This work was supported in part by the Lupus Research Institute, NCI grant CA138617, NIDDK grant DK090978, Charlotte Schmidlapp Award (to E.M.J.), and the Albert J. Ryan Fellowship (to J.K.). We are grateful for the support and instrumentation provided by the Research Flow Cytometry Core in the Division of Rheumatology at Cincinnati Children&#8217;s Hospital Medical Center, supported in part by NIH AR-47363, NIH DK78392 and NIH DK90971.

<ol>
	<li>Helmick, C. G., Felson, D. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Part+I.+Arthritis+Rheum.">Part I. Arthritis Rheum.</a> Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).</li><li>Somers, E. C., Marder, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+incidence+and+prevalence+of+systemic+lupus+erythematosus:+The+Michigan+lupus+epidemiology+and+surveillance+program.">Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program.</a> Arthritis and Rheumatol. 66, 369-378 (2014).</li><li>Perry, D., Sang, A., Yin, Y., Zheng, Y. -. Y., Morel, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+models+of+systemic+lupus+erythematosus.">Murine models of systemic lupus erythematosus.</a> J Biomed Biotechnol. 2011, 271694 (2011).</li><li>Lindholm, L., Rydberg, L., Stranneg&#229;rd, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+host+plasma+cells+during+graft-versus-host+reactions+in+mice.">Development of host plasma cells during graft-versus-host reactions in mice.</a> Eur J Immunol. 3 (8), 511-515 (1973).</li><li>Fialkow, P. J., Gilchrist, C., Allison, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoimmunity+in+chronic+graft-versus-host+disease.">Autoimmunity in chronic graft-versus-host disease.</a> Clin Exp Immunol. 13, 479-486 (1973).</li><li>Streilein, J. W., Stone, M. J., Duncan, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+Specificity+of+Autoantibodies+Produced+in+Systemic+Graft-vs-Host+Disease.">Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease.</a> J Immunol. 114 (1), 255-260 (1975).</li><li>Gleichmann, E., Gleichmann, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diseases+caused+by+reactions+of+T+lymphocytes+to+in+compatible+structures+of+the+major+histocompatibility+complex.+I.+Autoimmune+hemolytic+anemia.">Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia.</a> Eur J Immunol. 6 (12), 899 (1976).</li><li>Morris, S., Cohen, P. L., Eisenberg, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+induction+of+systemic+lupus+erythematosus+by+recognition+of+foreign+Ia.">Experimental induction of systemic lupus erythematosus by recognition of foreign Ia.</a> Clin Immunol Immunopathol. 57 (2), 263-273 (1990).</li><li>Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Role+of+Host+(Endogenous)+T+Cells+in+Chronic+Graft-Versus-Host+Autoimmune+Disease.">The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease.</a> J Immunol. 161 (11), 5880-5885 (1998).</li><li>Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING-Mediated+DNA+Sensing+Promotes+Antitumor+and+Autoimmune+Responses+to+Dying+Cells.">STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells.</a> J Immunol. 193, 6124-6134 (2014).</li><li>Petri, M., Orbai, A. -. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+and+validation+of+systemic+lupus+international+collaborating+clinics+classification+criteria+for+systemic+lupus+erythematosus.">Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus.</a> Arthritis Rheum. 64 (8), 2677-2686 (2012).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+Chain+Reaction:+Basic+Protocol+Plus+Troubleshooting+and+Optimization+Strategies.">Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies.</a> J Vis Exp. (63), e3998 (2012).</li><li>. Product information: Thermo Scientific FastDigest PsuI Available from: <a target="_blank" href="https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf">https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf</a> (2012)</li><li>Matheu, M. P., Parker, I., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+and+2-photon+imaging+of+peripheral+lymph+nodes+in+mice.">Dissection and 2-photon imaging of peripheral lymph nodes in mice.</a> J Vis Exp. (7), e265 (2007).</li><li>Harrell, M. I., Iritani, B. M., Ruddell, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymph+node+mapping+in+the+mouse.">Lymph node mapping in the mouse.</a> J Immunol Methods. 332 (1-2), 170-174 (2008).</li><li>Covelli, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+3,+Internal+examination.">Chapter 3, Internal examination.</a> Guide to the necroscopy of the mouse. , (2009).</li><li>Quah, B. J. C., Parish, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+carboxyfluorescein+diacetate+succinimidyl+ester+(CFSE)+to+monitor+lymphocyte+proliferation.">The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation.</a> J Vis Exp. (44), e2259 (2010).</li><li>Matheu, M. P., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+CD4++T+cells+from+mouse+lymph+nodes+using+Miltenyi+MACS+purification.">Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification.</a> J Vis Exp. (9), e53319 (2007).</li><li>Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manual+Restraint+and+Common+Compound+Administration+Routes+in+Mice+and+Rats.">Manual Restraint and Common Compound Administration Routes in Mice and Rats.</a> J Vis Exp. (67), e2771 (2012).</li><li>Hoff, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+of+Blood+Collection+in+the+Mouse.">Methods of Blood Collection in the Mouse.</a> Lab Animal. 29 (10), 47-53 (2000).</li><li>Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+Unfixed,+Frozen+Tissues+to+Study+Natural+Mucin+Distribution.">Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution.</a> J Vis Exp. (67), e3928 (2012).</li><li>Cohen, P. L., Maldonado, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+for+SLE.">Animal models for SLE.</a> Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).</li><li>Seavey, M. M., Lu, L. D., Stump, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+systemic+lupus+erythematosus+(SLE)+and+ex+vivo+assay+design+for+drug+discovery.">Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery.</a> Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).</li><li>McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+caveat+for+T+cell+transfer+studies:+generation+of+cytotoxic+anti-Thy1.2+antibodies+in+Thy1.1+congenic+mice+given+Thy1.2++tumors+or+T+cells.">A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells.</a> J Leukoc Biol. 89 (2), 291-300 (2011).</li><li>Scott, D. M., Ehrmann, I. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+mouse+male-specific+transplantation+antigen+H-Y..">Identification of a mouse male-specific transplantation antigen H-Y..</a> Nature. 376, 695-698 (1995).</li><li>Joly, E., Hudrisier, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+trogocytosis+and+what+is+its+purpose.">What is trogocytosis and what is its purpose.</a> Nat Immunol. 4 (9), 815 (2003).</li><li>Brown, D. R., Calpe, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+an+NK+cell-independent+role+for+Slamf4+in+controlling+humoral+autoimmunity.">Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity.</a> J Immunol. 187 (1), 21-25 (2011).</li><li>Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allotype-specific+immunoregulation+of+autoantibody+production+by+host+B+cells+in+chronic+graft-versus+host+disease.">Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease.</a> J Immunol. 144 (3), 916-922 (1990).</li><li>Choudhury, A., Cohen, P. L., Eisenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+require+&#8220;nurturing&#8221;+by+CD4+T+cells+during+development+in+order+to+respond+in+chronic+graft-versus-host+model+of+systemic+lupus+erythematosus.">B cells require &#8220;nurturing&#8221; by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus.</a> Clin Immunol. 136 (1), 105-115 (2010).</li><li>Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humoral+immunity+due+to+long-lived+plasma+cells.">Humoral immunity due to long-lived plasma cells.</a> Immunity. 8 (3), 363-372 (1998).</li></ol>

The authors have nothing to disclose.

