Name: bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses
Uploaded: 2015-12-29T13:00:00.000+00:00
Duration: 12 min 20 s
Description: Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

הפרוטוקול הנוכחי שמש בהצלחה לייצר שיבוטים cDNA זיהומיות באורך מלא לשני זנים שונים (CNU / 27 LP2 ו -14 SA -14-2 28) של JEV, flavivirus שפונקציונלי cDNA הוכיח להיות קשה מטבעו לבנות ו להפיץ בגלל רעילות תא מארח וחוסר היציבות הגנטית של cDNA המשובט 8,74-76 פרוטוקול זה כולל שלושה מרכיבים עיקריים:. ראשון, למקסם את הסינתזה / ההגברה של עותק cDNA נאמן של רנ&quot;א הנגיפי באמצעות טרנסקריפטאז באיכות גבוהה / DNA פולימראז; שני, שיבוט האזור הנגיפי PRM-E קידוד המכיל רצפים רעילים (נתונים שלא פורסמו) 74,77,78 בBAC וקטור מספר מאוד נמוך עותק מcDNA הראשוני subcloning לצעדי ההרכבה cDNA באורך מלא הסופיים; ושלישית, ניצול BAC וקטור שיבוט שיכול להכיל דנ&quot;א זר עם גודל של 120-350 kb, 19-21 ממוצע שככל הנראה סובל inse DNA הגדולRTS מאשר לעשות וקטורי שיבוט אחרים. גישת שיבוט זה תהיה בדרך כלל החלים רב וירוסים אחרים חיובי גדיל RNA, במיוחד אלו עם הגנום RNA גדול של ~ 10-32 קילו. דור של שיבוט cDNA זיהומיות הוא צעד מפתח בפיתוח מערכת גנטיקה הפוכה לאיתור וירוסי RNA, במיוחד לוירוסי RNA חיובי גדיל, כי הגנום שלו פועל mRNA ויראלי כמו שמתורגמת לחלבונים על ידי הריבוזומים תא מארח. לפיכך, שכפול נגיפי יכול להיות שיזם את ההקדמה של מולקולת רנ&quot;א הגנום באורך נגזר cDNA לתוך תא מארח רגיש. הזמינות של שיבוט JEV cDNA זיהומיות, בשילוב עם טכנולוגיית ה- DNA רקומביננטי, גדלה ההבנה של היבטים שונים של מחזור החיים של נגיפנו ברמה המולקולרית, כגון ביטוי גנים 73,79 ושכפול הגנום. 63,64 כמו כן, באורך מלא שיבוט JEV cDNA הוכיח להיות כלי רב ערך לפיתוח של חיסונים אנטי 28 ווקטורי מסירת הגן. &lt;sup&gt; 80,81 כמו בכל וירוסי RNA חיובי גדיל, ישנם צעדים קריטיים מרובים בבניית cDNA הפונקציונלי אמין לJEV שממנו יכול להיות מסונתז RNAs המידבק ביותר במבחנה. באופן אידיאלי, הרצף של RNAs הסינתטי עיבד משיבוט של cDNA באורך מלא צריך להיות זהה לזה של RNA הגנומי ויראלי, במיוחד 5&#39;- ו3&#39;-מסוף הרצפים הנדרשים לייזום של שכפול רנ&quot;א הנגיפי . 60-62 בפרוטוקול הנוכחי, האותנטי 5&#39;- ו3&#39;-קצוות היו מובטח על ידי הצבת רצף אמרגן SP6 במעלה הזרם של נוקלאוטיד אדנין הראשון של הגנום הנגיפי ומיצוב אתר הגבלה ייחודי מלאכותי Xba אני במורד זרם של האחרון נוקלאוטיד תימין של הגנום הנגיפי, בהתאמה. כתרים RNAs הסינתטי עם 5 האותנטיים &#39;ו 3&#39; קצוות הופקו על ידי שעתוק נגר של te cDNA Xba אני-לינארית וטופל MBNmplate באמצעות פולימראז SP6 RNA דרוך עם G מ &#39;7 (5&#39;) PPP (5 &#39;) אנלוגי כובע. פרוטוקול זה יכול להיות שונה בכמה דרכים. לשעתוק במבחנה, אחר RNA פולימראז bacteriophage (למשל, T3 או T7) יכול לשמש בשילוב עם רצף האמרגן המוגדר היטב שלה. 27 כאתר נגר, אתר הגבלה שונה יכול להיות מנוצל אם היא לא נמצאת ב הגנום הנגיפי ואם RNA הסינתטי מcDNA לינארית מסתיים בסופו של הדבר האותנטי 3 &#39;. החשיבות של רצף נוקליאוטידים 3&#39;-הסוף הודגמה על ידי ירידה ~ של פי 10 בinfectivity RNA כאשר RNA סינטטי מכיל שלושה או ארבעה נוקלאוטידים וירוס-שאינו קשור בסופה 3 &quot;. 27 בתגובת שעתוק במבחנה, שני מ &#39;7 G (5&#39;) PPP (5 &#39;) ומטר 7 G (5&#39;) PPP (5 &#39;) אנלוגי כובע יכול לשמש G באותה מידה, אם כי המקומות האחרונים נוקלאוטיד G נוסף שאינו קשור במעלה הזרם של נגיפי 5 &quot;-end, אבל שבנוסף אינו משנה את ההדבקה או שכפול של RNA הסינתטי. 27 יתר על כן, הסרת תבנית cDNA מתעתיקי הרנ&quot;א על ידי DNase אני עיכול אין צורך לבדיקות infectivity RNA, כי תבנית cDNA עצמו אינה מדבקת. 27 טכנולוגית BAC עכשיו הוחל בבניית השיבוטים cDNA מדבקים לקומץ של וירוסים חיוביים גדיל RNA, כלומר, שתי JEVs, CNU / 27 LP2 וSA 14 -14-2 28 (גודל הגנום, ~ 11 KB); שני וירוסים דנגה, BR / 90 26 ו- NGC 29 (~ 11 KB); וירוס שלשולים הנגיפי שור, SD1 (~ 12 KB); 25 שני וירוסים קלאסיים קדחת חזירים, C ו- פאדרבורן (~ 12 KB); 24 וירוס המחלה גבול, Gifhorn (~ 12 KB); 24 וירוס תסמונת רבייה ונשימה חזירי , PL97-1 / LP1 (~ 15 KB); 30 וירוס גסטרו-ההעברה, PUR46-MAD (~ 29 KB); 16 וירוס דלקת הצפק המדבק של חתולים,DF-2 (~ 29 KB); 32 קורונה החמור החריף בדרכי הנשימה תסמונת, Urbani (~ 30 KB); 9 קורונה תסמונת הנשימה המזרח התיכון, EMC / 2012 (~ 30 KB); 17 וקורונה האנושי, OC43 (~ 31 KB) 31 היתרון העיקרי של שימוש בBACS לבניית cDNA הוא היציבות הגנטית הגבוהה של פלסמידים BAC הגדולים, 1 או 2-עותק.; עם זאת, הטבע הפנימי של מאוד נמוך העותק מספרו הוא גם חסרון גדול, בגלל תשואות נמוכות מאוד של DNA BAC וההפחתה הסוגר בטוהר של ה- DNA BAC ביחס לארח DNA כרומוזומליות. בפרוטוקול הנוכחי, התשואה של BAC DNA מוגדל על ידי גידול E. coli DH10B הפך עם pBAC BAC המדבק / 14 SA -14-2 במדיום עשיר בחומרים מזינים, 2xYT. למרות מאמץ זה, התשואה הממוצעת היא רק ~ 15 מיקרוגרם של ה- DNA BAC מ 500 מיליליטר של מרק 2xYT. כמו כן, את הטוהר של ה- DNA BAC הוא הטוב ביותר להשיג באמצעות צנטריפוגה שיפוע צפיפות CsCl-EtBr לטיהור, ולא בידוד פלסמיד המבוסס על טור הנפוץ. עם זאת, חשוב לזכור כי א-שינה BAC coli לא צריך לגדול יותר, כי זה עלול לסכן את היציבות הגנטית של cDNA המשובט, וצמיחה גבוהה יותר לא בהכרח תוביל לתשואות גדולות יותר או DNA BAC גבוה-הטוהר. הפרוטוקול המתואר כאן הוא ושיטה מותאמות, יעילים, יעילה לבנייה וההפצה של שיבוט cDNA זיהומיות יציב מבחינה גנטית באורך מלא כBAC לJEV, הליך חשב כמעט בלתי אפשרי פעם אחת. אותה אסטרטגית שיבוט זה יכול גם להיות מיושם לרב וירוסי RNA חיובי גדיל אחרים. באופן כללי, שיבוטים cDNA זיהומיות יאפשר לנו להציג את מגוון רחב של מוטציות (למשל, מחיקות, הוספות, ומוטציות נקודה) לגנום רנ&quot;א נגיפי ללמוד פונקציות הביולוגיות שלהם בשכפול ופתוגנזה ויראלי. מערכת גנטיקה ההפוכה מבוסס cDNA זה מאפשר לפתח וTESחיסון לא ומועמדים טיפוליים מיקוד גורם ארסיות (ים) של נגיף RNA חיובי גדיל מסוים של עניין. בנוסף, טכנולוגית cDNA זיהומיות זה יכול גם לשמש כוקטור נגיפי, מסוגל להביע גן זר (ים) של עניין עבור יישומים רבים במחקר ביו-רפואי.

