אנו מודים נ דין למתן את רצף FP mCherry המקורי, מ &#39;Gerami-נג&#39;אד לבנייה של פלסמידים, ב לארסון לקבלת סיוע טכני, וט Heisel עבור עצות מועילות במהלך הפיתוח של הפרויקט הזה. JB נתמכה על ידי בפרס מתקדם המועצה האירופית למחקר 340,087 (RAPLODAPT). מערכות מיקרוסקופיה הדמיה נמסרו על ידי אוניברסיטת קרן Pediatrics מינסוטה ואוניברסיטת מרכז הדמיה מינסוטה.

1. פלסמידים תבנית לבודד מן החיידק <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לגדול החיידק המכיל את הפלסמיד תבנית לילה 10 מ&quot;ל lysogeny מרק (LB) + 200 מ&quot;ג / L אמפיצילין (AMP) על 37 מעלות צלזיוס עם רעד. </li><li style=";text-align:right;direction:rtl"> קציר תאים על ידי צנטריפוגה ב 6000 XG במשך 2 דקות. </li><li style=";text-align:right;direction:rtl"> למזוג נוזל, לבודד ולטהר דנ&quot;א E. coli תא על ידי שיטה סטנדרטית כפי שתואר לעיל Ausubel et al. 8. </li><li style=";text-align:right;direction:rtl"> Resuspend DNA טריס-EDTA (TE; 10 מ&quot;מ טריס, pH 8.0, 1 mM EDTA, pH 8.0) בריכוז העבודה של 50-100 ng / ml. </li></ol> 2. Primers עיצוב <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td fo:width="0.5in" style="width:50px"> תֶחֶל </td><td> רצף פריימר </td></tr><tr><td> F1 </td><td> 5 &#39; <strong&gt; GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTTCTAAAGGTGAAGAATTATT 3 &#39; </td></tr><tr><td> R1 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC GTAAAACGACGGCCAGTGAATTC 3 &#39; </td></tr><tr><td> F2 </td><td> 5 &#39;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3 &#39; </td></tr><tr><td> R2 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC ACTGGATGGCGGCGTTAGTATC 3 &#39; </td></tr></tbody></table> טבלה 1: רצפים פריימר השתמשו במחקר זה. טקסט נטוי מודגש מציין הומולוגיה אל מוקד ENO1 גנומית, אזורי גופן נורמלים הם הומולוגיים פלסמיד דנ&quot;א. <ol style=";text-align:right;direction:rtl"> &lt;li&gt; פריימרים עיצוב להיות הומולוגיים פלסמיד רצפים הגובלים קלטת להיות מוגבר וכן 3&#39;-end של הגן היעד של עניין (למשל ENO1) כדי להקל על רקומבינציה לתוך מוקד הגנומי של הגן (איור 2 ולוח 1) . <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ודא כי הרצפים פריימר קדימה להתאים 70 זוגות הבסיסים האחרונים (נ&quot;ב) של הגן של עניין, 5&#39;- 3 &#39;, מינוס קודון העצירה, כדי לשמור על מסגרת הקידוד, בתוספת BP כ -30 הראשונים של רצף פלסמיד להיות מוגבר. בתור הערה, את GGTGGTGGTT בכל פריימר הוא מקשר גליצין-פולי ללא הומולוגיה FP. מן ראוי לציין כי, בהעדר מקשר, לא יכול להיות היתוך ישיר של תחומים פונקציונליים, אשר באופן תיאורטי יכול להוביל misfolding חלבון, תשואה נמוכה בייצור חלבון, או את פעילות ביולוגית של לקוי. </li><li style=";text-align:right;direction:rtl"> ודא כי הרצפים פריימר ההפוכים הם 70 נ&quot;ב רק במורד זרם של גן, 3&#39;- 5 &#39;, לא כולל כל רצף גן, בתוספת appro האחרוןximately 30 נ&quot;ב של הסמן התזונתי או סמי התנגדות המשמש את הפלסמיד. </li><li style=";text-align:right;direction:rtl"> השתמש F1 ו- R1 כדי ליצור GFP- NAT1 ו YFP- NAT1 קלטות עם pMG2120 ו pMG2263, בהתאמה ו F2 ו R2 כדי ליצור mCherry- NAT1 עם pMG2343. </li></ol></li></ol> 3. צור FP קלטות ידי PCR (יום 1) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> כן ריאגנטים עבור PCR. הכן תערובת מאסטר (500 נפח סופי μl) על ידי הוספת כמויות וריכוזים הבאים אל צינור 1.5 מ&quot;ל: 50 μl חיץ PCR (אשלגן כלורי 500 מ&quot;מ, 100 מ&quot;מ טריס pH 8.0 במים), 20 deoxynucleotides μl (dNTPs; תערובת המניות של נוקלאוטידים ב- 10 מ&quot;מ כל אחד), 40 מגנזיום כלוריד μl 25 מ&quot;מ, 20 μl מטוהרים פלסמיד (מ ~ 50-100 ng / פתרון מניות μl), 10 μl כל קדימה לאחור תחל (מ -10 פתרונות מניות מ&quot;מ), 30 תקי μl פולימראז (גנריות, 5,000 יחידות / מ&quot;ל), ו 320 מים μl. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Aliquot 50 μl של תמהיל מאסטר לתוך כל אחד 10 PCR-compatible 0.5 מ&quot;ל צינורות. </li></ol></li><li style=";text-align:right;direction:rtl"> מניחים צינורות PCR ב thermocycler ולהפעיל את השלבים הבאים: 1 מחזור של 5 דק &#39;ב 94 ° C עד לפגל dsDNA; 40 מחזורים ברצף של 45 שניות על 94 מעלות צלזיוס, 30 שניות על 55 מעלות צלזיוס, כדי לאפשר פריימרים כדי לחשל את תבנית ה- DNA פלסמיד, ו -4 דקות ב 68 מעלות צלזיוס למשך הארכת מוצרי DNA; ו 1 מחזור רחב סופי של 15 דקות ב 72 מעלות צלזיוס. הערה: מיקס מאסטר PCR ופרמטרים אופניים ייתכן שיהיה צורך לשנות מבוסס על פולימראז תקי מסוים בשימוש. </li><li style=";text-align:right;direction:rtl"> ברכה כל המוצרים מ -10 תגובות PCR צינור 1.5 מיליליטר. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> נושא 5 μl של מוצר ה- PCR נקווה כדי ג&#39;ל אלקטרופורזה agarose לאמת גודל amplicon ולקבל אומדן של ריכוז המוצר, המבוסס על השוואה סולם DNA. באופן כללי, השתמשו ~ 250 מיקרוגרם של ה- DNA קלטת בכל תמהיל שינוי שלאחר מכן. </li><li style=";text-align:right;direction:rtl"> המשקע DNA על ידי הוספת 50 μl 3 נתרן אצטט M ואחריו 750 μl 95% אתנול למוצרים דגירה לפחות 30 דק &#39;ב -20 ° C. </li><li style=";text-align:right;direction:rtl"> קציר את מוצרי ה- PCR על ידי צנטריפוגה את הצינור ב XG 16,000 למשך 10 דקות. מוציאים בזהירות וזורקים supernatant ומייבשים גלולה לילה. Resuspend גלולה קלטת DNA מיובש 40 μl TE pH 8.0 ולאחסן בטמפרטורת החדר עד לשימוש. </li></ol></li></ol> 4. משני תאי קנדידה עם FP DNA קלטות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ביום 1, לשחזר זן שמרים להפוך ממורי גליצרול 15% קפוא (-80 ° C) מניות על ידי מפוספס על כמה גבישים מגורדים על דקסטרוז שמרים peptone עם אדנין (YPAD) אגרתי לדגור על 30 מעלות צלזיוס. לאחר ההתאוששות של צמיחת מושבה, לחסן מושבה אחת לתוך מדיום YPAD נוזל 2 מיליליטר צינור תרבות זכוכית עם מכסה לנשימת דגירת הלילה בשעת 30 ° C עם תסיסה. </li><li style=";text-align:right;direction:rtl"> ביום 2, לדלל 300 μl של תרבית שמרים הלילה לתוך 50 מ&quot;ל YPAD טריים (עד OD הסופי 600 של ~ 0.2) בבקבוק Erlenmeyer 125 מ&quot;ל עם מכסה לנשימה. לנער על 30 מעלות צלזיוסעבור ~ 3 שעות (עד OD הסופי 600 ~ 0.6-0.8). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> יוצקים את תרבות הלילה לתוך צינור חרוטי 50 מ&quot;ל ו גלולה התאים על ידי ספינינג במשך 5 דקות ב 1 XG 500 בצנטריפוגה בראש הטבלה. </li><li style=";text-align:right;direction:rtl"> יוצקים מעל כראוי וזורקים supernatant. Resuspend התא גלולה במים מ&quot;ל 5. Re-גלולת התאים על ידי צנטריפוגה שוב במשך 5 דקות ב 1500 XG בצנטריפוגה בראש הטבלה. </li><li style=";text-align:right;direction:rtl"> יוצקים מעל כראוי וזורקים supernatant. Resuspend התאים 500 μl TELiAc (אצטט ליתיום TE: 10 מ&quot;מ טריס, pH 8.0, 1 mM EDTA, pH 8.0, 0.1 מ &#39;אצטט ליתיום) בעת העברת לצינור 1.5 מ&quot;ל. צנטריפוגה הצינור במשך 2 דקות ב 3000 XG ב microcentrifuge. </li><li style=";text-align:right;direction:rtl"> תאים Resuspend ב 250 TELiAc μl. ההיקף הכולל כולל הגלולה צריך להיות ~ 300 μl. </li></ol></li><li style=";text-align:right;direction:rtl"> כדי נקי (שפופרת microfuge שונה מאשר 4.2.4), להוסיף 5 DNA המוביל μl (10 מ&quot;ג / מ&quot;ל) ו -150 μl של תאים מוכנים קנדידה (מ 4.2.4). זהו בקרה שלילית עבור transformation. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לצינור microfuge השני נקי, להוסיף 5 μl של ה- DNA המוביל מפוגל (כי כבר מבושל על 90 מעלות צלזיוס למשך 10 דקות ו מקורר 4 ° C), כל 40 μl של מוצר ה- PCR מוכן (מ 3.3.1) ו -150 μl של תאי קנדידה מוכנים (מ 4.2.4). </li><li style=";text-align:right;direction:rtl"> דגירה תערובות טרנספורמציה שני למשך 30 דקות בטמפרטורת החדר. </li><li style=";text-align:right;direction:rtl"> צינור אחד לערבב טרנספורמציה, להוסיף 700 תמהיל צלחת μl (10 מ&quot;מ טריס, pH 8.0, 1 mM EDTA, pH 8.0, 0.1 מ &#39;אצטט ליתיום פוליאתילן גליקול 50% 3350). להפוך את הצינורות כדי לערבב דגירה אותם בן לילה ב RT. </li></ol></li><li style=";text-align:right;direction:rtl"> ביום 3, דגירה טרנספורמציה מתערבב על 42 מעלות צלזיוס במשך שעה 1. (הלם חום). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> צנטריפוגה טרנספורמציה מתערבב במשך 30 שניות XG 16,000 ב microcentrifuge. הסר כראוי וזורקים supernatant. Resuspend כל של כדורי תא מים 150 μl ידי pipetting בעדינות מעלה ומטה כדי שלא לגרום נזק לתאים. </li><li style=";text-align:right;direction:rtl"> עבור טרנספורמציות utilizing גנים סמן auxotrophic (למשל URA3), צלחת כל התערובת כולה על ידי pipetting הפתרונות על אגר התקשורת סלקטיבית המתאימה (uridine למשל חסר) ולהפיץ את התערובת באופן שווה באמצעות חרוזי זכוכית סטרילית. </li><li style=";text-align:right;direction:rtl"> עבור טרנספורמציות ניצול גן סמן התנגדות nourseothricin (NAT1), כפי שמתואר כאן, שינוי צלחת המערבב הראשון על אגרת YPAD הלא סלקטיבי לדגור על 30 מעלות צלזיוס למשך 6-12 שעות. עזרי צעד זה ב התאוששות תא, הלם חום פוסט, לפני nourseothricin לחץ מוחל. </li><li style=";text-align:right;direction:rtl"> לאחר התאוששות הצמיחה חלקית, צלחת העתק התאים קנדידה על YPAD המכיל 400 מיקרוגרם / מ&quot;ל nourseothricin. עבור טרנספורמציות ניצול גנים סמן תזונתיים (למשל URA3), צעד ציפוי ביניים זו אינה נחוצה ותאי יכול להיות מצופה ישירות על גבי מדיה שמרים סלקטיבית (uridine למשל YPAD חסר) כמתואר 4.4.2. הערה: אם השינוי הוא מוצלח, colonies אמור להופיע, בתוך שלושה ימים (פוטנציאל עד חמישה ימים של תולדה לבחירה על אגרת nourseothricin המכיל). אין מושבות אמורות להופיע על צלחות להתפשט עם תערובות טרנספורמציה המכילות מוביל DNA לבד (שליטה שלילית). </li></ol></li><li style=";text-align:right;direction:rtl"> לבחירת סמן auxotrophic ו nourseothricin, transformants המשוערת פס כמו מושבות אחת צלחות אגרו תקשורת סלקטיבית טריות לדגור על 30 מעלות צלזיוס כדי להפיץ תאים שמרים כי יכול להיות מוקרן לבנייה מוצלחת של התכת FP. </li><li style=";text-align:right;direction:rtl"> Transformants מסך לשילוב נכון של קלטת תיוג (ראה נציג תוצאות עבור דוגמה מפורטת). אם הגן של עניין מתבטא בסכומים מספיק, הקרינה המושבה כולה עלולה להתרחש כך אפשר לזהות integrants מועמד פוטנציאלי באמצעות מערכת הדמיה צלחת עם יכולת גילוי הקרינה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בדוק integrants המשוערת על ידי PCR באמצעות הומולוגיים פריימרים רצפים outsidדואר של האזור של אינטגרציה לאשר היתוך גן היעד. </li><li style=";text-align:right;direction:rtl"> בנוסף, שקול ניתוח כתם המערבי על מנת לקבוע את הביטוי וגודל של החלבון היתוך, כמו גם על ידי מיקרוסקופ פלואורסצנטי של תאים בודדים עבור אישור חזותי של לוקליזציה חלבון, אם הוא ידוע. </li></ol></li></ol>

