addgene מזהים 49,349 ו49,352, בהתאמה; http://www.addgene.org), transfection החולף של ספרייה זו לתאי יונקים בתרבית וquantitation הבא של פעילויות האמרגן ידי רצף עמוק של התגים הקשורים בם (Tag-Seq). גרסאות קודמות של פרוטוקול זה היו בשימוש במחקר דיווח מלניקוב et al. טבע 30 ביוטכנולוגיה, 271-277 (2012) ובKheradpour et al. הגנום 23 מחקר, 800-811 (2013).
.1 רצף עיצוב וסינתזה
MPRA_SfiI_F | GCTAAGGGCCTAACTGGCCGCTTCACTG |
MPRA_SfiI_R | GTTTAAGGCCTCCGTGGCCGACGCTCTTC |
TAGseq_P1 | AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT |
TAGseq_P2 | CAAGCAGAAGACGGCATACGAGAT [אינדקס] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG |
טבלת 1 רצפי פריימר. [אינדקס] מציינים רצף מדד 6 עד 8 NT המשמש לקביעת רצף מרובבת. להשיג לפחות 8 פריימרים TagSeq-P2 עם מדדים שונים. כלשל פריימרים צריכים להיות מטוהר על ידי HPLC או עמוד.
מגיב | נפח 1x (μl) |
Herculase השני Fusion DNA פולימראז | 0.5 |
מאגר תגובת 5x Herculase השני | 10 |
dNTP (10 מ"מ כל אחד) | 1.25 |
BSA (20 מ"ג / מ"ל) | 1.25 |
MPRA_SfiI_F פריימר (25 מיקרומטר) | 0.25 |
MPRA_SfiI_R פריימר (25 מיקרומטר) | 0.25 |
תבנית OLS (1-10 attomol) | משתנה |
nuclease ללא מים | ל50 |
הכנת איור 2 ספריות סינתזת oligonucleotide.) שלוש ספריות שונות גלם סינתזת oligonucleotide (OLS) לרוץ על denaturing ג'ל polyacrylamide TBE-אוריאה 10%. יכולות להיות דמיינו להקות המתאימות oligonucleotides באורך מלא (*) ונכרתו מן הספריות 1 ו -2 ספרייה 3 מכילה מזהמים שמפריעים לטיהור עמוד. אם זה המקרה, המשך למוצרי PCR הגברה. ב) להגברת PCR פתוחה ותחליב של אותו לרוץ ספריית oligonucleotide ישירות על ג'ל agarose. ההגברה PCR של ספריות oligonucleotide מורכבות לעתים קרובות יוצרת מוצרי chimeric וממצאים אחרים שעלולות להופיע כלהקות גבוהות יותר ונמוכות יותר. תחליב PCR יכול למזער החפצים האלה.
.2 בניית ספרייה
.3 Transfection, הפרעות, ובידוד RNA
.4 Tag-Seq
מגיב | נפח 1x (μl) |
מדגם mRNA (400-700 כולל ng) | 8 |
אוליגו 0dT (50 מיקרומטר) | 1 |
dNTP (10 מ"מ כל אחד) | 1 |
מגיב | נפח 1x (μl) |
10x עילי III RT חוצץ | 2 |
MgCl 2 (25 מ"מ) | 4 |
DTT (0.1 M) | 2 |
RNaseOut (40 U / μl) | 1 |
עילי III (200 U / μl) | 1 |
תערובת תגובת סינתזת לוח 4: cDNA.
מגיב | נפח 1x (μl) |
2x PfuUltra השני HotStart PCR מיקס מאסטר | 25 |
TagSeq_P1 פריימר (25 מיקרומטר) | 0.5 |
TagSeq_P2 פריימר (25 מיקרומטר) | 0.5 |
תבנית (mRNA, cDNA לערבב או פלסמיד דנ"א) | משתנה |
nuclease ללא מים | ל50 |
לוח 5: תערובת תגובת Tag-Seq PCR.
MPRA מאפשר רזולוציה גבוהה, לנתיחה כמותי של יחסי רצף פעילותם של גורמי רגולציה תעתיק. ניסוי MPRA מוצלח בדרך כלל יניב מדידות לשחזור מאוד עבור רוב הרצפים בספריית transfected (איור 3 א). אם שחזור עני הוא ציין (איור 3 ב), זה מעיד על ריכוז נמוך מדי של mRNAs כתב בדגימות RNA התאוששו, בשל או 1) פעילות נמוכה מוחלטת בין רצפי assayed, או 2) יעילות transfection נמוכה.