המודל מושרה bm12 הוא דרך קלה יחסית ויעילה ללמוד את התהליכים התאיים ומולקולריים של SLE. הפעלה כרונית של תאי CD4 T הועברו adoptively המכוון נגד אנטיגנים עצמיים מובילה להצטברות של TFH, GC תאי B, ותאי פלזמה אשר ניתן למדוד על ידי cytometry זרימה, כפי שתואר כאן. מחקרים עתידיים באמצעות מודל זה יכול לחקור את התפקיד של גני מועמדים וטיפולים חדשניים בתהליכי המרכז נבטי אוטואימוניות שדומות לאלו המתרחשים בחולים עם SLE, וסופו של דבר קובעים את ההצטברות פתולוגית של נוגדנים עצמיים במהירות ובקלות. יתר על כן, ניתוח התזרים cytometric המתואר כאן יכול לשמש כדי לחקור מודלים עכבר נוספים שכרוכים בפיתוח של נוגדנים כוללים, אך לא מוגבל לאוטואימוניות, זיהום, ואלרגיה. כמו כל המודלים של בעלי החיים למחלות אנושיות, מודל זה יש גם המגבלות שלה. בהתחשב במהירות שבה devel המחלהוops גודלה, לא כל המעורבים בפיתוח של SLE גנים עשויים להיות נחוצים לפתוגניות במודל זה. בנוסף, יש להקפיד על מנת לשלול דחיית שתל נתונים כאשר מציעים הרחבה מינימאלית של TFH במקבלים מהונדסים גנטי. יש להשתמש בסמני Congenic כדי לאשר את קיומם של תאי תורם בקציר במיוחד מאז תאי נמען יכולים גם להתמיין TFH (איור 3), שעלולים להסוות את היעדרם של תאי תורם. שימוש בסמני congenic, צפינו חיסול של תאי תורם שכנראה טיפחו אנטיגנים דחייה ביום 14 (איור 6) שלם. אנחנו השתמשנו בהצלחה CD45.1 + וbm12 CD45.2 + bm12 עכברים כתורמים, וCD45.1 + BoyJ (B6.SJL- Ptprc Pepc b / BoyJ) וCD45.2 + C57BL / 6 עכברים כמקבלים (איורים 3, 6, 7, ונתונים שלא פורסמו). עם זאת, congenic סוג ברCD90.1 + תאים מB6.PL- Thy1 זן העכבר / CyJ לא להשתיל גם, ולא לעשות CD90.2 + bm12 תאי שתל גם בCD90.1 + נמען (נתונים שלא פורסמו), תופעה שהיא כנראה לא ייחודי למודל זה 26. כך או C57BL / 6 או bm12 עכברים יכולים לשמש כתורם או הנמען, כמו בתחילה דווח על ידי אח מוריס אל. 9 עם זאת, במעבדה שלנו אנו מוצאים את ההעברה של תאי bm12 לעכברים B6 מייצרת הרחבת תא T ו- B תא עקבית יותר אוכלוסיות ביום 14. יתר על כן, תורם והמקבל עכברים מקבוצות שונות צריכים להיות מגדר וגיל בהתאמה. למרות שניסויים שדווחו בתיאור הראשון של המודל bm12 לא מצאו הבדל משמעותי בכל פרמטר מחלה בין הגברים → הזכר ונקבה העברות → נקבת 9, העברות נקבת → זכר לא מומלצת, כאנטיגן זכר (HY) באו לידי ביטוי בתאי CD4 T הועברו עשוי לגרום לreje שתלction במקבלי נקבה 27. בעת בחירת נוגדנים וfluorochromes לסמני congenic, יש לציין כי תאי תורם הפכו חיוביים עבור סמן congenic נמען בדרגות שונות, כך שCD45.2 - השער לא מהווים כל CD45.1 + שתל. התופעה באה לידי ביטוי באופן ברור השוואת ביטוי CD45.2 ידי CD45.1 + נאיבי, CD45.1 + תורם, וCD45.2 + נמען תאי CD4 T (איור 7). יש לציין, נראים תאי תורם גם לupregulate ביטוי של סמן congenic שלהם, בהשוואה לקבוצת ביקורת נאיבית (איור 7). תוצאות דומות נראות גם עם CD45.2 + bm12 העברה לעכברים CD45.1 + BoyJ (מידע לא מוצג). יש להניח, רכישה של תוצאות CD45 הנמען מtrogocytosis 28 על ידי תאי CD4 T מופעלים הבאה חזרו אינטראקציות עם תאי B הנמען. למעשה, המצב bm12l עשוי להוכיח כלי שימושי בלימוד התהליך של trogocytosis in vivo. <img alt="איור 7" src="/files/ftp_upload/53319/53319fig7.jpg" /> איור 7. תאי תורם לרכוש נמען CD45 סמן congenic. CD45.1 + bm12 ימפוציטים הועברו לCD45.2 + C57BL / 6 נמענים. תורם, נמען, ונאיבי (+ CD45.1) תאי CD4 T מוערכים לCD45.1 וביטוי CD45.2 14 ימים לאחר ההעברה. <a href="https://www.jove.com/files/ftp_upload/53319/53319fig7large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> הוכח כי ההעברה של תאי CD4 T bm12 מטוהרים לC57BL עכברים / 7 היא מספיק כדי ליזום מחלה 29; עם זאת, מחלה שווה ערך מתפתחת כאשר כל ימפוציטים מועברים, והטיהור אינה נדרשת בהכרח ללמוד תלות מחלה על לסה&quot;נ TLL-פנימי ביטוי גנים. אייזנברג ועמיתים, בבירור שהתא מייצר נוגדנים במודל bm12 הוא כמעט אך ורק ממוצא נמען 30. יתר על כן, הדרישה לנמען CD4 T תאים 10 מוגבלת ל&#39;הטיפוח &#39;של תאי B במהלך התפתחותם, שיכול להיות על ידי התוספת של IL-4 אקסוגני 31-יצא לדרך, הנתונים שלנו מצביעים אף נמען שתאי T יכולים להשתתף במידה מסוימת בתגובת המרכז נבטי, כחלק מהם לעשות לפתח פנוטיפ TFH (איור 3, ימני תחתון). החלטה קריטית אחת שחייב להיעשות עבור כל ניסוי bm12 היא כאשר למסוק רקמות לניתוחים. כמובן ההחלטה תלויה בדיוק מה גורמים חשובים למחקר הנוכחי, אשר עשוי להשתנות. הניסויים שתוארו כאן לקחת עד 14 ימים, כפי שהם מתמקדים בפיתוח הראשוני של תאי TFH ותאי פלזמה; עם זאת, מאז מודל זה הוא כרונימודל GVHD של SLE, מחלה יכולה להיות במעקב ארוך הרבה יותר. למעשה, תכונות מסוימות קליניות של SLE, כוללים גלומרולונפריטיס, לפתח מאוחר יותר. פרוטאינוריה זוהתה מוקדם ככל 2 שבועות לאחר הזרקה, אך מגיעה לרמות שיא ב4-8 שבועות לאחר הזרקה 10,31. בנוסף, תזרים cytometric ניתוחים שתואר כאן כבר מותאם לניסויים שנמשכים 2 שבועות. אנו מוצאים מספר לא מבוטל של GC תאי B ותאי פלזמה בנקודה זו בזמן; למרות, נתן זמן נוסף, אחוז גדול של תאי פלזמה ANA-מפריש עשוי להימצא במח העצם 32. יתר על כן, תאי הפלזמה זוהו על ידי פנל צביעת זרימה זה סביר כוללים גם plasmablasts-מנת להבחין בין שני סוגים אלה תא, נוגדנים נוספים יידרשו. הרחבת TFH כנראה מגיעה לשיא בשלב מסוים אחרי החלון של 14 היום שבו אנו מתמקדים. עם זאת, למיטב ידיעתנו, אין מחקרים דיווחו bm12 מספר תא תורם מעבר 2 שבועות, או שימושסמני congenic ד לעקוב אחר תאים הועברו adoptively.

זאבת אדמנתית מערכתית (לופוס) היא מחלה אוטואימונית מורכבת המאופיינת prototypically על ידי נוגדן אנטי-גרעיני ייצור (ANA) וגלומרולונפריטיס. סיבוכים רבים אחרים, כוללים עורי, לב-ריאה, ונגעים בכבד קשורים למחלה אצל אנשים מסוימים. הערכות שכיחות בארה&quot;ב משתנות במידה רבה, מ150,000-1,500,000 1,2, עם שכיחות גבוהה במיוחד בנשים ומיעוטים 3. למרות אטיולוגיה של SLE כבר קשה להבחין, הוא חשב שינבע ממשחק הגומלין של גורמים גנטיים וסביבתיים שונים, שיגיעו לשיאו באוטואימוניות המערכתית. מודלים של בעלי חיים רבים כבר מועסקים ללמוד גורמים מובילים להופעת מחלה והתקדמות. מודלים עכבר קלאסיים של SLE כוללים זני נטייה גנטית עכבר כוללים NZB x מודל NZW F1 ונגזרי NZM, המתח / LPR הקה&quot;ע, ומתח BXSB / Yaa, ומערכות מושרה, כגון pristane ודגמי מחלת שתל נגד המארח כרוני (cGVHD) 4. דיווחים מוקדמים של ייצור נוגדנים בדגמי GVHD משמשים זנים שונים עכבר או זני אוגר להורה להעברות F1 5 - 8; שיטות נפוצות יותר בשימוש ללמוד מחלה כמו זאבת-כיום כוללות הורה DBA / 2 → (DBA / 2 x C57BL / 6) F1, ומודל העברת bm12 המתואר כאן. לכל אחד יש מודל האזהרות שלה, אבל הם בדרך כלל לשתף מערך משותף של תכונות המתואמים עם מאפיינים קליניים של מחלה אנושית. הפרמטרים לרוב דיווחו במודלים של עכברים כוללים splenomegaly, בלוטות הלימפה, דלקת כליות, ייצור ANA, וברמה התאית, ההתרחבות של תאי T זקיקי עוזר (TFH), תאי B נבטי מרכז (GC), ותאי פלזמה. מודל bm12 מושרה מושגת על ידי העברת המאמצת של לימפוציטים מIA bm12 B6 (C) - H2 - עכברים (bm12) AB1 bm12 / KhEgJ, מתח אניdentical לC57BL / 6 למעט 3 החלפות חומצת אמינו בכיתת MHC II, לIA ב C57BL / 6 עכברים (B6). Alloactivation של תורם CD4 T תאים על ידי נמען נגמ&quot;שים מוביל לcGVHD עם תסמינים דומים SLE מקרוב. באופן ספציפי, אלה כוללים הרחבת TFH תורם נגזרות, התרחבות של תאי שמקורם נמען GC B ותאי פלזמה, וייצור של אנאס כולל אנטי-dsDNA, אנטי-ssDNA, אנטי-הכרומטין, ונוגדנים נגד RBC 9. לאורך זמן, עכברי נמען לפתח גלומרולונפריטיס הקשורים פיקדונות IgG בגלומרולרי, ביניים, ואזורים של כלי דם של הכליות 10. הראינו לאחרונה כי, בדומה למחלות של בני אדם, יש גם תפקיד קריטי עבור סוג אני IFN במודל זה 11. יש לציין, הקריטריונים המגדירים עבור SLE האנושי כוללים את הפיתוח של דלקת כליות תואמות עם SLE בנוכחות נוגדנים נגד dsDNA 12, שניהם מאפיינים בולטים של מודל עכבר זה. יש seיתרונות veral של מודל bm12 על המודלים ספונטניים. מודלים קלאסיים שלפתח סימנים כמו SLE-ספונטני להסתמך על שני זנים היברידיים עכבר, זנים טהורים עכבר לא על רקע B6, או לוקוסים גנטיים גדולים על רקע B6, שהופכים את מעבר לפצצה או עכברים מהונדסים גנטי אחר קשה זמן רב. עם המודל מושרה bm12, עכברים מהונדסים גנטי יכולים לשמש גם תורם או נמען, המאפשרים זיהוי מהיר יותר של התא הסלולרי שבגנים מסוימים עשויים להיות חשובים למחלה. יתר על כן, התפתחות מחלה במודל bm12 היא הרבה יותר מהר, הדורש רק 2 שבועות עד להופעת אנאס, בהשוואה למספר חודשים לדגמים ספונטניים ביותר. יתר על כן, בניגוד לדגמים ספונטניים שמתפתחים מחלה בנקודות זמן שונה, תחילת המחלה וההתקדמות במודל B6 → bm12 מסונכרנת מאוד. זה מאפשר לדור של קבוצות בגודל המתאימה שיכולות בהדואר משמש לאסטרטגיות התערבותית או טיפוליות בכל שלב של התפתחות מחלה. להלן פרוטוקול מפורט לייזום אוטואימוניות כמו SLE-ידי העברת המאמצת של לימפוציטים bm12 לעכברי C57BL / 6, או וריאנטים גנטיים על רקע B6. בנוסף, אנו מתארים פרוטוקול מכתים הזרימה cytometric לספירת TFH, GC תאי B, וסוגי תאי פלזמה תאים הקשורים למחלות אנושיות. חשוב לציין, יכולים לשמש גם פרוטוקולים אלה לאפיין מחלה ברוב דגמי עכבר של SLE ולזהות TFH, GC תאי B ותאי פלזמה בדגמי מחלה אחרים.

<table border="0">
	<tbody>
		<tr>
			<td>B6.SJL-Ptprca Pepcb/BoyJ</td>
			<td>The Jackson Laboratory</td>
			<td>001162</td>
			<td>CD45.1+ BoyJ mouse strain</td>
		</tr>
		<tr>
			<td>B6(C)-H2-Ab1bm12/KhEgJ</td>
			<td>The Jackson Laboratory</td>
			<td>001162</td>
			<td>Bm12 mouse strain</td>
		</tr>
		<tr>
			<td>FastDigest PsuI</td>
			<td>Life Technologies</td>
			<td>FD1554</td>
			<td>Restriction digest enzyme for genotyping</td>
		</tr>
		<tr>
			<td>1X RBC Lysis Buffer</td>
			<td>eBioscience</td>
			<td>00-4333-57</td>
			<td></td>
		</tr>
		<tr>
			<td>IMDM</td>
			<td>GE Healthcare</td>
			<td>SH30228.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasma Separation Tube (PST)</td>
			<td>BD</td>
			<td>365974</td>
			<td>Blood collection tube with Dipotassium EDTA</td>
		</tr>
		<tr>
			<td>Serum Separation Tube (SST)</td>
			<td>BD</td>
			<td>365967</td>
			<td>Blood collection tube with Clot activator / SST Gel</td>
		</tr>
		<tr>
			<td>Ficoll</td>
			<td>GE Healthcare</td>
			<td>17-1440-02&#160;</td>
			<td>High density cell separation solution</td>
		</tr>
		<tr>
			<td>Lympholyte-M</td>
			<td>Cedarlane</td>
			<td>CL5030</td>
			<td>High density cell separation solution</td>
		</tr>
		<tr>
			<td>GL-7-biotin</td>
			<td>eBioscience</td>
			<td>13-5902-82&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-BUV395</td>
			<td>BD</td>
			<td>564176</td>
			<td></td>
		</tr>
		<tr>
			<td>CD138-BV421</td>
			<td>BioLegend</td>
			<td>142508</td>
			<td></td>
		</tr>
		<tr>
			<td>CD4-BV510</td>
			<td>BioLegend</td>
			<td>100559</td>
			<td></td>
		</tr>
		<tr>
			<td>TCR&#946;-BV605</td>
			<td>BD</td>
			<td>562840</td>
			<td></td>
		</tr>
		<tr>
			<td>CD45.1-BV711</td>
			<td>BioLegend</td>
			<td>110739</td>
			<td></td>
		</tr>
		<tr>
			<td>CD45.2-FITC</td>
			<td>BioLegend</td>
			<td>109806</td>
			<td></td>
		</tr>
		<tr>
			<td>PD-1-PE</td>
			<td>BioLegend</td>
			<td>135206</td>
			<td></td>
		</tr>
		<tr>
			<td>CD19-PerCP</td>
			<td>BioLegend</td>
			<td>115532</td>
			<td></td>
		</tr>
		<tr>
			<td>Fas-PE-Cy7</td>
			<td>BD</td>
			<td>557653</td>
			<td></td>
		</tr>
		<tr>
			<td>CXCR5-APC</td>
			<td>BioLegend</td>
			<td>145506</td>
			<td></td>
		</tr>
		<tr>
			<td>Fixable Viability Dye ef780</td>
			<td>eBioscience</td>
			<td>65-0865-18</td>
			<td></td>
		</tr>
		<tr>
			<td>CD4-BV421</td>
			<td>BioLegend</td>
			<td>100443</td>
			<td></td>
		</tr>
		<tr>
			<td>1.2 ml FACS tube inserts, racked</td>
			<td>USA Scientific</td>
			<td>1412-1400</td>
			<td></td>
		</tr>
		<tr>
			<td>BD Falcon&#8482; Round-Bottom Tubes</td>
			<td>BD</td>
			<td>352017</td>
			<td></td>
		</tr>
	</tbody>
</table>

the bm12 inducible model of systemic lupus erythematosus (sle) in c57bl/6 mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

עכברים חולים לפתח splenomegaly קטן כמו 14 ימים, מציגים טחולים 2-3 פעמים בגודל של עכברים בריאים במונחים של מסה וcellularity (איור 2). Splenocytes הם מגודרת ברצף על פיזור אור (FSC-ידי SSC-), חיסול כפילויות (FSC-W או -H ידי FSC-A), תאי קיימא (הכתמה נמוכה של צבע כדאיות), וCD4 + TCRβ + (איור 3A). תאי תורם נבדלים מתאי נמען מבוססים על CD45.1 וCD45.2 (איור 3, שמאלי תחתון). תאי תורם בעיקר לאמץ פנוטיפ תא עוזר זקיקי T (TFH), כמאופיינים גברת הביטוי של PD-1, CXCR5, Bcl-6, וICOS (איור 3, C). חלק מאוכלוסיית תא נמען CD4 T גם מבדיל לTFH (איור 3, ימני תחתון). לאחר למות מראשוני ו / או הגירה של תאים הועברו, הרחבת TFH תורם נגזרות היא לוגריתמים, reaching 10-20 מיליון תאים בטחול של עכברים 14 ימים לאחר ההזרקה (איור 3D). CFSE תיוג של לימפוציטים הועבר הוכיח כי תורם תאי CD4 T להתמיין TFH מוקדם לאחר הפעלה; בעצם כל התאים מתחלקים נצפו בימים 3, 7, ו -14 הוגברו CXCR5 וPD-1 (איור 4). פרופילי שיא ההתפשטות גם מצביעים על כך שאחוז נמוך יחסי של תורם תאי CD4 T עבר alloactivation וחטיבה. ביום 14, רוב תאי התורם לגילוי הם אלה שמחולקים מעבר למספר המרבי של חטיבות למדידה על ידי CFSE. הרחבת TFH תורם נגזרות מלווה בהצטברות מקבילה של תאי B GC אנדוגני ותאי פלזמה (איור 5 א). הצטברות של תאי פלזמה בטחול מתעכבת בהשוואה לזו של TFH, שאינה מראה שום עלייה מעל בעלי חיים תמימים בימים 3 או 7 (איור 5). Accordingly, נוגדנים נגד גרעין אינם קלות לזיהוי לפני היום 9 (מידע לא מוצג), אך ניתן לכמת באופן מהימן ביום 14 11. באמצעות השימוש בסמנים congenic, שראינו דחייה של תאי תורם בזנים מרובים. בזמן הזה הוא בעיה נפוצה כאשר עכברים לא מספיק backcrossed לרקע C57BL / 6, שגם נצפו דחייה כאשר תאי bm12 הועברו לעכברים / CyJ (CD90.1) B6.PL- Thy1 שנחשבים בדרך כלל להיות באופן מלא backcrossed. לכן, עכברים מוקרנים באופן שגרתי ביום ~ 3 על ידי דגימות דם זרימה מכתימה להעריך את היעילות של שתל תאי CD4 T הראשוני; אנחנו יודעים מניסויי התפשטות CFSE שמורכבים תאים הרחיבו מעט מאוד בתחילת נקודת זמן זו. תוצאות אלו אז בהשוואה לתוצאות שהתקבלו מקציר יום 14. במקרה דוגמא של דחייה, 30 מ&#39;CD45.1 + bm12 ימפוציטים הועברו לCardif<html> - / - עכברים שהיה backcrossed לעכברי C57BL / 6 במשך 12 דורות. ביום 5, כל העכברים מוצגים השתלה שווה ערך (2-3% במחזור של תאי CD4 T), אבל ביום 14, bm12 תאי תורם בוטלו לחלוטין מהנמען המהונדס הגנטית (איור 6). <img alt="איור 2" src="/files/ftp_upload/53319/53319fig2.jpg" /> קינטיקה צמיחת 2. טחול איור לאחר ההזרקה של לימפוציטים bm12. הטחולים נשקלו על איזון ברמת דיוק גבוה ישירות לאחר כריתה (משמאל). מספרי תא חיים נקבעו על ידי ספירה עם hemocytometer באמצעות trypan הכחול להוציא תאים מתים (מימין). תוצאות מוצגות כממוצע ± SEM, כאשר n = 9, 4, 3, ו -6, בהתאמה. <a href="https://www.jove.com/files/ftp_upload/53319/53319fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> jpg &quot;/&gt; איור 3. ניתוח של הרחבת תא עוזר זקיקי T במודל bm12 של SLE. CD45.1 + bm12 ימפוציטים הועברו לC57BL / 6 המקבלים וטחולים נותחו 14 ימים לאחר מכן. () אסטרטגית gating נציג מראה &quot;לימפוציטים&quot; (פנל ראשון), &quot;תאים בודדים&quot; (פנל שני), &quot;תאי חיים&quot; (פנל שלישי), ו&quot; תאי CD4 T &quot;(פנל הרביעי). תאים (B) תורמים הם מכובדים מנמען CD4 T תאים על ידי CD45.1 וצביעת CD45.2 ונותח לביטוי של PD-1 וCXCR5. תאים תורמים (C) לאמץ פנוטיפ TFH, כפי שצוין על ידי גברת הביטוי של כמה חלבונים נפוצים הקשורים TFH. (ד) תוצאות אופייניות המראות את הרחבת TFH תורם נגזרות (המוגדרת כPD-1 + תאי חיים CXCR5 + CD4 + CD45.1 +) ב 3 ימים, 7, ו -14 שלאחר העברה. תוצאות מתוארותשל ממוצע ± SEM, כאשר n = 5, 4, 3, ו -6, בהתאמה. <a href="https://www.jove.com/files/ftp_upload/53319/53319fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/53319/53319fig4.jpg" /> איור 4. PD-1 וCXCR5 הם שהוגברו על חלוקת תאים. תאי Bm12 תויגו עם CFSE לפני ההזרקה לתוך C57BL / 6 נמענים. זרימת חלקות נציג מוצגות לתורם תאי CD4 T ב 3, 7, ו -14 ימים לאחר ההזרקה. <a href="https://www.jove.com/files/ftp_upload/53319/53319fig4large.jpg" target="_blank">אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/53319/53319fig5.jpg" /> הרחבת איור 5. של תאי פלזמה הטחול וGC תאי B. () זרימת חלקות נציג מטחולי עכבר נאיביים, או אלה מעכברים 14 ימים לאחר CD45.1 + bm12 העברה. תאי פלזמה מוגדרים כתאי חיים נמוכים CD138 + CD19 (לוחות העליונים). GC תאי B הם קבוצת משנה של CD19 + תאי B, המבטאים GL-7 ופאס (לוחות תחתון). נתונים (B) Quantitave מראים את ההצטברות של תאי פלזמה הטחול לאורך זמן. תוצאות מוצגות כממוצע ± SEM, כאשר n = 5, 4, 3, ו -6, בהתאמה. <a href="https://www.jove.com/files/ftp_upload/53319/53319fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 6" src="/files/ftp_upload/53319/53319fig6.jpg" /> שתלי איור 6. Bm12 נדחים על ידי כמה עכברי נמען מהונדסים גנטי. CD45.1 + bm12 ימפוציטים הועברו לאו עכברים מהונדסים גנטי (לוחות העליונים) או / 6 (לוחות תחתון) עכברי נמען C57BL. עכברים דיממו שבלאחר הזרקה 5 ימים והעריכו ליעילות שתל. Splenocyteים מאותו העכברים נותחו 14 ימים לאחר מכן. <a href="https://www.jove.com/files/ftp_upload/53319/53319fig6large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="0" fo:keep-together.within-page="1" style="top-margin: 20px;text-align:right;direction:rtl"><tbody><tr><td> שם פריימר </td><td colspan="2"> רצף (5 &#39;- 3&#39;) </td><td> טמפרטורת חישול </td></tr><tr><td> Bm12F </td><td colspan="2"> CGTGGTCCCCGCTGTCCCCC </td><td rowspan="2"> * 65 מעלות צלזיוס </td></tr><tr><td> Bm12R </td><td colspan="2"> GGGCAGAGGGCAGAGGTGAG </td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td> מגזר </td><td> מספר המחזורים </td><td> טמפרטורה </td><td> משך </td></tr><tr><td> 1 </td><td> 1 </td><td> 95 מעלות צלזיוס </td><td> 2 דקות. </td></tr><tr><td rowspan="3"> 2 </td><td rowspan="3"> 40 </td&gt; <td> 95 מעלות צלזיוס </td><td> 15 שניות. </td></tr><tr><td> * 65-0.5 ° C / צעד </td><td> 15 שניות. </td></tr><tr><td> 72 מעלות צלזיוס </td><td> 45 שניות. </td></tr><tr><td> 3 </td><td> 1 </td><td> 72 מעלות צלזיוס </td><td> 10 דקות. </td></tr></tbody></table> טבלה 1:. תחל ותנאי thermocycling לgenotyping bm12 תנאי thermocycling אופטימליים יהיו תלויים בחומרים הכימיים המדויקים והמכשירים המשמשים. תנאים אלה מותאמים לthermocycler מסוגל לשנות טמפרטורת חישול בכל שלב, אם כי ייתכן שגם הפרוטוקול לעבוד באמצעות חישול בטמפרטורה סטטית. <img alt="טבלה 2" src="/files/ftp_upload/53319/53319table2.jpg" /> טבלה 2:. לוחות נוגדן לTFH הטחול, GC B ותאי פלזמה זיהוי על ידי cytometry זרימת פירוט לוחות השתמשנו בהצלחהלהערכת יעילות שתל ביום 3 (משמאל) והניתוח של תאי T ו- B ביום 14 לאחר הזרקת bm12 תא (באמצע). אלה כבר מותאמים לLSRII עם 5 לייזרים (355, 405, 488, 561, 640 וננומטר). מערכות סינון מומלצים לכל fluorochrome רשומות (מימין), אם כי אלה לא יכולים להיות האפשרות הטובה ביותר עבור כל מכונה. תלוי מה לייזר, PMT, ושילובי מערכת סינון זמינים, הפרדת פנל ניתוח תא T ו- B ללוחות מרובים עשויה להיות נחוצה.

Watch this Scientific Journal Video about The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice at JoVE.com

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

דגם bm12 העין מתנהל של זאבת אדמנתית המערכתית (לופוס) בC57BL עכברים / 6

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

the-bm12-inducible-model-systemic-lupus-erythematosus-sle-c57bl6

Universidad San Sebastian

Research

JoVE Journal

Medicine

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

17.2K Views.  Cincinnati Children's Hospital Medical Center and University of Cincinnati College of Medicine. The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

Video: The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The Spared Nerve Injury (SNI) Model of Induced Mechanical Allodynia in Mice

Peripheral neuropathic pain is a severe chronic pain condition which may result from trauma to sensory nerves in the peripheral nervous system. The spared nerve injury (SNI) model induces symptoms of neuropathic pain such as mechanical allodynia i.e. pain due to tactile stimuli that do not normally provoke a painful response [1]. 
The SNI mouse model involves ligation of two of the three branches of the sciatic nerve (the tibial nerve and the common peroneal nerve), while the sural nerve is left intact [2]. The lesion results in marked hypersensitivity in the lateral area of the paw, which is innervated by the spared sural nerve. The non-operated side of the mouse can be used as a control. The advantages of the SNI model are the robustness of the response and that it doesn&#x2019;t require expert microsurgical skills.
The threshold for mechanical pain response is determined by testing with von Frey filaments of increasing bending force, which are repetitively pressed against the lateral area of the paw [3], [4]. A positive pain reaction is defined as sudden paw withdrawal, flinching and/or paw licking induced by the filament. A positive response in three out of five repetitive stimuli is defined as the pain threshold. 
As demonstrated in the video protocol, C57BL/6 mice experience profound allodynia as early as the day following surgery and maintain this for several weeks.

The Spared Nerve Injury SNI Model of Induced Mechanical Allodynia in Mice

The Spared Nerve Injury animal model is described here as a mouse model of peripheral neuropathic pain following partial denervation of the sciatic nerve by lesioning the tibial and common peroneal nerve branches, leaving the remaining sural nerve intact. Behavioral modification resulting from mechanical allodynia is quantified by von Frey filaments.

פגיעה ניצלו עצב (SNI) דגם Allodynia מכונות המושרה עכברים

Peripheral neuropathic pain is a severe chronic pain condition which may result from trauma to sensory nerves in the peripheral nervous system. The spared ...

The CYP2D6 Animal Model: How to Induce Autoimmune Hepatitis in Mice

Autoimmune hepatitis is a rare but life threatening autoimmune disease of the liver of unknown etiology1,2. In the past many attempts have been made to generate an animal model that reflects the characteristics of the human disease 3-5. However, in various models the induction of disease was rather complex and often hepatitis was only transient3-5. Therefore, we have developed a straightforward mouse model that uses the major human autoantigen in type 2 autoimmune hepatitis (AIH-2), namely hCYP2D6, as a trigger6. Type 1 liver-kidney microsomal antibodies (LKM-1) antibodies recognizing hCYP2D6 are the hallmark of AIH-27,8. Delivery of hCYP2D6 into wildtype FVB or C57BL/6 mice was by an Adenovirus construct (Ad-2D6) that ensures a direct delivery of the triggering antigen to the liver. Thus, the ensuing local inflammation generates a fertile field9 for the subsequent development of autoimmunity. A combination of intravenous and intraperitoneal injection of Ad-2D6 is the most effective route to induce a long-lasting autoimmune damage to the liver (section 1). Here we provide a detailed protocol on how autoimmune liver disease is induced in the CYP2D6 model and how the different aspects of liver damage can be assessed. First, the serum levels of markers indicating hepatocyte destruction, such as aminotransferases, as well as the titers of hCYP2D6 antibodies are determined by sampling blood retroorbitaly (section 2). Second, the hCYP2D6-specific T cell response is characterized by collecting lymphocytes from the spleen and the liver. In order to obtain pure liver lymphocytes, the livers are perfused by PBS via the portal vein (section 3), digested in collagen and purified over a Percoll gradient (section 4). The frequency of hCYP2D6-specific T cells is analyzed by stimulation with hCYP2D6 peptides and identification of IFN&gamma;-producing cells by flow cytometry (section 5). Third, cellular infiltration and fibrosis is determined by immunohistochemistry of liver sections (section 6). Such analysis regimen has to be conducted at several times after initiation of the disease in order to prove the chronic nature of the model. The magnitude of the immune response characterized by the frequency and activity of hCYP2D6-specific T and/or B cells and the degree of the liver damage and fibrosis have to be assessed for a subsequent evaluation of possible treatments to prevent, delay or abrogate the autodestructive process of the liver.

Infection of mice with an Adenovirus expressing the major human autoantigen cytochrome P450 2D6 (hCYP2D6) recognized by sera of patients suffering from type 2 autoimmune hepatitis results in a persistent form of autoimmune-mediated liver disease characterized by extensive hepatitis, fibrosis and generation of a CYP2D6-specific immune response.

CYP2D6 מודל החיה: כיצד לגרום דלקת כבד אוטואימונית עכברים

Autoimmune hepatitis is a rare but life threatening autoimmune disease of the liver of unknown etiology1,2. In the past many attempts have been made to ...

Tibial Nerve Transection - A Standardized Model for Denervation-induced Skeletal Muscle Atrophy in Mice

The tibial nerve transection model is a well-tolerated, validated, and reproducible model of denervation-induced skeletal muscle atrophy in rodents. Although originally developed and used extensively in the rat due to its larger size, the tibial nerve in mice is big enough that it can be easily manipulated with either crush or transection, leaving the peroneal and sural nerve branches of the sciatic nerve intact and thereby preserving their target muscles. Thus, this model offers the advantages of inducing less morbidity and impediment of ambulation than the sciatic nerve transection model and also allows investigators to study the physiologic, cellular and molecular biologic mechanisms regulating the process of muscle atrophy in genetically engineered mice. The tibial nerve supplies the gastrocnemius, soleus and plantaris muscles, so its transection permits the study of denervated skeletal muscle composed of fast twitch type II fibers and/or slow twitch type I fibers. Here we demonstrate the tibial nerve transection model in the C57Black6 mouse. We assess the atrophy of the gastrocnemius muscle, as a representative muscle, at 1, 2, and 4 weeks post-denervation by measuring muscle weights and fiber type specific cross-sectional area on paraffin-embedded histologic sections immunostained for fast twitch myosin.

The tibial nerve transection model is a well-tolerated, validated, and reproducible model of skeletal muscle atrophy. The model surgical protocol is described and demonstrated in C57Black6 mice. &#160;

חיתוך רוחב עצב הטיביאלי - מודל סטנדרטי לניוון שרירים שלד מושרה denervation בעכברים

The tibial nerve transection model is a well-tolerated, validated, and reproducible model of denervation-induced skeletal muscle atrophy in rodents. ...

Assessing Changes in Volatile General Anesthetic Sensitivity of Mice after Local or Systemic Pharmacological Intervention

One desirable endpoint of general anesthesia is the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is less straightforward than it is in human patients. A widely used behavioral surrogate for hypnosis in rodents is the loss of righting reflex (LORR), or the point at which the animal no longer responds to their innate instinct to avoid the vulnerability of dorsal recumbency. We have developed a system to assess LORR in 24 mice simultaneously while carefully controlling for potential confounds, including temperature fluctuations and varying gas flows. These chambers permit reliable assessment of anesthetic sensitivity as measured by latency to return of the righting reflex (RORR) following a fixed anesthetic exposure. Alternatively, using stepwise increases (or decreases) in anesthetic concentration, the chambers also enable determination of a population's sensitivity to induction (or emergence) as measured by EC50 and Hill slope. Finally, the controlled environmental chambers described here can be adapted for a variety of alternative uses, including inhaled delivery of other drugs, toxicology studies, and simultaneous real-time monitoring of vital signs.

Loss of the righting reflex has long served as a standard behavioral surrogate for unconsciousness, also called hypnosis, in laboratory animals. Alterations in volatile anesthetic sensitivity caused by pharmacological interventions can be detected with a carefully controlled high-throughput assessment system, which may be adapted for delivery of any inhaled therapeutic.

הערכת שינויים בנדיפות כללית הרדמה רגישות של עכברים לאחר התערבות תרופתי מקומית או מערכתית

One desirable endpoint of general anesthesia is  the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is  less ...

The Sciatic Nerve Cuffing Model of Neuropathic Pain in Mice

Neuropathic pain arises as a consequence of a lesion or a disease affecting the somatosensory system. This syndrome results from maladaptive changes in injured sensory neurons and along the entire nociceptive pathway within the central nervous system. It is usually chronic and challenging to treat. In order to study neuropathic pain and its treatments, different models have been developed in rodents. These models derive from known etiologies, thus reproducing peripheral nerve injuries, central injuries, and metabolic-, infectious- or chemotherapy-related neuropathies. Murine models of peripheral nerve injury often target the sciatic nerve which is easy to access and allows nociceptive tests on the hind paw. These models rely on a compression and/or a section. Here, the detailed surgery procedure for the &#34;cuff model&#34; of neuropathic pain in mice is described. In this model, a cuff of PE-20 polyethylene tubing of standardized length (2 mm) is unilaterally implanted around the main branch of the sciatic nerve. It induces a long-lasting mechanical allodynia, i.e., a nociceptive response to a normally non-nociceptive stimulus that can be evaluated by using von Frey filaments. Besides the detailed surgery and testing procedures, the interest of this model for the study of neuropathic pain mechanism, for the study of neuropathic pain sensory and anxiodepressive aspects, and for the study of neuropathic pain treatments are also discussed.

Neuropathic pain is a consequence of a lesion or disease affecting the somatosensory system. The &#8220;cuff model&#8221; of neuropathic pain in mice consists of the implantation of a polyethylene cuff around the main branch of the sciatic nerve. Mechanical allodynia is tested using von Frey filaments.

דגם השת עצב איזוק של כאב נוירופתי בעכברים

Neuropathic pain arises as a consequence of a lesion or a disease affecting the somatosensory system. This syndrome results from maladaptive changes in ...

Monitoring of Systemic and Hepatic Hemodynamic Parameters in Mice

The use of mouse models in experimental research is of enormous importance for the study of hepatic physiology and pathophysiological disturbances. However, due to the small size of the mouse, technical details of the intraoperative monitoring procedure suitable for the mouse were rarely described. Previously we have reported a monitoring procedure to obtain hemodynamic parameters for rats. Now, we adapted the procedure to acquire systemic and hepatic hemodynamic parameters in mice, a species ten-fold smaller than rats. This film demonstrates the instrumentation of the animals as well as the data acquisition process needed to assess systemic and hepatic hemodynamics in mice. Vital parameters, including body temperature, respiratory&#160;rate&#160;and heart&#160;rate were recorded throughout the whole procedure. Systemic hemodynamic parameters consist of carotid artery pressure (CAP) and central venous pressure (CVP). Hepatic perfusion parameters include portal vein pressure (PVP), portal flow rate as well as the flow rate of the common hepatic artery (table 1). Instrumentation and data acquisition to record the normal values was completed within 1.5 h. Systemic and hepatic hemodynamic parameters remained within normal ranges during this procedure.
This procedure is challenging but feasible. We have already applied this procedure to assess hepatic hemodynamics in normal mice as well as during 70% partial hepatectomy and in liver lobe clamping experiments. Mean PVP after resection (n= 20), was 11.41&#177;2.94 cmH2O which was significantly higher (P&#60;0.05) than before resection (6.87&#177;2.39 cmH2O). The results of liver lobe clamping experiment indicated that this monitoring procedure is sensitive and suitable for detecting small changes in portal pressure and portal flow rate. In conclusion, this procedure is reliable in the hands of an experienced micro-surgeon but should be limited to experiments where mice are absolutely needed.

This film demonstrates how to acquire systemic and hepatic hemodynamics in mice. The whole monitoring includes acquisition of vital parameters, systemic blood pressure, central venous pressure, common hepatic artery flow rate, and portal vein pressure as well as the portal flow rate in mice.

ניטור של פרמטרים מערכתיים והבדיה המודינמית בעכברים

The use of mouse models in experimental research is of enormous importance for the study of hepatic physiology and pathophysiological disturbances. ...

Utilizing Murine Inducible Telomerase Alleles in the Studies of Tissue Degeneration/Regeneration and Cancer

Telomere dysfunction-induced loss of genome integrity and its associated DNA damage signaling and checkpoint responses are well-established drivers that cause tissue degeneration during ageing. Cancer, with incidence rates greatly increasing with age, is characterized by short telomere lengths and high telomerase activity. To study the roles of telomere dysfunction and telomerase reactivation in ageing and cancer, the protocol shows how to generate two murine inducible telomerase knock-in alleles 4-Hydroxytamoxifen (4-OHT)-inducible TERT-Estrogen Receptor (mTERT-ER) and Lox-Stopper-LoxTERT (LSL-mTERT). The protocol describes the procedures to induce telomere dysfunction and reactivate telomerase activity in mTERT-ER and LSL-mTERT mice in vivo. The representative data show that reactivation of telomerase activity can ameliorate the tissue degenerative phenotypes induced by telomere dysfunction. In order to determine the impact of telomerase reactivation on tumorigenesis, we generated prostate tumor model G4 PB-Cre4 PtenL/L p53L/L LSL-mTERTL/L and thymic T-cell lymphoma model G4 Atm-/- mTERTER/ER. The representative data show that telomerase reactivation in the backdrop of genomic instability induced by telomere dysfunction can greatly enhance tumorigenesis. The protocol also describes the procedures used to isolate neural stem cells (NSCs) from mTERT-ER and LSL-mTERT mice and reactivate telomerase activity in NSCs in vitro. The representative data show that reactivation of telomerase can enhance the self-renewal capability and neurogenesis in vitro. Finally, the protocol describes the procedures for performing telomere FISH (Fluorescence In Situ Hybridization) on both mouse FFPE (Formalin Fixed and Paraffin Embedded) brain tissues and metaphase chromosomes of cultured cells.

Telomere and telomerase play essential roles in ageing and tumorigenesis. The goal of this protocol is to show how to generate two murine inducible telomerase knock-in alleles and how to utilize them in the studies of tissue degeneration/regeneration and cancer.

ניצול Murine עין מתנהל הטלומרז אללים במחקרים של ניוון רקמה / התחדשות והסרטן

Telomere dysfunction-induced loss of genome integrity and its associated DNA damage signaling and checkpoint responses are well-established drivers that ...

Induction of Accelerated Atherosclerosis in Mice: The "Wire-Injury" Model

Atherosclerosis is a proliferative fibro-inflammatory disease developing in the arterial wall, inducing a deficient blood flow or a lack of blood flow. Moreover, by rupture of the defective vascular wall, atherosclerosis induces occlusive thrombus formation, which represents the main cause of myocardial infarction or stroke and the most frequent cause of death. Despite the advances in the cardiovascular field, many questions remain unanswered, and additional basic research is essential to improve our understanding of the molecular mechanisms during atherosclerosis and its effects. Due to limited clinical studies, there is a need for representative animal models recreating atherosclerotic conditions such as neointima formation after stent implantation, balloon angioplasty, or endarterectomy. Since the mouse presents many advantages and is the most frequently used model for studying molecular processes, the current study proposes an invasive procedure of endothelial denudation, also known as the wire-injury model, which is representative of the human condition of neointima formation in arteries after revascularization procedures.

Induction of Accelerated Atherosclerosis in Mice: The &quot;Wire-Injury&quot; Model

This study describes an invasive procedure for the induction of accelerated atherosclerosis in mice. In comparison to other methods using electric- or cryo-induced injury, mechanical-induced injury mimics the human condition of restenosis after revascularization therapies and is ideal for the study of the molecular mechanisms involved.

אינדוקציה של טרשת עורקים מואצת בעכברים: מודל "פגיעת חוט"

Atherosclerosis is a proliferative fibro-inflammatory disease developing in the arterial wall, inducing a deficient blood flow or a lack of blood flow. ...

The Pilocarpine Model of Temporal Lobe Epilepsy and EEG Monitoring Using Radiotelemetry System in Mice

Temporal lobe epilepsy (TLE) is a common neurological disorder in adulthood. For translational studies of chronic epilepsy, pilocarpine-induced status epilepticus (SE) is frequently selected to recapitulate spontaneous recurrent seizures (SRS). Here we present a protocol of SE induction by intraperitoneal (i.p.) injection of pilocarpine and monitoring of chronic recurring seizures in live animals using a wireless telemetry video and electroencephalogram (EEG) system. We demonstrated notable behavioral changes that need attention after pilocarpine injection and their correlation with hippocampal neuronal loss at 7 days and 6 weeks post-pilocarpine. We also describe the experimental procedures of electrode implantation for video and EEG recording, and analysis of the frequency and duration of chronic recurrent seizures. Finally, we discuss the possible reasons why the expected results are not achieved in each case. This provides a basic overview of modeling chronic epilepsy in mice and guidelines for troubleshooting. We believe this protocol can serve as a baseline for suitable models of chronic epilepsy and epileptogenesis.

This manuscript describes a method of inducing status epilepticus by systemic pilocarpine injection and of monitoring spontaneous recurrent seizures in live animals using a wireless telemetry video and electroencephalogram system. This protocol can be utilized for studying the pathophysiologic mechanisms of chronic epilepsy, epileptogenesis, and acute seizures.

המודל פילוקרפין של אפילפסיה של אונה רקתית EEG ניטור באמצעות מערכת Radiotelemetry בעכברים

Temporal lobe epilepsy (TLE) is a common neurological disorder in adulthood. For translational studies of chronic epilepsy, pilocarpine-induced status ...

Murine Distal Colostomy, A Novel Model of Diversion Colitis in C57BL/6 Mice

Diversion colitis (DC) is a frequent clinical condition occurring in patients with bowel segments excluded from the fecal stream as a result of a diverting enterostomy. The etiology of this disease remains ill-defined but appears to differ from that of classical inflammatory bowel diseases such as Crohn's disease and ulcerative colitis. Research aimed to decipher the pathophysiological mechanisms leading to the development of this disease has been severely hampered by the lack of an appropriate murine model. This protocol generates a murine model of DC that facilitates the study of the immune system's role and its interaction with the microbiome in the development of DC. In this model using C57BL/6 animals, distal parts of the colon are excluded from the fecal stream by creating a distal colostomy, triggering the development of mild to moderate inflammation in the excluded bowel segments and reproducing the hallmark lesions of human DC with a moderate systemic inflammatory response. In contrast to the rat model, a large number of genetically-modified murine models on the C57BL/6 background are available. The combination of these animals with our model allows the potential roles of individual cytokines, chemokines, or receptors of bioactive molecules (e.g., interleukin (IL)-17; IL-10, chemokine CXCL13, chemokine receptors CXCR5 and CCR7, and the sphingosine-1-phosphate receptor 4) to be assessed in the pathogenesis of DC. The availability of congenic mouse strains on the C57BL/6 background largely facilitates transfer experiments to establish the roles of distinct cell types involved in the etiology of DC. Finally, the model offers the opportunity to assess the influences of local interventions (e.g., modification of the local microbiome or local anti-inflammatory therapy) on mucosal immunity in affected and non-affected bowel segments and the on systemic immune homeostasis.

Murine distal colostomy provides a murine model for human diversion colitis, a predominantly lymphocytic colitis in colon segment excluded from the fecal stream.