לירולוגים RNA, כניסתו של טכנולוגיית ה- DNA רקומביננטי בשנתי ה -1970 המאוחרות שאפשר להמיר את הגנום רנ&quot;א נגיפי לשיבוטי cDNA, אשר לאחר מכן יכול להיות מופץ כפלסמידים בחיידקים למניפולציה הגנטית של נגיפי RNA. 1 להיות וירוס RNA הראשון מולקולרי המשובטים היה Qβ bacteriophage, וירוס RNA חיובי גדיל שמדביק coli Escherichia. פלסמיד המכיל עותק cDNA מלא של RNA הגנומי Qβ הוליד פאגים Qβ זיהומיות כאשר הציג לE. coli. 2 זמן קצר לאחר מכן, בטכניקה זו יושמה לנגיף פוליו, נגיף RNA חיובי גדיל של בני אדם ובעלי חיים. פלסמיד הנושא cDNA באורך מלא של RNA הגנומי נגיף הפוליו היה מידבק כאשר transfected לתאי יונקים ומסוגלים לייצר virions זיהומיות 3 בזה גישה &quot;שהושק ה- DNA&quot;, צריך להיות עיבד cDNAs המשובט intracellularly ליזום שכפול רנ&quot;א נגיפי.;עם זאת, לא ברור כיצד השעתוק הוא יזם ואיך התמלילים מעובדים לרצף הנגיפי הנכון. חשש זה הוביל לפיתוח של חלופה &quot;שהושק RNA&quot; גישה, לפיה עותק cDNA מלא של הגנום רנ&quot;א הנגיפי הוא משובט תחת אמרגן מוכר על ידי א &#39; coli או RNA פולימראז הפאג לייצור RNAs הסינתטי במבחנה עם &#39;ו 3&#39; טרמיני המוגדרים 5, שעובר את מחזור השכפול הנגיפי השלם כאשר הוכנסו לתאי מארח. 4,5 ההצלחה הראשונה עם גישה זו דווחה לוירוס פסיפס ברום , 6,7 וירוס RNA חיובי גדיל של צמחים. מאז, הגישה השיק RNA פותחה עבור מגוון רחב של וירוסי RNA חיובי גדיל, כולל caliciviruses, alphaviruses, flaviviruses, arteriviruses, וקורונה. 1,4,5,8 בשני דנ&quot;א ורנ&quot;א השיק מערכות גנטיקה הפוכה, הבנייה של פולשיבוט cDNA L-אורך הוא המפתח ליצירת DNA או RNA של וירוסי RNA חיובי גדיל מדבק, אבל זה הופך להיות אתגר משמעותי טכני כמו הגודל של עליות הגנום נגיפיות. 9-17 בפרט, הגנום RNA גדול של ~ 10 -32 Kb מציג שלושה מכשולים עיקריים לשיבוט של cDNA הפונקציונלי באורך מלא. 18 הקושי הראשון הוא הסינתזה של cDNA נאמן להעתיק, מאז הנאמנות של RT-PCR היא ביחס הפוך לאורכו של רנ&quot;א הנגיפי. המשוכה השנייה היא נוכחותם של רצפים רעילים, מאז מולקולות RNA ארוכות יותר עלולות להכיל רצפים בלתי צפויים מסוגלים לבצע את בר cDNA בפלסמידים לא יציבים בE. coli. הנושא השלישי והקריטי ביותר הוא הזמינות של וקטור מתאים, שכן קשה למצוא וקטור שיבוט שיכול לשכן להוסיף cDNA ויראלי של&gt; 10 KB. במהלך שלושת העשורים האחרונים, חסמים אלה היו להתגבר על ידי כמה התקדמויות בenzymology, מתודולוגיה,vectorology ד. 1,4,5,8 מבין אלה, הפיתוח המבטיח וחדשני ביותר הוא השיבוט של וירוסים גדולים חיובי גדיל RNA כרומוזומים מלאכותיים בקטריאלי זיהומיות כ( BACS). וקטור BAC הוא פלסמיד נמוך עותק שיבוט (1-2 עותקים / תא) המבוסס על ה גורם פוריות coli, עם גודל ממוצע של ה- DNA להוסיף ~ 120-350 kb 19-21 קטע DNA מוכנס לתוך וקטור BAC באופן דומה לשיבוט לתוך וקטורי שיבוט כלליים.; השיבוטים BAC וכתוצאה מכך הם יציבים לאורך דורות רבים בE. coli. 22,23 עד כה, טכנולוגית BAC נעשה שימוש כדי ליצור שיבוטים cDNA מדבקים ל&gt; 10 חברי שלוש משפחות חיוביות גדיל RNA וירוס, כלומר, Flaviviridae, 24-29 Arteriviridae, 30 וCoronaviridae. 9,16,17 , 31,32 שימוש בוירוס דלקת מוח יפני (JEV) כדוגמא, את העבודה הנוכחית מדווחת נהלים מפורטים שיכול להיותמשמש לבניית BAC זיהומיות באורך מלא יציב מבחינה גנטית עבור מגוון רחב של וירוסי RNA חיובי גדיל. JEV הוא flavivirus zoonotic 33 שמועבר בטבע בין ציפורים, חזירים, ומארחי חוליות אחרים על ידי וקטורי יתושים. 34,35 בבני אדם, זיהום JEV יכול לגרום לדלקת קרום המוח הקטלנית לעתים קרובות החמורה המחלה נוירולוגית היפנית (י&quot;א), 36 אשר מתרחש ב אסיה וחלקים של האוקיינוס ​​השקט במערב, 37,38 עם שכיחות שנתית משוערת של ~ 50,000-175,000 מקרים קליניים. 39,40 הגנום של JEV היא 11 KB, מולקולה ~ חד-גדילים, חיובי תחושת RNA ומורכבת מסגרת קריאה פתוחה יחידה (ORF) מוקפת שני אזורי קידוד-עישון (NCRs) ב5 &#39;ו 3&#39; מסתיימת. 41,42 ORF מקודד polyprotein שהוא ביקע על ידי מארח ופרוטאזות הנגיפית כדי לייצר 10 חלבונים בודדים, מיועד C, PRM, E, ns1, NS2A, NS2B, ns3 NS4A, NS4B, וNS5 בN- לכיוון C-מסוף. 34,43,44 כמו כן, דוארטופס xtended של ns1 (ns1 &#39;) בא לידי הביטוי על ידי -1 frameshifting ריבוזומלי בקודונים 8-9 של NS2A. 45,46 של 11 חלבונים אלה, שלושה החלבונים המבניים (C, PRM, ו- E) הם חיוניים ליצירה של זיהומיות virions, 47,48 ושמונת חלבוני nonstructural הנותרים (ns1 לNS5, וns1 &#39;) הם קריטיים עבור שכפול נגיפי RNA, הרכבה 49-51 חלקיקים, 52-56 והתחמקות חסינות מולדת. 57-59 שניהם 5&#39; ו 3 &quot;NCRs מכיל רצפי שימור ראשוניים ומבני RNA צורה משניים / יישונים, 60-62 שהם חשובים לויסות שכפול רנ&quot;א נגיפי. 63,64 פרוטוקול זה מתאר את הכלים, שיטות והאסטרטגיות ליצירת באורך מלא BAC זיהומיות של JEV 14 SA -14-2. 28 שיבוט BAC פונקציונלי זה מכיל עותק מלא cDNA של RNA הגנומי JEV, 65 אשר הקיף על ידי אמרגן לRNA פולימראז SP6 במעלה הזרםשל 5&#39;-הסוף הנגיפי ואתר הגבלה ייחודי Xba אני במורד הזרם של 3&#39;-הסוף הנגיפי במבחנה תעתיק ניגר. טכנולוגית BAC זה חל על בניית שיבוט מולקולרי cDNA פונקציונלי מלא עבור מערך של וירוסי RNA חיובי גדיל.

<table><tbody><tr><td>&lt;strong&gt;1. Molecular Cloning&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>2xYT Broth</td><td>Sigma-Aldrich</td><td>Y2377</td><td></td></tr><tr><td>[&lt;sup&gt;3&lt;/sup&gt;H]UTP</td><td>PerkinElmer</td><td>NET380250UC</td><td>Radioactive</td></tr><tr><td>50 ml Tube</td><td>Thermo Scientific (Nalgene)</td><td>3114-0050</td><td></td></tr><tr><td>250 ml Bottle</td><td>Beckman Coulter</td><td>356011</td><td></td></tr><tr><td>Agarose</td><td>Lonza</td><td>50004</td><td></td></tr><tr><td>Agarose (Low Melting Point)</td><td>Life Technologies (Invitrogen)</td><td>16520-100</td><td></td></tr><tr><td>AvaI</td><td>New England BioLabs</td><td>R0152S</td><td></td></tr><tr><td>AvrII</td><td>New England BioLabs</td><td>R0174S</td><td></td></tr><tr><td>BamHI</td><td>New England BioLabs</td><td>R0136S</td><td></td></tr><tr><td>BsiWI</td><td>New England BioLabs</td><td>R0553S</td><td></td></tr><tr><td>BsrGI</td><td>New England BioLabs</td><td>R0575S</td><td></td></tr><tr><td>Butanol</td><td>Fisher Scientific</td><td>A399-1&amp;nbsp;</td><td></td></tr><tr><td>Cesium Chloride</td><td>Fisher Scientific</td><td>BP1595-1</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma-Aldrich</td><td>C0378</td><td></td></tr><tr><td>Chloroform</td><td>Sigma-Aldrich</td><td>C2432</td><td>Carcinogenic</td></tr><tr><td>DE-81 Filter Paper</td><td>GE Healthcare Life Sciences</td><td>3658-023</td><td></td></tr><tr><td>dNTP mix</td><td>Life Technologies (Invitrogen)</td><td>18427-088</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DH10B&amp;nbsp;</td><td>Life Technologies (Invitrogen)</td><td>18297-010</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E5134</td><td></td></tr><tr><td>Ethanol&amp;nbsp;</td><td>Sigma-Aldrich</td><td>E7023</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Sigma-Aldrich</td><td>E7637</td><td>Toxic and highly mutagenic</td></tr><tr><td>Filter Column (Plasmid Maxiprep Kit)</td><td>Life Technologies (Invitrogen)</td><td>K2100-26</td><td></td></tr><tr><td>Glacial Acetic Acid</td><td>Sigma-Aldrich</td><td>A6283</td><td>Irritating</td></tr><tr><td>Glucose</td><td>Sigma-Aldrich</td><td>G5400</td><td></td></tr><tr><td>Glycogen&amp;nbsp;</td><td>Roche</td><td>10901393001</td><td></td></tr><tr><td>High-fidelity DNA Polymerase</td><td>New England BioLabs</td><td>M0491S</td><td></td></tr><tr><td>Isoamyl Alcohol</td><td>Sigma-Aldrich</td><td>I9392</td><td>Flammable</td></tr><tr><td>Isopropanol&amp;nbsp;</td><td>Amresco</td><td>0918</td><td>Flammable</td></tr><tr><td>LB Broth</td><td>Life Technologies (Invitrogen)</td><td>12795-027</td><td></td></tr><tr><td>Lithium Chloride</td><td>Sigma-Aldrich</td><td>L9650</td><td></td></tr><tr><td>Lysozyme</td><td>Amresco</td><td>0663</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Sigma-Aldrich</td><td>M8266</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Life Technologies (Invitrogen)</td><td>18080-044</td><td></td></tr><tr><td>Mung Bean Nuclease</td><td>New England BioLabs</td><td>M0250S</td><td></td></tr><tr><td>Needle (18G, 20G)</td><td>BD</td><td>305196, 305175</td><td>Biohazardous (Sharps waste)</td></tr><tr><td>NotI</td><td>New England BioLabs</td><td>R0189S</td><td></td></tr><tr><td>Oligonucleotide</td><td>Integrated DNA Technologies</td><td>Custom Oligonucleotide Synthesis</td><td></td></tr><tr><td>PacI</td><td>New England BioLabs</td><td>R0547S</td><td></td></tr><tr><td>pBeloBAC11</td><td>New England BioLabs</td><td>ER2420S (E4154S)</td><td></td></tr><tr><td>Phenol (Buffer-Saturated)</td><td>Life Technologies (Invitrogen)</td><td>15513-039</td><td>Toxic and highly corrosive</td></tr><tr><td>Phenol:Chloroform:Isoamyl Alcohol</td><td>Life Technologies (Invitrogen)</td><td>15593-031</td><td>Toxic and highly corrosive</td></tr><tr><td>Phenol:Guanidine Isothiocyanate</td><td>Life Technologies (Ambion)</td><td>10296-010</td><td>Toxic, corrosive, and irritating</td></tr><tr><td>Pme I</td><td>New England BioLabs</td><td>R0560S</td><td></td></tr><tr><td>Potassium Acetate</td><td>Amresco</td><td>0698</td><td></td></tr><tr><td>RNase Inhibitor</td><td>Life Technologies (Invitrogen)</td><td>10777-019</td><td></td></tr><tr><td>rNTP Set</td><td>GE Healthcare Life Sciences</td><td>27-2025-01</td><td></td></tr><tr><td>Sealable Polypropylene Tube (16 &amp;times; 76 mm)&amp;nbsp;</td><td>Beckman Coulter</td><td>342413</td><td></td></tr><tr><td>SfiI</td><td>New England BioLabs</td><td>R0123S</td><td></td></tr><tr><td>Sma I</td><td>New England BioLabs</td><td>R0141S</td><td></td></tr><tr><td>Sodium Acetate</td><td>Sigma-Aldrich</td><td>S2889</td><td></td></tr><tr><td>Sodium Dodecyl Sulfate</td><td>Amresco</td><td>0227</td><td></td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich</td><td>S5881</td><td></td></tr><tr><td>SP6 RNA Polymerase</td><td>New England BioLabs</td><td>M0207S</td><td></td></tr><tr><td>Spin Column (Plasmid Miniprep Kit)</td><td>Life Technologies (Invitrogen)</td><td>K2100-11</td><td></td></tr><tr><td>Syringe</td><td>HSW NORM-JECT</td><td>4200.000V0</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td></td></tr><tr><td>Tris</td><td>Amresco</td><td>0826</td><td></td></tr><tr><td>tRNA (yeast)</td><td>Life Technologies (Invitrogen)</td><td>15401-011</td><td></td></tr><tr><td>XbaI&amp;nbsp;</td><td>New England BioLabs</td><td>R0145S</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;2. Cell Culture&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Alpha Minimal Essential Medium</td><td>Life Technologies (Gibco)</td><td>12561-049</td><td></td></tr><tr><td>Conical Tube (50 mL)</td><td>VWR</td><td>21008-242</td><td></td></tr><tr><td>Crystal Violet&amp;nbsp;</td><td>Sigma-Aldrich</td><td>C0775</td><td></td></tr><tr><td>Culture Dish (150 mm)&amp;nbsp;</td><td>TPP</td><td>93150&amp;nbsp;</td><td></td></tr><tr><td>Cuvette (2-mm Gap)</td><td>Harvard Apparatus</td><td>450125&amp;nbsp;</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Life Technologies (Gibco)</td><td>16000-044</td><td></td></tr><tr><td>Formaldehyde</td><td>Sigma-Aldrich</td><td>F1635</td><td>Toxic and carcinogenic</td></tr><tr><td>Glutamine</td><td>Life Technologies (Gibco)</td><td>25030-081</td><td></td></tr><tr><td>Minimal Essential Medium</td><td>Life Technologies (Gibco)</td><td>61100-061</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Life Technologies (Gibco)</td><td>15070-063</td><td></td></tr><tr><td>Potassium Chloride</td><td>Sigma-Aldrich</td><td>P3911</td><td></td></tr><tr><td>Potassium Phosphate Monobasic</td><td>Sigma-Aldrich</td><td>P9791</td><td></td></tr><tr><td>Six-Well Plate</td><td>TPP</td><td>92006</td><td></td></tr><tr><td>Sodium Chloride</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>Sodium Phosphate Dibasic</td><td>Sigma-Aldrich</td><td>S3264</td><td></td></tr><tr><td>Trypsin-EDTA (0.25%)</td><td>Life Technologies (Gibco)</td><td>25200-056</td><td></td></tr><tr><td>Vitamins</td><td>Sigma-Aldrich</td><td>M6895</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;3. Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Agarose Gel Electrophoresis System</td><td>Mupid</td><td>MPDEXU-01</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Incubator</td><td>Thermo Scientific</td><td>Heracell 150i</td><td></td></tr><tr><td>Desktop Centrifuge&amp;nbsp;</td><td>Thermo Scientific</td><td>ST16R</td><td></td></tr><tr><td>Electroporator</td><td>Harvard Apparatus</td><td>ECM 830</td><td></td></tr><tr><td>Longwave Ultraviolet Lamps (Handheld)</td><td>UVP</td><td>UVGL-58</td><td></td></tr><tr><td>Tabletop Centrifuge</td><td>Beckman Coulter</td><td>368826</td><td></td></tr><tr><td>Thermocycler</td><td>Life Technologies (Applied Biosystems)</td><td>GeneAmp PCR System 9700</td><td></td></tr><tr><td>Vortexer</td><td>Scientific Industries</td><td>G-560</td><td></td></tr><tr><td>Water Bath</td><td>Jeio Tech</td><td>WB-10E</td><td></td></tr></tbody></table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

לכל וירוסי RNA חיובי גדיל, האמינות והיעילות של מערכת גנטיקה הפוכה תלויה ביציבות הגנטית של cDNA באורך מלא משובט, הרצף שהוא שווה ערך לרצף הקונצנזוס של RNA הגנומי ויראלי. 27 איור 1 מציג חמישה אסטרטגית צעד לבניית cDNA זיהומיות באורך מלא כBAC לJEV SA 14 -14-2 28: שלב 1, טיהור של רנ&quot;א הנגיפי מsupernatant תרבית תאים של BHK-21 תאים נגועים JEV (איור 1 א); שלב 2, סינתזה של ארבע amplicons החופפות cDNA (F1 כדי F4) פורש הגנום הנגיפי השלם (איור 1); שלב 3, subcloning של כל אחד מארבעת שברי cDNA רציפים לתוך וקטור BAC, יצירת pBAC / F1 כדי pBAC / F4 (איור 1 ג); שלב 4, שינוי של cDNAs המשובט לשעתוק ניגר במבחנה עם RNA פולימראז SP6, כלומר, הצבת SP6רצף אמרגן מייד במעלה הזרם של 5&#39;-הסוף הנגיפי (pBAC / F1 SP6), ביטול מראש קיימים-פנימי אתר Xba אני בנוקלאוטיד 9,131 ידי החדרת מוטציה נקודה שקטה, 9,134 → T (pBAC / F3 KO), והכנסת אתר Xba המלאכותי החדש אני רץ-מייד במורד הזרם של 3&#39;-הסוף הנגיפי (pBAC / F4 RO) (איור 1D); ושלב 5, הרכבה של באורך מלא SA 14 -14-2 cDNA BAC, pBAC / SA 14 -14-2 (איור 1E). טבלת 1 רשימות oligonucleotides המשמש בתהליך שכפול זה. 28 לבניית JEV cDNA פונקציונלי, הצעד החשוב הראשון הוא הסינתזה של ארבעה שברי cDNA החופפים באמצעות רנ&quot;א הנגיפי המטוהר כתבנית לRT-PCR. איור 2 מספק תוצאת נציג לארבעה מוצרי RT-PCR שהיו electrophoresed על 0.8%agarose ג&#39;ל. ג&#39;ל זו ממחיש באופן ברור כי באורך מלא JEV cDNA מוגבר לארבעה שברי cDNA חופפים. מדי פעם, תגובות RT-PCR עשויות להניב מוצרי וירוס ספציפי או ספציפי נוסף אחת או יותר, כי הם קטנים יותר מאשר ברוב המוצר הצפוי, בגלל חישול ספציפי של פריימרים במהלך סינתזה / ההגברה cDNA. מצד השני, קטן או לא צפוי מוצר RT-PCR היה להיות מוגבר בגלל זיהום RNase המקרי במהלך בידוד RNA הנגיפי או ביצועי RT-PCR לא תקינים. הצעד הבא הוא מפתח השיבוט והשינוי של אורך מלא partial- או JEV cDNA בBAC, שהנו הליך פשוט יחסית שמשתמש בטכניקות DNA רקומביננטי סטנדרטיים. 69 איור 3 מציג תוצאות נציג לטיהור שיבוט BAC מכילה cDNA באורך מלא של JEV SA 14 -14-2 על ידי רצועות בשיפוע CsCl-EtBr.בניסוי זה, לאחר צנטריפוגה במשך 16 שעות ב401700 × גרם, שתי להקות שונות, כלומר, א &#39; DNA coli כרומוזומליות לעיל ופלסמיד דנ&quot;א BAC supercoiled להלן, נראה באמצע הצינור תחת אור אולטרה סגול גל ארוך. נפח מינימאלי (~ 400 μl) של להקת ה- DNA BAC הנמוכה נאסף בקפידה על ידי תוקע חור עם מזרק בצד של הצינור. בהמשך לכך, EtBr הופק מה- DNA BAC על ידי מיצוי butanol, וללא EtBr BAC DNA היה מרוכז על ידי משקעים אתנול. השלב האחרון הוא קביעת infectivity הספציפי של RNAs הסינתטי עיבד במבחנה באורך המלא SA 14 -14-2 BAC (pBAC / 14 SA -14-2) לאחר transfection RNA בתאי יתר (איור 4). צעד זה כרוך בשלושה שלבים עוקבים: שלב 1, linearization של האורך המלא SA 14 -14-2 cDNA ב&#39;3-end של הגנום הנגיפי (איור 4 א); שלב 2, ייצור RNAs הסינתטי מcDNA לינארית על ידי שעתוק נגר (איור 4); ושלב 3, הצלה של וירוסי רקומביננטי בBHK-21 תאים transfected עם RNAs הסינתטי (איור 4C). בניסוי, שני שיבוטים עצמאיים של pBAC / 14 SA -14-2 היו לינארית עם Xba אני עיכול וטופלו בMBN להסיר 5 הסככה ארבעה-הבסיס &quot;שנוצרה על ידי עיכול Xba אני. BACS ינארית נוקה על ידי מיצוי פנול, כלורופורם, ואחריו משקעים אתנול. Linearization של שני BACS המטוהר הודגם על 0.8% agarose ג&#39;ל (איור 5 א &#39;). חילוץ פנול, כלורופורם חייב להיעשות בזהירות כדי להבטיח שBACS לינארית הוא RNase ללא. כל אחד משני BACS ינארית שימש כתבנית cDNA לשעתוק נגר באמצעות פולימראז SP6 RNA בנוכחות G מ &#39;7 (5&#39;) PPP (5&#39;) אנלוגי כובע. שלמות RNAs הסינתטי הוצגה על ידי הפעלת aliquots של שתי תערובות תגובת שעתוק על 0.6% agarose ג&#39;ל, יחד עם סולם DNA KB התייחסות 1 (איור 5). ב assay זה פשוט, להקת RNA הבולט הגדולה תמיד היגרה רק להלן 3 kb התייחסות להקת DNA ונראיתי חד. עם זאת, מושפל RNA יהיה בעלת מראה מרוח על אותו ג&#39;ל. Assay מרכז זיהומיות הוא סטנדרט הזהב להחלטת infectivity הספציפי של RNAs הסינתטי. assay זה נעשה על ידי electroporating BHK-21 תאים עם דגימות RNA, זריעת aliquots שווה של פי 10 בדילול סדרתי התאים electroporated 6 צלחות המכילות גם BHK-21 תאים נאיביים (3 × 10 5 תאים היטב /), וכיסית agarose על monolayers התא. לאחר הדגירה במשך 4 ימים, תאים ששרדו היו קבועים עם פורמלדהיד ומוכתם בים סגול גבישolution לכמת את מספר מרכזי זיהומיות (פלאק), אשר תואם את מספר מולקולות RNA זיהומיות מועברות לתוך התאים (איור 6 א). מאז תבנית cDNA משמשת לשעתוק במבחנה הוכחה להיות שאינו מדבק, 27 aliquot של תערובת תגובת השעתוק היה ישירות המשמש לelectroporation. Electroporation הוא השיטה המועדפת לtransfection RNA; לחלופין, ניתן transfected RNAs בשיטות אחרות באמצעות יפוזומים DEAE-dextran וקטיוני. electroporation RNA הוא מאוד יעיל, אבל &quot;קשתי&quot; של הדופק החשמלי מתרחש רק לעתים נדירות, אם מלחים נמצאים בתגובת electroporation או אם קובט electroporation הוא שימוש חוזר. הביטוי של חלבונים נגיפיים בתאים-transfected RNA נבדק על ידי מבחני immunofluorescence באמצעות antiserum ארנב נגד ns1 (איור 6). הייצור של חלקיקים נגיפיים שנצברו בsupernatants של תאי transfected RNA היהalyzed על ידי מבחני פלאק (איור 6 ג). התוצאות של ניסויים אלה מראים בבירור כי RNAs הסינתטי נגזר cDNA הם מדבק בBHK-21 תאים מתירנית, יצירת כייל גבוה של וירוסי רקומביננטי. <table fo:keep-together.within-page="1" style=";text-align:right;direction:rtl"><tbody><tr><td> Oligonucleotide </td><td> רצף (5 &#39;ל 3&#39;) </td><td> ב מיקום </td><td> קוטביות </td></tr><tr><td> 1RT </td><td> TAGGGATCTGGGCGTTTCTG GCAAAT </td><td> 2578-2603 </td><td> Antisense </td></tr><tr><td> 1F </td><td> aatcccgggAGAAGTTTATC TGTGTGAACTT </td><td> 1-22 </td><td> לָחוּשׁ </td></tr><tr><td> 1R </td><td> attgcggccgcCCACGTCGT TGTGCACGAAGAT </td><td> 2532-2553 </td><td> Antisense </td></tr><tr><td> 2RT </td><td> TTCTGCCTACTCTGCCCCTC CGTTGA </td><td> 5975-6000 </td><td> נְמָלָהisense </td></tr><tr><td> 2F </td><td> aatcccgggTCAAGCTCAGT GATGTTAACAT </td><td> 1800-1821 </td><td> לָחוּשׁ </td></tr><tr><td> 2R </td><td> attgcggccgcGATGGGTTT CCGAGGATGACTC </td><td> 5929-5950 </td><td> Antisense </td></tr><tr><td> 3RT </td><td> ACGGTCTTTCCTTCTGCTGC AGGTCT </td><td> 9426-9451 </td><td> Antisense </td></tr><tr><td> 3F </td><td> aatcccgggGAGGATACATT GCTACCAAGGT </td><td> 5500-5521 </td><td> לָחוּשׁ </td></tr><tr><td> 3R </td><td> attgcggccgcGTAAGTCAG TTCAATTATGGCT </td><td> 9380-9401 </td><td> Antisense </td></tr><tr><td> 4RT </td><td> AGATCCTGTGTTCTTCCTCA CCACCA </td><td> 10,952-10,977 </td><td> Antisense </td></tr><tr><td> 4F </td><td> aatcccgggAGTGGAAGGCT CAGGCGTCCAA </td><td> 9200-9221 </td><td> לָחוּשׁ </td></tr><tr><td> 4R </td><td> attgcggccgcAGATCCTGT GTTCTTCCTCACC </td><td> 10,956-10,977 </td><td> Antisense </td></tr><tr><td> SP6F </td><td> cataccccgcgtattcccac ת&quot;א </td><td></td><td> לָחוּשׁ </td></tr><tr><td> SP6R </td><td> ACAGATAAACTTCTctatag tgtcccctaaa </td><td> 1-14 </td><td> Antisense </td></tr><tr><td> F1F </td><td> aggggacactatagAGAAGT TTATCTGTGTG </td><td> 1-17 </td><td> לָחוּשׁ </td></tr><tr><td> F1R </td><td> TGGATCATTGCCCATGGTAA GCTTA </td><td> 638-662 </td><td> Antisense </td></tr><tr><td> X1F </td><td> CGAATGGATCGCACAGTGTG GAGAG </td><td> 8403-8427 </td><td> לָחוּשׁ </td></tr><tr><td> X1R </td><td> AAAGCTTCAAACTCAAGATA CCGTGCTCC </td><td> 9120-9148 </td><td> Antisense </td></tr><tr><td> X2F </td><td> GGAGCACGGTATCTTGAGTT TGAAGCTTT </td><td> 9120-9148 </td><td> לָחוּשׁ </td></tr><tr><td> X2R </td><td> cacgtggacgagggcatgcc tgcag </td><td></td><td> Antisense </td></tr><tr><td> ROF </td><td> CCAGGAGGACTGGGTTACCA AAGCC </td><td> 10,670-10,694 </td><td> לָחוּשׁ </td></tr><tr><td> ROR </td><td> agggcggccgctctagAGAT CCTGTGTTCTTCCTCACCAC </td><td> 10,954-10,977 </td><td> Antisense </td></tr><tr><td colspan="4"> רצפי JEV מוצגים באותיות רישיות, ורצפי BAC מסומנים באותיות קטנות. עמדת נוקלאוטיד ב מתייחסת לרצף הגנום המלא של JEV SA 14 -14-2 (מספר הצטרפות GenBank JN604986). </td></tr></tbody></table> טבלה 1: Oligonucleotides משמש לסינתזת cDNA, הגברה PCR, וmutagenesis BAC. <img alt="איור 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> איור 1.0; אסטרטגיה לבניית cDNA באורך מלא של JEV SA 14 -14-2 כBAC בידוד () של רנ&quot;א הנגיפי מחלקיקי JEV.. מוצג הוא תרשים סכמטי של RNA הגנומי של JEV SA 14 -14-2. (ב) סינתזה של ארבעה שברי cDNA חופפים (F1 כדי F4) המכסה את כל הגנום הנגיפי. Subcloning (C) של ארבעה שברי cDNA חופפים לוקטור BAC, יצירת pBAC / F1 כדי pBAC / F4. שינוי (D) של cDNAs המשובט לשעתוק נגר במבחנה. pBAC / F1 SP6 הוא נגזר של pBAC / F1 שמכיל את רצף אמרגן SP6 במעלה הזרם של 5&#39;-סוף ויראלי. pBAC / F3 KO הוא נגזר של pBAC / F3 המכיל מוטציה שקטה נקודה (9,134 → T, כוכבית). pBAC / F4 RO הוא נגזר של pBAC / F4 המכיל Xba אני מלאכותי אתר נגר במורד הזרם של 3&#39;-סוף ויראלי. (E </<html> strong&gt;) עצרת של באורך מלא SA 14 -14-2 BAC (pBAC / 14 SA -14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> איור 2. סינתזה של ארבעה שברי cDNA חופפים (F1 כדי F4) פורש RNA הגנומי באורך המלא של JEV SA 14 -14-2. ארבעה מוצרי RT-PCR מוערכים על ידי אלקטרופורזה בג&#39;ל 0.8% agarose. M, סולם DNA 1 KB. הגדלים הצפויים של ארבעה שברי cDNA מסומנים בתחתית תמונת ג&#39;ל. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> /ftp_upload/53164/53164fig3.jpg &quot;/&gt; טיהור איור 3. של BAC מכיל cDNA באורך מלא של 14 JEV SA -14-2. פלסמיד BAC מבודד מא coli DH10B בשיטת תמוגה SDS-בסיסית ומטוהר יותר על ידי רצועות בשיפוע CsCl-EtBr. הציג הוא דוגמא לשיפוע CsCl-EtBr באמצעות צינור פוליפרופילן סגר 16 × 76 מ&quot;מ. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> סקירת איור 4. ההתאוששות של וירוסים מדבקים באורך מלא JEV SA 14 -14-2 cDNA התאסף בBAC. (א) לינאריזציה של תבנית cDNA. באורך המלא JEV BAC הוא לחתוך עםטופלתי Xba אני ועם MBN. סינתזה (ב) לתעתיקי הרנ&quot;א. CDNA לינארית הוא עיבד על ידי RNA פולימראז SP6 בנוכחות מ &#39;7 G (5&#39;) PPP (5 &#39;) אנלוגי כובע. (ג) שחזור של JEVs הסינתטי. במבחנה RNAs עבד הם transfected לBHK-21 תאים על ידי electroporation, אשר מייצר כייל גבוה של וירוס סינטטי. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> איור 5. סינתזה של RNAs ידי שעתוק במבחנה באמצעות BAC JEV באורך מלא כתבנית cDNA. דור (א) לאורך המלא לינארית JEV BAC, pBAC / 14 SA -14-2. שני שיבוטים עצמאיים של pBAC/ SA 14 -14-2 (Cl.1 וCl.2) הם ינארית על ידי עיכול עם Xba אני וטיפול שלאחר מכן עם MBN. BACS ינארית נבחנים על ידי אלקטרופורזה בג&#39;ל 0.8% agarose. הפקה (ב) לRNAs הסינתטי על ידי שעתוק נגר. כל אחד משני BACS ינארית משמש כתבנית לשעתוק ניגר RNA פולימראז SP6. Aliquots של שתי תגובות השעתוק מנוהלים על 0.6% agarose ג&#39;ל. M, 1 KB סולם DNA. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> איור 6. infectivity ספציפי של RNAs הסינתטי עיבד מBAC JEV באורך מלא וההתאוששות של וירוס סינטטי. BHK-21 תאים (מוק)-electroporated מדומים או electroporated עם תעתיקי הרנ&quot;א נגזרים frאום כל אחד משני השיבוטים העצמאיים של BAC JEV באורך מלא (Cl.1 וCl.2). () Infectivity RNA. התאים הם כיסו עם agarose ומוכתם בסגולים קריסטל ב 4 ימים לאחר transfection. infectivity RNA נקבע על ידי מבחני מרכז זיהומיות כדי להעריך את הכמות של RNA זיהומיות electroporated לתוך התאים (פנל משמאל). כמו כן, נציג תמונות של מרכזי זיהומיות מוצגות (פנל מימין). ביטוי חלבון (B). התאים בתרבית שקופיות קאמריות 4 היטב. ביטוי חלבון נגיפי בתאים-electroporated RNA ב 20 שעות שלאחר transfection (HPT) מנותח על ידי מבחני immunofluorescence באמצעות antiserum עיקרי נגד ns1 ארנב וIgG העז Cy3 מצומדות- המשני נגד ארנב (אדום). הגרעינים counterstained עם 4 &#39;, 6-diamidino-2-phenylindole (כחול). תמונות immunofluorescence הם כיסו על תמונות התערבות ההפרש לעומת זאת מקביל שלהם. תשואת וירוס (C). התאים בתרבית 150 מנות תרבות מ&quot;מ. הייצור של virions זיהומיות שנצבר בsupernatants התרבות של תאי electroporated RNA ב 22 ו -40 HPT נבדק על ידי מבחני פלאק. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

חיידקים מלאכותיים כרומוזומים: Genomics כלי פונקציונלי לחקר חיובי גדיל RNA וירוסים

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.3K Views.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Video: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

פשוט וחזק In vivo ו במבחנה גישה ללימוד הרכבה וירוס

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

הקרנת תפוקה גבוהה לספקטרום רחב כימיים מעכבי RNA וירוסים

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Reverse Genetics to Engineer Positive-Sense RNA Virus Variants

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA viruses. By integrating a full RNA genome error-prone PCR and reverse genetics, random genome-wide substitution mutagenesis can be induced. We have developed a method using this technique to synthesize diverse libraries to identify viral mutants with phenotypes of interest. This method, called full-length mutant RNA synthesis (FL-MRS), offers the following advantages: (i) the ability to create a large library via a highly efficient one-step error-prone PCR; (ii) the ability to create groups of libraries with varying levels of genetic diversity by manipulating the fidelity of DNA polymerase; (iii) the creation of a full-length PCR product that can directly serve as a template for mutant RNA synthesis; and (iv) the ability to create RNA that can be delivered into host cells as a non-selected input pool to screen for viral mutants of the desired phenotype. We have found, using a reverse genetics approach, that FL-MRS is a reliable tool to study viral-directed evolution at all stages in the life cycle of the hepatitis C virus, JFH1 isolate. This technique appears to be an invaluable tool to employ directed evolution to understand adaptation, replication, and the role of viral genes in pathogenesis and antiviral resistance in positive-sense RNA viruses.

The protocol describes a method for introducing controllable genetic diversity in the hepatitis C virus genome by combining full-length mutant RNA synthesis using error-prone PCR and reverse genetics. The method provides a model for phenotype selection and can be used for 10 kb long positive-sense RNA virus genomes.

גנטיקה הפוכה כדי להנדס וריאנטים של נגיף RNA בעל חוש חיובי

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA ...

Genetics

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

יצירה והרכבה של נוקלאוקפסידים ספציפיים לווירוסים של הנגיף הסינכרוני הנשימתי

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

Biochemistry

Modeling The Lifecycle Of Ebola Virus Under Biosafety Level 2 Conditions With Virus-like Particles Containing Tetracistronic Minigenomes

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or specific treatments for the disease caused by these viruses, and work with infectious Ebola viruses is restricted to biosafety level 4 laboratories, significantly limiting the research on these viruses. Lifecycle modeling systems model the virus lifecycle under biosafety level 2 conditions; however, until recently such systems have been limited to either individual aspects of the virus lifecycle, or a single infectious cycle. Tetracistronic minigenomes, which consist of Ebola virus non-coding regions, a reporter gene, and three Ebola virus genes involved in morphogenesis, budding, and entry (VP40, GP1,2, and VP24), can be used to produce replication and transcription-competent virus-like particles (trVLPs) containing these minigenomes. These trVLPs can continuously infect cells expressing the Ebola virus proteins responsible for genome replication and transcription, allowing us to safely model multiple infectious cycles under biosafety level 2 conditions. Importantly, the viral components of this systems are solely derived from Ebola virus and not from other viruses (as is, for example, the case in systems using pseudotyped viruses), and VP40, GP1,2 and VP24 are not overexpressed in this system, making it ideally suited for studying morphogenesis, budding and entry, although other aspects of the virus lifecycle such as genome replication and transcription can also be modeled with this system. Therefore, the tetracistronic trVLP assay represents the most comprehensive lifecycle modeling system available for Ebola viruses, and has tremendous potential for use in investigating the biology of Ebola viruses in future. Here, we provide detailed information on the use of this system, as well as on expected results.

Work with infectious Ebola viruses is restricted to biosafety level 4 laboratories. Tetracistronic minigenome-containing replication and transcription-competent virus like particles (trVLPs) represent a lifecycle modeling system that allows us to safely model multiple infectious cycles under biosafety level 2 conditions, relying exclusively on Ebola virus components.

דוגמנות מחזור החיים של נגיף האבולה תחת 2 תנאים ברמת בטיחות ביולוגיים עם חלקיקים כמו וירוס המכילים Tetracistronic Minigenomes

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or ...

Combining Analysis of DNA in a Crude Virion Extraction with the Analysis of RNA from Infected Leaves to Discover New Virus Genomes

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low titers in their host or cannot be mechanically inoculated to another host are difficult to propagate to achieve a greater titer of infectious material. Infected leaves are ground in a mild buffer with optimal pH and ionic composition recommended for purifying most bacilliform Para retroviruses. Urea is used to break up inclusion bodies that trap virions and to dissolve cellular components. Differential centrifugation provides further separation of virions from plant contaminants. Then proteinase K treatment removes the capsids. Then the viral DNA is concentrated and used for next-generation sequencing (NGS). The NGS data are used to assemble contigs which are submitted to NCBI-BLASTn to identify a subset of virus sequences in the generated dataset. In a parallel pipeline, RNA is isolated from infected leaves using a standard column-based RNA extraction method. Then ribosome depletion is carried out to enrich for a subset of mRNA and virus transcripts. Assembled sequences derived from RNA sequencing (RNA-seq) were submitted to NCBI-BLASTn to identify a subset of virus sequences in this dataset. In our study, we identified two related full-length badnavirus genomes in the two datasets. This method is preferred to another common approach which extracts the aggregate population of small RNA sequences to reconstitute plant virus genomic sequences. This latter metagenomic pipeline recovers virus related sequences that are retro-transcribing elements inserted into the plant genome. This is coupled to biochemical or molecular assays to further discern the actively infectious agents. The approach documented in this study, recovers sequences representative of replicating viruses that likely indicate active virus infection.

Here we present a new approach to identify plant viruses with double-strand DNA genomes. We use standard methods to extract DNA and RNA from infected leaves and carry out next-generation sequencing. Bioinformatic tools assemble sequences into contigs, identify contigs representing virus genomes and assign genomes to taxonomic groups.

שילוב ניתוח של דנ א ב מיצוי Virion גולמי עם הניתוח של RNA של עלים נגועים לגלות הגנום וירוס חדש

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

זיהומים arbovirus כמו כלים ההקרנה לצורך זיהוי גורמים אנטי ויראלי Immunomodulators ומנחה

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

Confocal Imaging of Double-Stranded RNA and Pattern Recognition Receptors in Negative-Sense RNA Virus Infection

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors (PRRs) such as the retinoic acid (RIG-I) like receptors (RLRs) RIG-I and melanoma differentiation-associated protein 5 (MDA-5) leads to the induction of the innate immune response. The formation and intracellular distribution of dsRNA in positive-sense RNA virus infection has been well characterized by microscopy. Many negative-sense RNA viruses, including some arenaviruses, trigger the innate immune response during infection. However, negative-sense RNA viruses were thought to produce low levels of dsRNA, which hinders the imaging study of PRR recognition of viral dsRNA. Additionally, infection experiments with highly pathogenic arenaviruses must be performed in high containment biosafety level facilities (BSL-4). The interaction between viral RNA and PRRs for highly pathogenic RNA virus is largely unknown due to the additional technical challenges that researchers need to face in the BSL-4 facilities. Recently, a monoclonal antibody (Mab) (clone 9D5) originally used for pan-enterovirus detection has been found to specifically detect dsRNA with a higher sensitivity than the traditional J2 or K1 anti-dsRNA antibodies. Herein, by utilizing the 9D5 antibody, we describe a confocal microscopy protocol that has been used successfully to visualize dsRNA, viral protein and PRR simultaneously in individual cells infected by arenavirus. The protocol is also suitable for imaging studies of dsRNA and PRR distribution in pathogenic arenavirus infected cells in BSL4 facilities.

Double-stranded RNA produced during RNA virus replication can be recognized by pattern recognition receptors to induce an innate immune response. For negative-sense RNA viruses, the interaction between the low-level dsRNA and PRRs remains unclear. We have developed a confocal microscopy method to visualize arenavirus dsRNA and PRR in individual cells.

הדמיה קונאפוקלית של זוגיות גדילי RNA ודפוס זיהוי רצפטורים להדבקת וירוס RNA שלילי-סנס

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors ...

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

דור, הגברה, טיטור של Recombinant וירוסים Syncytial הנשימה

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

הצלה של וירוס רקומביננטי Zika מתוך כרומוזום מלאכותי בקטריאלי cDNA שיבוט

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...

חיידקים מלאכותיים כרומוזומים: Genomics כלי פונקציונלי לחקר חיובי גדיל RNA וירוסים

Summary

Explore More Videos

PLAYLIST