<ol><li>Bendel, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Colonization+and+epithelial+adhesion+in+the+pathogenesis+of+neonatal+candidiasis%5BTitle%5D)+AND+%22Semin.+Perinatol%22%5BJournal%5D)">Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis.</a> Semin. Perinatol. 27 (5), 357-364 (2003).</li>
<li>Gerami-Nejad, M., Berman, J., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cassettes+for+PCR-mediated+construction+of+green%2C+yellow%2C+and+cyan+fluorescent+protein+fusions+in+Candida+albicans%5BTitle%5D)+AND+%22Yeast%22%5BJournal%5D)">Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans.</a> Yeast. 18 (9), 859-864 (2001).</li>
<li>Gerami-Nejad, M., Dulmage, K., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Additional+cassettes+for+epitope+and+fluorescent+fusion+proteins+in+Candida+albicans%5BTitle%5D)+AND+%22Yeast%22%5BJournal%5D)">Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans.</a> Yeast. 26 (7), 399-406 (2009).</li>
<li>Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+protein+function+in+clinical+C.+albicans+isolates%5BTitle%5D)+AND+%22Yeast%22%5BJournal%5D)">Analysis of protein function in clinical C. albicans isolates.</a> Yeast. 29 (8), 303-309 (2012).</li>
<li>Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cassettes+for+the+PCR-mediated+construction+of+regulatable+alleles+in+Candida+albicans%5BTitle%5D)+AND+%22Yeast%22%5BJournal%5D)">Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans.</a> Yeast. 21 (5), 429-436 (2004).</li>
<li>Gonia, S., Larson, B., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PCR-mediated+gene+modification+strategy+for+construction+of+fluorescent+protein+fusions+in+Candida+parapsilosis%5BTitle%5D)+AND+%22Yeast%22%5BJournal%5D)">PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis.</a> Yeast. 33 (2), 63-69 (2016).</li>
<li>Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cassettes+for+PCR-+mediated+gene+tagging+in+Candida+albicans+utilizing+nourseothricin+resistance%5BTitle%5D)+AND+%22Yeast%22%5BJournal%5D)">Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance.</a> Yeast. 28 (12), 833-841 (2011).</li>
<li>Ausubel, F. M., et al. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aAusubel%2C+FM+%22Current+Protocols+in+Molecular+Biology%22">Current Protocols in Molecular Biology</a>. , Wiley. New York. (1995).</li>
<li>Wilson, R. B., Davis, D., Mitchell, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+hypothesis+testing+with+Candida+albicans+through+gene+disruption+with+short+homology+regions%5BTitle%5D)+AND+%22J.+Bacteriol%22%5BJournal%5D)">Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.</a> J. Bacteriol. 181 (6), 1868-1874 (1999).</li>
<li>Pulver, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rsr1+focuses+Cdc42+activity+at+hyphal+tips+and+promotes+maintenance+of+hyphal+development+in+Candida+albicans%5BTitle%5D)+AND+%22Eukaryotic+Cell%22%5BJournal%5D)">Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans.</a> Eukaryotic Cell. 12 (4), 482-495 (2013).</li>
<li>Falgier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Candida+species+differ+in+their+interactions+with+immature+human+gastrointestinal+epithelial+cells%5BTitle%5D)+AND+%22Pediatr.+Res%22%5BJournal%5D)">Candida species differ in their interactions with immature human gastrointestinal epithelial cells.</a> Pediatr. Res. 69 (5), 384-389 (2011).</li>
<li>Nosek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+manipulation+of+the+pathogenic+yeast+Candida+parapsilosis%5BTitle%5D)+AND+%22Curr.+Genet%22%5BJournal%5D)">Genetic manipulation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 42 (1), 27-35 (2002).</li>
<li>Zemanova, J., Nosek, J., Tomaska, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-efficiency+transformation+of+the+pathogenic+yeast+Candida+parapsilosis%5BTitle%5D)+AND+%22Curr.+Genet%22%5BJournal%5D)">High-efficiency transformation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 45 (3), 183-186 (2004).</li>
<li>Benjamin, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neonatal+candidiasis+among+extremely+low+birth+weight+infants%3A+risk+factors%2C+mortality+rates%2C+and+neurodevelopmental+outcomes+at+18+to+22+months%5BTitle%5D)+AND+%22Pediatrics%22%5BJournal%5D)">Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months.</a> Pediatrics. 117 (1), 84-92 (2006).</li>
<li>Kullberg, B. J., Arendrup, M. C. <a target="_blank" href="https://www.ncbi.nlm.nih.gov/pubmed/26444731">Invasive Candidiasis.</a> N Engl J Med. 373 (15), 1445-1456 (2015).</li>
</ol>

החוקרים אין לי מה לחשוף.

בניית epitope מתויגת רצפים במיני קנדידה באמצעות אסטרטגיית שינוי הגנטית בתיווך PCR שתוארה לעיל ניתן לסכם כמו תהליך בן שלושה שלבים. ראשית, קלטת נעשית על ידי PCR מקודד הוא הרצף רצוי לשילוב ואזורים הומולוגי אל המוקד להכנסה לתוך הגנום שמרים. שנית, תאי שהמרים חייב להשתנות עש...

מיני קנדידה הם פטריות commensal כי ליישב את שטחי מעי מין ושתן של כל בני האדם. בתנאים של כשל חיסוני, כגון המתרחשות עם לידה מוקדמת או תופעות מדכאות חיסון מן הטיפולים בסרטן, מיני הקנדידה יכולים להיות פתוגנים אופורטוניסטים. של מיני קנדידה, קנדידה אלביקנס הקולוניאליסט פטרייתי הנפוץ ביותר וגורם רוב הזיהומים פטרייתיים פולשניים. מינים אחרים קנדידה כגון ג glabrata, ג parapsilosis, tropicalis ג, ו- C. kruseii גם לגרום לזיהומים רציניים בחולים מדוכאי חיסון, עם קצת התנגדות פנימית מפגין נפוצים אנטיביוטיקה אנטי פטרייתי כגון fluconazole ו amphotericin B. לפיכך, זיהומים עם כמה מינים אלה הנצפים בתדירות גבוהה יותר, במיוחד בקרב חולי המטופלים מניעתי עם תרופות אנטי פטרייתי. אפילו עם הולם במועדNTI-פטרייתי לטיפול, זיהומי קנדידה פולשניים להמשיך להיות מזוהה עם תחלואה משמעותית ותמותה 1. בגלל המשמעות של מינים הקנדידה לבריאות האדם, יש צורך בכלים מולקולריים זמינים המאפשרים לימוד ובירור מהותה של מנגנוני בפתוגנזה שלהם. כלי אחד חשוב המאפשר לחוקרים לחזות ולכמת תאים מיקרוביאליים החלבונים שהם מביעים היא טכנולוגיית היתוך FP. תגובת שרשרת פולימראז (PCR) שינוי גנטי בתיווך, כמתואר במאמר זה, מאפשרת בנייה של התכה, בין רצפי FP לבין חלבון קנדידה קידוד רצף של ריבית מוקד הגנומי שלו. שילוב יציב של המבנה מאפשר ניתוח של ביטוי חלבון כמו גם דינמיקת לוקליזציה חלבון. פלסמידים המכילים רצפי FP, אופטימיזציה עבור ביטוי קנדידה אלביקנס וכי ניתן להשתמש ב- G בתיווך PCRאנרגית אסטרטגית שינוי, נבנתה בעבר 2, 3, 4, 5. פלסמידים המכילים FP טרנספורמציה &quot;קלטות&quot;: רצף FP צמוד גן סמן תזונתי המאפשר השינוי של ג אלביקנס ו- C. parapsilosis 2, 3, 4, 5, 6, 7. נכון לעכשיו פלסמידים זמינים כוללים מגוון של גני סמן תזונתיים לבחירה (URA3, HIS1, ARG4) לחידוש זני auxotrophic גם כסמן עמידות לתרופות דומיננטיות (NAT1), המאפשר שינוי של זנים קליניים חסרי auxotrophies. בנוסף, פלסמידים המכילים אפשרויות עבור עד ארבעה רצפים FP שונים (ירוק [GFP], Yellow [YFP], ציאן [CFP], ודובדבן [mCherry]) ואו רצף סיום ADH1 לבנייה של התכה חלבון carboxy הסופית-, או רצף האמרגן לבנייה של התכה חלבון אמינו הסופית-. Primers נועדו עם הומולוגיה ל- DNA פלסמיד סביב קלטת FP. בנוסף, פריימרים גם כוללים סדרות 5&#39;-רחבת נושאות הומולוגיה לגן שמרי עניין להיות מתויג, המאפשר אינטגרציה של הקלטת לתוך מוקד גנומית באמצעות רקומבינציה הומולוגי (איור 1). גן ספציפי קלטות FP מופקות על ידי PCR ואז להפוך לתאי קנדידה עשו מוסמכת לספיגה של ה- DNA על ידי טיפול עם אצטט ליתיום. <img alt="איור 1" src="/files/ftp_upload/55333/55333fig1.jpg" /> איור 1: תרשים של איך בשילובי רצף FP נוצרים מיני קנדידה. (א) includ DNA פלסמידes רצף FP וכן קידוד רצף nourseothricin התנגדות (NAT1). מיקומים יחסיים של קדימה (FWD) primers ההפוכה (REV) נראים לעין, עם חלקים שחורים של פריימרים המציינים באזור של הומולוגיה לרצף פלסמיד ואת המנות הסגולות המציינות באזור הומולוגית הגן ספציפי או הארכה יחל. (B) קלטות FP הופכות קנדידה ולשלב בתוך מוקד גנומית ENO1 באמצעות רקומבינציה הומולוגי (קווים מקווקווים). (ג) כתוצאה רצף היתוך FP בבית 3&#39;end של ENO1. <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> בזאת, אנו מציגים דוגמא של היתוך חלבון (Eno1-FP) מבנים במיני קנדידה. אנו משתמשים תיוג פלסמידים המכילים את הגן סמן טרנספורמציה NAT1 וכן רצפי קידוד GFP, YFP, אוmCherry (איור 2). פלסמידים אלה משמשים יחד עם פריימרים ב PCR כדי ליצור קלטות גן ספציפי המאפשרים שילוב של FPS כדי 3&#39;-סוף ENO1, וכתוצאה מכך ביטוי Eno1 התמזגו fps ב carboxy הסופית- שלה. <img alt="איור 2" src="/files/ftp_upload/55333/55333fig2.jpg" /> איור 2: מפות של פלסמידים קלטת המכילה FP. קדמי (F) הפוך (R) פריימרים השתמשו כדי ליצור את הקלטות מן פלסמידים מסומנים יחד עם המיקום היחסי של ההומולוגיה שלהם פלסמידים. רצפים פריימר הם כמפורט בטבלה 1. F1 ו- R1 שימשו גם כדי ליצור את קלטת NAT1 pYFP-. הפלסמיד המכיל את הקלטת NAT1 YFP- (pMG2263) זהה pMG2120 למעט YFP במקום של רצף ה- GFP. בגדלים קלטת: GFP-NAT1, 3.7 KBP; mCherry- NAT1, 3.2 KBP; YFP- NAT1, 3.KBP 7. נתון זה יש הבדל בין Gerami-נג&#39;אד, et al. 4 <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

<table><tbody><tr><td>100 W mercury lamp</td><td>CHIU Technical Corporation</td><td>M-100T</td><td></td></tr><tr><td>95% Ethanol</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Adenine</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Ampicillin</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Carrier DNA</td><td>Ambion</td><td>AM9680</td><td>Sheared Salmon Sperm DNA 10 mg/ml</td></tr><tr><td>CCD Camera</td><td>Photometrics</td><td>CoolSNAP HQ</td><td></td></tr><tr><td>Conical Tube</td><td>Corning</td><td>430828</td><td>50 ml</td></tr><tr><td>Culture Tube Rotator</td><td>New Brunswick</td><td>2013923</td><td>TC-8, or Any Culture Tube Rotator</td></tr><tr><td>Deoxynucleotides (dNTP) PCR Grade</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Eppendorf Tubes</td><td>Eppendorf</td><td>022363719, 022363212</td><td>0.5 ml, 1.5 ml</td></tr><tr><td>Erlenmeyer Flask</td><td>Fisher Scientific</td><td>7250089</td><td>125 ml</td></tr><tr><td>Ethylenediaminetetraacetic Acid (EDTA)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Freezer (-80 &amp;deg;C)</td><td>Thermo Electron Corporation</td><td>ULT-1386-9-V</td><td>Revco Ultima II</td></tr><tr><td>GFP, YFP and Texas Red Filter Sets</td><td>Chroma Technology Corporation</td><td>49002, 86004v2, 49008</td><td></td></tr><tr><td>Glass culture tubes</td><td>Fisher Scientific</td><td>1496126</td><td>75 mm</td></tr><tr><td>HRP goat anti-mouse antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2005</td><td></td></tr><tr><td>HRP goat anti-rabbit antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2301</td><td></td></tr><tr><td>Incubator (30 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lithium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lysogeny Broth (LB) Media</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>5415 D</td><td></td></tr><tr><td>Microscope</td><td>Nikon</td><td>E600</td><td>Nikon Eclipse E600</td></tr><tr><td>Microscope Image Analysis Software</td><td>Universal Imaging Corporation</td><td>6.3r7</td><td>MetaMorph Software Series 6.3r7</td></tr><tr><td>Mouse anti-GFP antibody</td><td>Roche</td><td>11814460001</td><td></td></tr><tr><td>Nourseothricin</td><td>Fisher Scientific</td><td>50997939</td><td></td></tr><tr><td>PCR Thermocycler</td><td>Applied Biosystems</td><td>9700</td><td>GeneAmp PCR System</td></tr><tr><td>PCR tubes</td><td>BioExpress, GeneMate</td><td>T-3035-1</td><td>0.2 ml</td></tr><tr><td>Polyethylene Glycol 3350</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Potassium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Rabbit anti-mCherry antibody</td><td>BioVision</td><td>5993-100</td><td></td></tr><tr><td>Refrigerator (4 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Sodium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>SMZ1500</td><td></td></tr><tr><td>Table Top Centrifuge</td><td>Labnet</td><td>Z 400</td><td>Hermle Z 400</td></tr><tr><td>&lt;em&gt;Taq&lt;/em&gt; DNA Polymerase</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane (Tris)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Vortex Mixer</td><td>Scientific Industries</td><td>SI-0236</td><td>Vortex Genie 2</td></tr><tr><td>Yeast Extract Peptone Dextrose (YPD) Media</td><td>Any</td><td>NA</td><td></td></tr></tbody></table>

generation of fluorescent protein fusions in candida species

מיני קנדידה, הקולוניאליסטים רווחים של קטעי מעיים ו מין ושתן, הן הגורם של רוב הזיהומים פטרייתיים פולשניים בבני אדם. לכן, כלים מולקולריים וגנטיים נדרשים כדי להקל על המחקר של המנגנונים בפתוגנזה שלהם. PCR בתיווך שינוי גנטי הוא גישה פשוטה ומהירה ליצור חלבונים מתויג epitope כדי להקל הגילוי שלהן. בפרט, חלבון פלואורסצנטי (FP) התכה הם כלים רבי עוצמה המאפשרים הדמיה לכמת הן בתאי שמרים וחלבונים על ידי מיקרוסקופ פלואורסצנטי ו immunoblotting, בהתאמה. פלסמידים המכילים רצפי קידוד FP, יחד עם גני סמן תזונתיים המסייעים טרנספורמציה של מיני קנדידה, נוצרו לצורך בניית הביטוי FP ב קנדידה. בזאת, אנו מציגים אסטרטגיה לבניית היתוך FP בתוך מיני קנדידה. פלסמידים המכילים את עמיד nourseothricinגן סמן טרנספורמציה NCE (NAT1) וכן רצפים לאף ירוק, צהוב, או דובדבן FPS (GFP, YFP, mCherry) משמש יחד עם פריימרים הכוללים רצפים ספציפי גני תגובת שרשרת פולימראז (PCR) כדי ליצור קלטת FP . יש קלטת גן ספציפי זה יש את היכולת להשתלב סוף 3&#39;של מוקד הגן המקביל באמצעות רקומבינציה הומולוגיים. היתוך בתוך המסגרת מוצלחת של רצף FP לתוך מוקד הגן של עניין מאומת גנטי, ואחריו ניתוח של ביטוי חלבון היתוך על ידי מיקרוסקופ ו / או שיטות איתור חיסוני. בנוסף, במקרה של חלבונים מבוטאים בכמות גבוהה, יכולים להיות מוקרנים בשילובים מוצלחים בעיקר על ידי שיטות הדמית קרינה.

כדוגמא, השתמשנו הפרוטוקול שתואר לעיל לבנות בשילובי GFP ו mCherry כדי Eno1 ב זן מעבדת parapsilosis ג. כל transformant המשוערת בתחילה restreaked לצמיחה. בדוגמא זו, שכן חלבון ההיתוך כתוצאה מבוטא בכמות גבוהה (אנולאז) ואת FPS בהיר, הצלחנו להקרין transformants ידי מיקרוסקופ פלואורסצ?...

Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Generation of Fluorescent Protein Fusions in Candida Species

PCR בתיווך שינוי גנטי יכול לשמש כדי ליצור תערובות חלבון פלואורסצנטי במיני קנדידה, המאפשר הדמיה לכמת בתאי שמרים וחלבונים. בזאת, אנו מציגים אסטרטגיה לבניית שילוב חלבון פלואורסצנטי (Eno1-FP) ב קנדידה parapsilosis.

הדור של Fusions חלבון פלורסנט<em&gt; קנדידה</em&gt; מינים

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

generation-of-fluorescent-protein-fusions-in-candida-species

Research

JoVE Journal

Genetics

Generation of Fluorescent Protein Fusions in Candida Species

10.6K Views.  University of Minnesota.  PCR בתיווך שינוי גנטי יכול לשמש כדי ליצור תערובות חלבון פלואורסצנטי במיני קנדידה, המאפשר הדמיה לכמת בתאי שמרים וחלבונים. בזאת, אנו מציגים אסטרטגיה לבניית שילוב חלבון פלואורסצנטי (Eno1-FP) ב קנדידה parapsilosis. 

Video: Generation of Fluorescent Protein Fusions in Candida Species

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended intracellular endotubes that build and stabilize the lumen with a membrane and submembraneous cytoskeleton of apical character. The excretory cell expands its length approximately 2,000 times to generate these canals, making this model unique for the in vivo assessment of de novo polarized membrane biogenesis, intracellular lumen morphogenesis and unicellular tubulogenesis. The protocol presented here shows how to combine standard labeling, gain- and loss-of-function genetic or RNA interference (RNAi)-, and microscopic approaches to use this model to visually dissect and functionally analyze these processes on a molecular level. As an example of a labeling approach, the protocol outlines the generation of transgenic animals with fluorescent fusion proteins for live analysis of tubulogenesis. As an example of a genetic approach, it highlights key points of a visual RNAi-based interaction screen designed to modify a gain-of-function cystic canal phenotype. The specific methods described are how to: label and visualize the canals by expressing fluorescent proteins; construct a targeted RNAi library and strategize RNAi screening for the molecular analysis of canal morphogenesis; visually assess modifications of canal phenotypes; score them by dissecting fluorescence microscopy; characterize subcellular canal components at higher resolution by confocal microscopy; and quantify visual parameters. The approach is useful for the investigator who is interested in taking advantage of the C. elegans excretory canal for identifying and characterizing genes involved in the phylogenetically conserved processes of intracellular lumen and unicellular tube morphogenesis.

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The C. elegans excretory canal is a unique single-cell model for the visual in vivo analysis of de novo polarized membrane biogenesis. This protocol describes a combination of standard genetic/RNAi and imaging approaches, adaptable for the identification and characterization of molecules directing unicellular tubulogenesis, and apical membrane and lumen biogenesis.

התעלה Excretory C. elegans כמודל עבור מורפוגנזה לומן תאיים ו Vivo ב מקוטב ממברנה להן בתא יחיד: תיוג על ידי התכה GFP, RNAi אינטראקציה עם המסך הדמיה

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended ...

Developmental Biology

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal meningitis worldwide resulting in more than 625,000 deaths per year worldwide.&#160;Although electroporation has been developed for the transformation of plasmids in Cryptococcus, only&#160;biolistic&#160;delivery provides&#160;an effective means to transform&#160;linear&#160;DNA&#160;that can be integrated into the genome by homologous recombination.&#160;
Acetate has been shown to be a major fermentation product during cryptococcal infection, but the significance of this is not yet known.&#160;A bacterial pathway composed of the enzymes xylulose-5-phosphate/fructose-6-phosphate phosphoketolase (Xfp) and acetate kinase (Ack) is one of three potential pathways for acetate production in C. neoformans. Here, we demonstrate the biolistic transformation of a construct, which has the gene encoding Ack fused to the fluorescent tag mCherry, into&#160;C. neoformans. We then confirm integration of the ACK-mCherry fusion into the&#160;ACK&#160;locus.

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

Biolistic transformation is a method used to generate stable integration of DNA into the genome of the opportunistic pathogen Cryptococcus neoformans through homologous recombination. We will demonstrate biolistic transformation of a construct, which has the gene encoding acetate kinase fused to the fluorescent tag mCherry into&#160;C. neoformans.

שינוי Biolistic של פלורסנט Tagged Gene לOpportunistic פטרייתיים פתוגן<em&gt; Neoformans קריפטוקוקוס</em

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal ...

Immunology and Infection

Visualizing Yeast Organelles with Fluorescent Protein Markers

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have constructed fluorescent protein-based markers for major organelles and endomembrane structures, including the nucleus, endoplasmic reticulum (ER), Golgi apparatus, endosomes, vacuoles, mitochondria, peroxisomes, lipid droplets, and autophagosomes. The protocol presented here describes the procedures for using these markers in yeast, including DNA preparation for yeast transformation, selection and evaluation of transformants, fluorescent microscopic observation, and the expected outcomes. The text is geared toward researchers who are entering the field of yeast organelle study from other backgrounds. Essential steps are covered, as well as technical notes about microscope hardware considerations and several common pitfalls. It provides a starting point for people to observe yeast subcellular entities by live-cell fluorescent microscopy. These tools and methods can be used to identify protein subcellular localization and track organelles of interest in time-lapse imaging.

<meta charset="utf8"></head><body>הדמיה של אברוני שמרים עם סמני חלבון פלואורסצנטיים

Here we describe the use of a set of fluorescent protein-based organelle markers in live-cell imaging of the budding yeast, Saccharomyces cerevisiae.

הדמיה של אברוני שמרים עם סמני חלבון פלואורסצנטיים

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have ...

Biochemistry

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial applications as well as increases basic fundamental biological knowledge. F&ouml;rster (Fluorescence) Resonance Energy Transfer (FRET) between a donor molecule in an electronically excited state and a nearby acceptor molecule has been frequently utilized for studies of protein-protein interactions in living cells. The proteins of interest are tagged with two different types of fluorescent probes and expressed in biological cells. The fluorescent probes are then excited, typically using laser light, and the spectral properties of the fluorescence emission emanating from the fluorescent probes is collected and analyzed. Information regarding the degree of the protein interactions is embedded in the spectral emission data. Typically, the cell must be scanned a number of times in order to accumulate enough spectral information to accurately quantify the extent of the protein interactions for each region of interest within the cell. However, the molecular composition of these regions may change during the course of the acquisition process, limiting the spatial determination of the quantitative values of the apparent FRET efficiencies to an average over entire cells. By means of a spectrally resolved two-photon microscope, we are able to obtain a full set of spectrally resolved images after only one complete excitation scan of the sample of interest. From this pixel-level spectral data, a map of FRET efficiencies throughout the cell is calculated. By applying a simple theory of FRET in oligomeric complexes to the experimentally obtained distribution of FRET efficiencies throughout the cell, a single spectrally resolved scan reveals stoichiometric and structural information about the oligomer complex under study. Here we describe the procedure of preparing biological cells (the yeast Saccharomyces cerevisiae) expressing membrane receptors (sterile 2 &alpha;-factor receptors) tagged with two different types of fluorescent probes. Furthermore, we illustrate critical factors involved in collecting fluorescence data using the spectrally resolved two-photon microscopy imaging system. The use of this protocol may be extended to study any type of protein which can be expressed in a living cell with a fluorescent marker attached to it.

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

By employing a spectrally resolved two-photon microscopy imaging system, pixel-level maps of F&ouml;rster Resonance Energy Transfer (FRET) efficiencies are obtained for cells expressing membrane receptors hypothesized to form homo-oligomeric complexes. From the FRET efficiency maps, we are able to estimate stoichiometric information about the oligomer complex under study.

ב כימות vivo של G מצמידים חלבון קולטן אינטראקציות באמצעות נפתר Spectrally שני פוטון מיקרוסקופית

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial ...

Biology

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using fluorochromes like Green Fluorescent Protein (GFP) directly attached to the protein of interest has become increasingly popular 1. Using GFP and similar fluorochromes the subcellular localisations and movements of proteins can be detected in a fluorescent microscope. Moreover, also the subnuclear localisation of a certain region of a chromosome can be studied using this technique. GFP is fused to the Lac Repressor protein (LacR) and ectopically expressed in the cell where tandem repeats of the lacO sequence has been inserted into the region of interest on the chromosome2. The LacR-GFP will bind to the lacO repeats and that area of the genome will be visible as a green dot in the fluorescence microscope. Yeast is especially suited for this type of manipulation since homologous recombination is very efficient and thereby enables targeted integration of the lacO repeats and engineered fusion proteins with GFP 3. Here we describe a quantitative method for live cell analysis of fission yeast. Additional protocols for live cell analysis of fission yeast can be found, for example on how to make a movie of the meiotic chromosomal behaviour 4. In this particular experiment we focus on subnuclear organisation and how it is affected during gene induction. We have labelled a gene cluster, named Chr1, by the introduction of lacO binding sites in the vicinity of the genes. The gene cluster is enriched for genes that are induced early during nitrogen starvation of fission yeast 5. In the strain the nuclear membrane (NM) is labelled by the attachment of mCherry to the NM protein Cut11 giving rise to a red fluorescent signal. The Spindle Pole body (SPB) compound Sid4 is fused to Red Fluorescent Protein (Sid4-mRFP) 6. In vegetatively growing yeast cells the centromeres are always attached to the SPB that is embedded in the NM 7. The SPB is identified as a large round structure in the NM. By imaging before and 20 minutes after depletion of the nitrogen source we can determine the distance between the gene cluster (GFP) and the NM/SPB. The mean or median distances before and after nitrogen depletion are compared and we can thus quantify whether or not there is a shift in subcellular localisation of the gene cluster after nitrogen depletion.

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

כמותי תא חי פלואורסצנטי, מיקרוסקופ ניתוח של שמרים ביקוע

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using ...

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic changes are regulated by a complex signaling network controlled in response to environmental stimuli. These regulatory components have been highly studied, but almost all studies use a variety of in vitro stimuli to trigger filamentation. To determine how morphogenesis is regulated during the pathogenesis process, we developed an in vivo microscopy system to obtain high spatial resolution images of organisms undergoing hyphal formation within the mammalian host. The protocol presented here describes the use of this system to screen small collections of C. albicans mutant strains, allowing us to identify key regulators of morphogenesis as it occurs at the site of infection. Representative results are presented, demonstrating that some regulators of morphogenesis, such as the transcriptional regulator Efg1, have consistent phenotypes in vitro and in vivo, whereas other regulators, such as adenyl cyclase (Cyr1), have significantly different phenotypes in vivo compared to in vitro.

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

This manuscript describes a method for screening moderately sized Candida albicans mutant libraries for morphogenesis phenotypes during active infection in a mammalian host using non-invasive confocal microscopy.

שימוש בהדמיית in vivo לבדיקת פנוטיפים של מורפוגנזה בזנים מוטנטיים של קנדידה אלביקנס במהלך זיהום פעיל בפונדקאי של יונקים

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic ...

הקמת מודל עכברי לזיהום הקשור לצנתר קנדידה אלביקנס

A Catheter-Related Candida albicans Infection Model in Mouse

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed on the outer surface of the catheter and lead to disseminated infections, which are fatal to patients. There are no effective prevention and treatment management in clinics. Therefore, it is urgent to establish an animal model of CRI for the preclinical screening of new strategies for its prevention and treatment. In this study, a polyethylene catheter, a widely used medical catheter, was inserted into the back of the BALB/c mice after hair removal. Candida albicans ATCC MYA-2876 (SC5314) expressing enhanced green fluorescent protein was subsequently inoculated on the skin's surface along the catheter. Intense fluorescence was observed on the surface of the catheter under a fluorescent microscope 3 days later. Mature and thick biofilms were found on the surface of the catheter via scanning electron microscopy. These results indicated the adhesion, colonization, and biofilm formation of candida albicans on the surface of the catheter. The hyperplasia of the epidermis and the infiltration of inflammatory cells in the skin specimens indicated the histopathological changes of the CRI-associated skin. To sum up, a mouse CRI model was successfully established. This model is expected to be helpful in the research and development of therapeutic management for candida albicans associated CRI.

מחבר זרקור: שיפור זיהוי קנדידה אלביקנס בזיהומי קטטר באמצעות תיוג חלבון פלואורסצנטי 

We establish a mouse model of C.albicans-associated catheter-related infection (CRI), in which biofilm forms on the catheter, and the interaction between C.albicans and host correlates well with the clinical CRI. This model helps screen therapies for C.albicans biofilm-associated CRI, laying a foundation for clinical transformation.

מודל זיהום קנדידה אלביקנס הקשור לצנתר בעכבר

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed ...

הדור של Fusions חלבון פלורסנט

Summary

Explore More Videos

התעלה Excretory C. elegans כמודל עבור מורפוגנזה לומן תאיים ו Vivo ב מקוטב ממברנה להן בתא יחיד: תיוג על ידי התכה GFP, RNAi אינטראקציה עם המסך הדמיה

שינוי Biolistic של פלורסנט Tagged Gene לOpportunistic פטרייתיים פתוגן

הדמיה של אברוני שמרים עם סמני חלבון פלואורסצנטיים

הדמיה של אברוני שמרים עם סמני חלבון פלואורסצנטיים

ב כימות vivo של G מצמידים חלבון קולטן אינטראקציות באמצעות נפתר Spectrally שני פוטון מיקרוסקופית

כמותי תא חי פלואורסצנטי, מיקרוסקופ ניתוח של שמרים ביקוע

שימוש בהדמיית in vivo לבדיקת פנוטיפים של מורפוגנזה בזנים מוטנטיים של קנדידה אלביקנס במהלך זיהום פעיל בפונדקאי של יונקים

מודל זיהום קנדידה אלביקנס הקשור לצנתר בעכבר

מודל זיהום קנדידה אלביקנס הקשור לצנתר בעכבר

מודל זיהום קנדידה אלביקנס הקשור לצנתר בעכבר