איור 4 מראה "טביעת רגל מידע" נציג 1,2 שנוצרה על ידי מנסה לאמוד ~ 37,000 וריאנטים של רצף 145 נ"ב במעלה הזרם של גן IFNB האנושי בתאי HEK293 עם או בלי חשיפה לוירוס סנדאי אקראיים. אמרגן TATA-box ומשפרים הפרוקסימלי ידוע 10 יכולים בבירור להיות מזוהה כregi מידע עשירתוספות באופן וירוס תלוי.
איור 3 Tag-Seq שחזור. מגרשי פיזור מראים דוגמאות של נתונים Tag-Seq משני transfections לשכפל עצמאי עם גבוה (A) ואת שחזור נמוך (B). העלילה האחרונה מראה תגי נתון חריגים רבים עם ספירה הגבוהה mRNA רק באחת משתי החזרות. חפצים כגון בדרך כלל מצביעים על כך שהריכוזים של mRNAs הכתב היו נמוכים מדי עבור ההגברה PCR כמותי, גם בשל פעילות נמוכה מוחלטת בין מבני הכתב, או את יעילות transfection נמוכה.
איור 4 footprinting מידע של האתר האנושי שעתוק IFNB התחלה ומשפרים הפרוקסימלי. כ 37,000 גרסאות אקראיות של 145 נוקלאוטיד אזור (NT) במעלה הזרם של גן IFNB האנושי היו assayed באמצעות MPRA בתאי HEK293 עם () וללא חשיפה (ב ') לוירוס סנדאי. הסורגים הכחולים להציג את המידע ההדדי בין פלט הכתב ונוקלאוטיד בכל עמדה. משפר הפרוקסימלית וTATA-box עומדים בתור אזורים של תוכן מידע גבוה על זיהום ויראלי.
MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency.
The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.
A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted CD). In practice, CD is limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than CD. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then CD should be no more than ~200,000. Note that CD is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple “promoter bashing” experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test.
If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements.
Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.
It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).
החוקרים מצהירים כי אין להם אינטרסים כלכליים מתחרים.
עבודה זו נתמכה על ידי הקרן הלאומי לחקר גנום אדם במכון המחקר של המכון הלאומי לבריאות בפרס מספר R01HG006785.
Name | Company | Catalog Number | Comments |
Oligonucleotide library synthesis | Agilent, CustomArray, or other OLS vendors | custom | If using OLS construction method |
pMPRA1 | Addgene | 49349 | MPRA plasmid backbone |
pMPRAdonor1 | Addgene | 49352 | luc2 ORF donor plasmid |
TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) | Generic | n/a | OLS buffer |
Novex TBE-Urea Gels, 10% | Life Technologies | EC6875BOX | PAGE purification of OLS products |
Novex TBA-Urea Sample Buffer | Life Technologies | LC6876 | PAGE purification of OLS products |
SYBR Gold Nucleic Acid Gel Stain | Life Technologies | S-11494 | PAGE purification of OLS products |
Micellula DNA Emulsion & Purification Kit | EURx/CHIMERx | 3600-01 | Library amplification by emulsion PCR |
Herculase II Fusion DNA Polymerase | Agilent | 600675 | Polymerase for emulsion PCR |
SfiI | New England Biolabs | R0123S | Library cloning with pMPRA vectors |
KpnI-HF | New England Biolabs | R3142S | Library cloning with pMPRA vectors |
XbaI | New England Biolabs | R0145S | Library cloning with pMPRA vectors |
T4 DNA Ligase (2,000,000 units/ml) | New England Biolabs | M0202T | Library cloning with pMPRA vectors |
One Shot TOP10 Electrocomp E. coli | Life Technologies | C4040-50 | Library cloning with pMPRA vectors |
LB agar and liquid media with carbenicllin | Generic | n/a | Growth media for cloning |
E-Gel EX Gels 1% | Life Technologies | G4010-01 | Library verification and purification |
E-Gel EX Gels, 2% | Life Technologies | G4010-02 | Library verification and purification |
MinElute Gel Extraction Kit | Qiagen | 28604 | Library and backbone purification |
EndoFree Plasmid Maxi Kit | Qiagen | 12362 | Library DNA isolation |
Cell culture media | n/a | n/a | Experiment-specific |
Transfection reagents | n/a | n/a | Experiment-specific |
MicroPoly(A)Purist Kit | Life Technologies | AM1919 | mRNA isolation |
TURBO DNA-free Kit | Life Technologies | AM1907 | Plasmid DNA removal |
SuperScript III First-Strand Synthesis System | Life Technologies | 18080-051 | cDNA synthesis |
PfuUltra II Hotstart PCR Master Mix | Agilent | 600850 | Polymerase for Tag-Seq PCR |
Primers (see text) | IDT | custom | PAGE purify Tag-Seq primers |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved