עבודה זו נתמכה על ידי הקרנות הפעלה סגל החדשות של צפון קרוליינה סטייט עבור שו Guozhou.

הערה: מערכת תא חרקים/baculovirus עם ביטוי שונה וקטורים עבור ביטוי חלבון צמחי הפרשה וגיבוש משמש.
1. שינוי של וקטור הביטוי Baculovirus עם פפטיד אות GP67 לביטוי הפרשת חלבון צמחי
<ol><li>לסנתז קטע DNA המכיל של 5' BglII חיתוך האתר13הרצף אות הפרשת GP67, אתר רב-שיבוט עם NotI, BamHI, EcoRI, StuI, סאלי, SpeI, XbaI, PstI ו XhoI (איור 1 א'). הערה: מאז הן BglII והן BamHI מתעכל דנ א הביא הקצוות דבק אותו, הווקטור ליניארית ניתן מאתרים ומפסיקים למקטע הדנ א מתעכל בעוד אתרים הן BglII והן BamHI ברצף מצדו annealed מוטציה רצף שאינו cleavable על ידי או BglII או BamHI14.</li>
	<li>תקציר 4 µg של ה-DNA עם BglII, XhoI, µg 4 של וקטור ביטוי DNA עם BamHI ו- XhoI14. לערבב 10 יחידות של כל אנזים הגבלה עם דנ א ב 1 x ריכוז מאגר התגובה (אצטט אשלגן 50 מ מ, 20 מ מ טריס-אצטט אצטט מגנזיום 10 מ מ, 100 µg/mL BSA, pH 7.9 25 ° c), דגירה התערובת ב 37 מעלות צלזיוס במשך 4 שעות.<ol>
<li>לטהר את מקטע ה-DNA נכרת, הווקטור ליניארית DNA על-ידי ערכת15החילוץ ג'ל הדנ א.</li>
	</ol>
</li>
	<li>מיקס 100 ננוגרם של וקטור ליניארית DNA עם 400 ננוגרם של ה-DNA מתעכל קטע בתוך תערובת התגובה מצדו 10-µL המכילה 1-T4 DNA ליגאז התגובה מאגר (50 מ מ טריס-HCl, 10 מ מ MgCl2, 1 מ מ ATP ו- 10 מ"מ. DTT, pH 7.5 ב- 25 ° C) ו- 5 יחידות של ה-DNA T4 ליגאז. דגירה תערובת התגובה ב 16 ° C עבור 16 h.</li>
	<li>להפוך µL 5 של תערובת מצדו µL 100 DH5α תאים המוסמכת בעקבות פרוטוקול סטנדרטי טרנספורמציה ובחר את המושבות המתקבלת על מטוס צלחת אגר אמפיצילין-LB16. לאסוף 5-10 מושבות ולגדול כל המושבה ב 2 מ ל LB בינוני המכיל אמפיצילין µg/mL 100 ב 220 סל ד ו- 37 מעלות צלזיוס חממה חזק עבור 16 h.</li>
	<li>תמצית כל פלסמיד DNA עם ערכת miniprep17 דנ א ואשר השיבוטים מאת רצפי DNA עם פריימר AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-להגביר הגן TDR לבנה א קטע קידוד שאריות 30-642 מן הגן TDR סינתטי לבנות (קדימה פריימר: פול GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, פריימר הפוכה: GC GGATCC CTA חברתנו חברתנו ATG חברתנו חברתנו חברתנו ACCGTCTATATCTGCATTTCCGGC). להגביר את ה-DNA 30 מחזורים במאגר תגובת ה-DNA פולימראז המכיל תערובת dNTP 0.5 מ מ, 0.2 µM תחל, µg 0.1 של תבנית ה-DNA, MgCl 0.4 מ מ2ו- 1 יחידה התגובה של ה-DNA פולימראז.<ol>
<li>עבור הצעדים מחזור ה-PCR, להגדיר את דנטורציה הראשונית ב 95 ° C ל 30 s ולאחר מכן 30 מחזורים של דנטורציה ב 95 ° C ל 30 s, חישול ב 55 ° C s 30, ואת סיומת ב-72 מעלות עבור 1 דקות, עם סיומת הסופי ב-72 מעלות במשך 5 דקות.</li>
	</ol>
</li>
	<li>לעכל את מקטע ה-PCR והן וקטור שונה עם אנזימי הגבלה endonuclease NotI ו- BamHI. מאתרים ומפסיקים את השבר ג'ין עם וקטור ליניארית. מיקס 100 ננוגרם של וקטור ליניארית DNA עם 400 ננוגרם של ה-DNA מתעכל קטע בתוך תערובת התגובה מצדו 10-µL T4 DNA ליגאז התגובה מאגר המכיל 5 יח ל T4 DNA ליגאז. דגירה תערובת התגובה ב 16 ° C עבור 16 h.</li>
	<li>להפוך µL 5 של תערובת מצדו µL 100 DH5α תאים המוסמכת בעקבות פרוטוקול סטנדרטי טרנספורמציה ובחר את המושבות המתקבלת על מטוס צלחת אגר אמפיצילין-LB16. לאשר את השיכפולים הנכונה על ידי רצפי DNA.</li>
</ol>2. שינוי של וקטור הביטוי Baculovirus עם פפטיד אות חרקים Hemolin לביטוי הפרשת חלבון צמחי
<ol><li>לסנתז קטע DNA המכיל של 5' BglII חיתוך האתר13, הרצף אות הפרשת hemolin חרקים ו אתר רב-שיבוט עם NotI, BamHI, EcoRI, StuI, סאלי, SpeI, XbaI, PstI ו XhoI (איור 1B).</li>
	<li>תקציר 4 µg של ה-DNA עם BglII, XhoI, µg 4 של וקטור ביטוי DNA עם BamHI ו- XhoI14. לערבב 10 יחידות של כל אנזים הגבלה עם דנ א ב 1 x ריכוז מאגר התגובה (אצטט אשלגן 50 מ מ, 20 מ מ טריס-אצטט אצטט מגנזיום 10 מ מ, 100 µg/mL BSA, pH 7.9 25 ° c), דגירה התערובת ב 37 מעלות צלזיוס במשך 4 שעות.<ol>
<li>לטהר את מקטע ה-DNA נכרת, הווקטור ליניארית DNA על-ידי ערכת15החילוץ ג'ל הדנ א.</li>
	</ol>
</li>
	<li>מיקס 100 ננוגרם של וקטור ליניארית DNA עם 400 ננוגרם של ה-DNA מתעכל קטע בתוך תערובת התגובה מצדו 10-µL המכילה 1-T4 DNA ליגאז התגובה מאגר (50 מ מ טריס-HCl, 10 מ מ MgCl2, 1 מ מ ATP ו- 10 מ"מ. DTT, pH 7.5 ב- 25 ° C) ו- 5 יחידות של ה-DNA T4 ליגאז. דגירה תערובת התגובה ב 16 ° C עבור 16 h.</li>
	<li>להפוך µL 5 של תערובת מצדו µL 100 DH5α תאים המוסמכת ובחר את המושבות על צלחת אגר אמפיצילין-LB. לאסוף 5-10 מושבות ולגדול כל המושבה במדיום LB 2-mL המכיל 100 µg/mL של אמפיצילין-220 סל ד ו- 37 מעלות צלזיוס חממה חזק עבור 16 h.</li>
	<li>לחלץ את הדנ א פלסמיד עם ערכת miniprep17 דנ א ואשר השיבוטים מאת רצפי DNA עם פריימר AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>להגביר את-PCR לבנה א אבקה קולטן קינאז 3 (PRK3) ג'ין פרגמנט קידוד שאריות 20-237 מ בונה ג'ין PRK3 סינתטי (קדימה פריימר: פול GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, פריימר הפוכה: CGC GGATCC CTA חברתנו חברתנו ATG חברתנו חברתנו חברתנו TGAAGGTTTCTCATCGCATTCTATATTC). להגביר את ה-DNA 30 מחזורים במאגר תגובת ה-DNA פולימראז המכיל תערובת dNTP 0.5 מ מ, 0.2 µM תחל, µg 0.1 של תבנית ה-DNA, MgCl 0.4 מ מ2ו- 1 יחידה התגובה של ה-DNA פולימראז.<ol>
<li>עבור הצעדים מחזור ה-PCR, להגדיר את דנטורציה הראשונית ב 95 ° C ל 30 s ולאחר מכן 30 מחזורים של דנטורציה ב 95 ° C ל 30 s, חישול ב 55 ° C s 30, ואת סיומת ב-72 מעלות ל 30 s בתוך כל מחזור, והסיומת הסופי ב-72 מעלות במשך 5 דקות.</li>
	</ol>
</li>
	<li>לעכל את מקטע ה-PCR והן וקטור שונה עם אנזימי הגבלה endonuclease NotI ו- BamHI. מאתרים ומפסיקים את השבר ג'ין עם וקטור ליניארית. מיקס 100 ננוגרם של וקטור ליניארית DNA עם 400 ננוגרם של ה-DNA מתעכל קטע בתוך תערובת התגובה מצדו 10-µL T4 DNA ליגאז התגובה מאגר המכיל 5 יח ל T4 DNA ליגאז. דגירה תערובת התגובה ב 16 ° C עבור 16 h.</li>
	<li>להפוך µL 5 של תערובת מצדו µL 100 DH5α תאים המוסמכת בעקבות פרוטוקול סטנדרטי טרנספורמציה ובחר את המושבות המתקבלת על מטוס צלחת אגר אמפיצילין-LB16. לאשר את השיכפולים הנכונה על ידי רצפי DNA.</li>
</ol>3. ייצור, הגברה של Baculovirus בונה מחסה בקלטת ביטוי חלבון רקומביננטי
<ol><li>שימוש 100 ננוגרם של פלסמיד לבנות להפוך µL 40 תאי המוסמכת DH10Bac בעקבות הפרוטוקול של מערכת ביטוי baculovirus1. דגירה הלוחות טרנספורמציה ב 37 מעלות צלזיוס במשך 48 שעות.</li>
	<li>לאסוף שתי מושבות לבן של כל צלחת טרנספורמציה, לחסן כל המושבה לתוך 2 מ ל LB בינוני המכיל 50 µg/mL kanamycin, גנטמיצין µg/mL 7 ו- 10 µg/mL טטרציקלין. לפי התקנון של baculovirus ביטוי מערכת1 כדי לחלץ ולוודא את bacmid ה-DNA. Aliquot כל DNA שני צינורות עם 20 µL כל אחד, ולאחסן את הצינורות ב-20 ° C. הערה: השלבים הבאים מחייבים פעולה אספטי.</li>
	<li>לגדול עם טפט של תאים Sf9 האנטיביוטיקה פניצילין-סטרפטומיצין תרבות המדיה עם 10% סרום שור עוברית (FBS) ו- 100 µg/mL (או 100 I.U./mL) ב 27 ° C 80% זרימה לתוך צלחת 6-. טוב. להעריך את אחוז הנהרות בהתאם לאחוז אזור מכוסה בצלחת תרביות רקמה.</li>
	<li>הכינו את הפתרונות הבאים לפי שני צינורות סטרילי 1.5-mL צנטריפוגה.<ol>
<li>צינור 1: עבור כל תרביות תאים, למהול 20 µL של bacmid ה-DNA לתוך µL 100 unsupplemented Sf9 תא תרבות בינוני ללא אנטיביוטיקה. מערבבים בעדינות הדילול על ידי מצליף את הצד של הצינור.</li>
		<li>צינור 2: עבור כל תרביות תאים, לדלל 8 µL של השומנים תרביות תאים ריאגנט לתוך µL 100 unsupplemented Sf9 תא תרבות בינוני ללא אנטיביוטיקה. לערבב הדילול ביסודיות על ידי pipetting למעלה ולמטה עבור 6 x.</li>
	</ol>
</li>
	<li>לשלב את שני פתרונות, מערבבים בעדינות על-ידי pipetting לאט לאט מעלה ומטה עבור 3 x ולאחר תקופת דגירה אותם של 20-40 דקות בטמפרטורת החדר.</li>
	<li>תשטוף כל טוב של טפט Sf9 תאים 2 x 3 מ של unsupplemented Sf9 תא תרבות בינונית ללא אנטיביוטיקה. עבור כל תרביות תאים, להוסיף 0.8 מ של unsupplemented Sf9 תא תרבות בינונית ללא אנטיביוטיקה כל שפופרת המכילה את התערובת השומנים-DNA. לערבב בעדינות את התוכן של הצינורות על ידי pipetting לאט לאט מעלה ומטה עבור 3 x. האחות שטיפת המדיה מן הלוחות, כיסוי הדגימות עם התערובת תרביות תאים.</li>
	<li>לאחר התוספת של התערובת תרביות תאים, דגירה את הצלחת transfected עבור 5 שעות ב-27 º c להחליף את המדיה תרביות תאים המדיום מלאה של תרבות תא Sf9 המכיל 10% FBS ו µg 100/mL (או 100 I.U./mL) האנטיביוטיקה פניצילין-סטרפטומיצין. דגירה את הצלחת transfected ב 27 ° C עבור 4 d.</li>
	<li>הקציר ומגבירים את baculovirus רקומביננטי.<ol>
<li>לאסוף את תגובת שיקוע של צלחת נגוע צינור חרוטי 15-mL סטרילית לאחר 4 d של דגירה. לסובב את תגובת שיקוע ב x 1010 g עבור 5 דקות כדי להסיר את שאריות תאים. למחוק בגדר decant את תגובת שיקוע על צינור נקי, לאחסן אותו ב 4 ° C עד 1 שנה. הערה: זהו וירוס P0. זה יכול להיות aliquoted ומאוחסן ב-80 מעלות צלזיוס לתקופה ארוכה יותר של זמן.</li>
		<li>כדי להגביר את כל וירוס רקומביננטי, לגדול טפט של תאים Sf9 על צלחת 150-מ מ 80% הנהרות. האחות התקשורת מהצלחת, להוסיף 2 מ"ל של הנגיף P0 כנצרות תאים לצלחת, דגירה את הצלחת. בשביל 1 h בחממה 27 ° C. סלע את הצלחת כל 15 דקות לערבב את המדיום עם התאים.<ol>
<li>להוסיף 25 מ של המדיה של גרייס מלא המכיל 10% FBS ו µg 100/mL (או 100 I.U./mL) האנטיביוטיקה פניצילין-סטרפטומיצין. דגירה את הצלחת. בשביל בתלת-ממד בחממה 27 ° C כדי להשיג את הוירוס מעבר P1.</li>
		</ol>
</li>
		<li>לאסוף את תגובת שיקוע של צלחת נגוע סטרילי 50-mL צינור חרוטי ו ספין-x 1010 g עבור 5 דקות כדי להסיר את שאריות תאים. Decant את תגובת שיקוע על צינור נקי ואחסן אותו ב 4 ° C עד 1 שנה. הערה: הווירוס P1 ניתן aliquoted מאוחסנת ב- 80 ° C לתקופה ארוכה יותר של זמן.</li>
		<li>כדי להגביר את הווירוס מ- P1 ל- P2 המעבר, לגדול טפט של תאים Sf9 על צלחת 150-מ מ 90% הנהרות, תשאף התקשורת של הצלחת, להוסיף 2 מ"ל של הנגיף P1 לצלחת, תקופת דגירה זה של 1 ש ח בחודש חממה 27 ° C.</li>
		<li>חזור על שלבים 3.8.2 ו 3.8.3 כדי להשיג את הקטעים P2, P3 של וירוסים. אל תאחסן את הוירוס P3 ליותר מ- 2 חודשים.</li>
	</ol>
</li>
</ol>4. חלבון ביטוי, טיהור עם נינטה, התגבשות
<ol><li>תרבות 1 ליטר בתאי חרקים Hi5 האנטיביוטיקה פניצילין-סטרפטומיצין תרבות המדיה עם µg 100/mL (או 100 I.U./mL) על צפיפות של 2 x 106 -100 סל"ד ב שייקר אינקובטור 27 ° C. ספין למטה התאים ב x 570 גרם במשך 5 דקות, decant את תגובת שיקוע, resuspend התאים 20 מ"ל של הנגיף P3 טריים המיוצרים ולשמור אותו בטמפרטורת החדר עבור ה 1 לנער בעדינות את הבקבוק ספין כדי resuspend את התאים 1 x כל 15 דקות.</li>
	<li>להעביר את התאים 1 ליטר של תרבות התקשורת עם µg 100/mL (או 100 I.U./mL) סטרפטומיצין פניצילין אנטיביוטיקה, התרבות התאים ב 100 סל"ד ב שייקר אינקובטור 27 ° C עבור ה 72 ספין למטה התאים ב 1,010 x g למשך 5 דקות ולאסוף את תגובת שיקוע.</li>
	<li>מחוון ה-pH השתמש רצועות כדי להתאים את ה-pH של תגובת שיקוע כדי 8.0 על-ידי הוספת 0.1 M HCl או 0.1 M NaOH ולהוסיף איגוד מאגר-ריכוז סופי, המכיל מאגר טריס 20 מ מ ב- pH 8.0, 100 מ מ NaCl, ו- 5 מ מ imidazole. להוסיף כמות מסוימת של שרף נינטה (10-40 מ"ל) מבוסס על התשואה המשוערת של ביטוי שלו מתויג רקומביננטי החלבון.<ol>
<li>לערבב הפתרון על מהומה מגנטי עם מהירות נמוכה ב 4 ° C עבור 1 ח' שטיפת השרף, elute החלבון מאוגד בעקבות תקן נינטה טיהור פרוטוקול18.</li>
	</ol>
</li>
	<li>נושא החלבון מטוהרים יונים, ג'ל סינון כרומטוגרפיה, כמו גם שיטות טיהור אחרות חלבון, להניב מדגם הומוגני. הערה: עבור ectodomain TDR, 20 מ מ. טריס, pH 8, 100 מ מ NaCl שימשו בתור מאגר סינון ג'ל. עבור ectodomain PRK3, 20 מ מ bis-טריס, ה-pH 6, 100 מ מ NaCl שימשו המאגר סינון ג'ל המועדפת.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

המחברים אין לחשוף.

לאור המגוון גודל ויציבות של אלפי חלבונים המצויים המערכות הביולוגיות, זה לעיתים קרובות אמפירי עבור מחקר מעבדה כדי להחליט באיזו מערכת ביטוי heterologous יש שייבחרו עבור הביטוי של חלבון ספציפי. מערכת ביטוי e. coli היא לעיתים קרובות הבחירה הראשונה עבור ביטוי חלבון עקב מחזור החיים הקצר של החיידקי...

זה הכרחי עבור מעבדת מחקר להיות מסוגל לייצר כמויות גדולות של חומרים הומוגנית על אפיוני הביוכימי, biophysical, במיוחד ללימודי לחקר הגבישים רנטגן. ישנן מערכות רבות ומבוססת ביטוי heterologous כגון Escherichia coli, שמרים, בתאי חרקים, בתרבית של תאים, תאי צמחים, וכו ביניהם, מערכת ביטוי בתיווך baculovirus תא חרקים היא אחת ביותר נפוץ טכניקות לייצר כמויות גדולות של מבנית מקופל גדול בגודל האיקריוטים חומרים עבור התגבשות חלבון1.
הווקטורים ביטוי במערכת הביטוי baculovirus מתוכננים להכיל polyhedrin חזק או יזם P10 לייצר תשואה גבוהה של חלבונים תאיים רקומביננטי2,3. כדי להפוך את baculovirus רקומביננטי, הגן עניין שוכפל לתוך וקטור חרקים המכיל את לוקוס polyhedrin (polh) של הגנום מולטי-nucleopolyhedroviral Autographa קליפורניה הבונה וכתוצאה מכך הוא ואז וסודרו ולאמת את המסגרת הנכונה קריאה פתוחה (ORF). הבונה הנכון ואז מוחדרים התא המארח חרקים בתהליך של תרביות תאים. הגן עניין מוכנס לתוך הגנום הנגיפי מאת רקומבינציה הומולוגית. אירוע זה תוצאות בייצור של הגנום הנגיפי רקומביננטי, אשר משכפל ואז לייצר רקומביננטי budded חלקיקי וירוס1.
התאים חרקים המשמשים בדרך כלל במערכת הביטוי הם תאים (Hi5) Sf9 וגבוהה חמש. תאים Sf9 הם בידוד המשובטים של Sf21, נגזר מן התאים השחלות הגולמי של זחל כנימה frugiperda, והם Hi5 תאים בידוד המשובטים נגזר הורים Trichoplusia ni תא השחלות קו TN-3684,5. Transfections שיתוף וירוס הגברה, מבחני פלאק מתנהלים על תאים Sf9, ואילו תאים Hi5 נבחרו בדרך כלל לייצר כמויות גבוהות של חומרים6. ראוי לציין כי התאים Hi5 אינם מתאימים עבור דור ו הגברה של וירוס progenies נטייתם לייצר וירוסים מוטציה. באופן מסורתי, טווח טמפרטורה 25-30 מעלות צלזיוס נחשבת טובה לגידול תאים חרקים. עם זאת, דווח שיש 27-28 מעלות צלזיוס טמפרטורה אופטימלית עבור תא חרקים וצמיחה של זיהום7,8.
המבוא של רצף קליטה טובה שקדמו הגן נדרש עבור הביטוי גבוהה של החלבונים המופרש. הרצף אות ביעילות ידריך את חלבון רקומביננטי מתורגם לתוך רשתית תוך-פלזמית עבור הפרשת חלבונים ושינויים post-translational הכרחי עבור קיפול תקין וייצוב3. האות פפטיד רצפים, כגון אופפים baculovirus חלבון GP64/67, דבורת דבש melittin ואחרים, נבחרו כדי להקל על הביטוי של הפרשה חומרים של מערכות ביטוי בתיווך baculovirus3. המבוא של פפטיד האות של GP67 הוכח לשפר את התשואה ביטוי של חלבון רקומביננטי המופרש, לעומת שימוש של פפטיד אות מהותי של ג'ין היעד9. Hemolin הוא חלבון hemolymph של ענק משי העש Hyalophora cecropia, המושרה על זיהום חיידקים10. בשל רמה גבוהה יחסית של ביטוי מושרה, אות פפטיד רצף הגן יכול לשמש כדי לתווך הביטוי הפרשה חומרים במערכת baculovirus-חרק תא.
לבנה א Tracheary רכיב בידול מעכבות פקטור קולטן (TDR) ואבקה קולטן קינאז 3 (PRK3) שניהם שייכים למשפחת חוזר קולטן דמוי קינאז (LRR-RLK) צמח לאוצין-עשיר של חלבונים11,12 . כדי ללמוד את המבנה והתפקוד של משפחה זו של קולטן פרוטאינים צמחיים, כמו גם כדי להקל על אפיון הביוכימי מבניים אחרים פרוטאינים צמחיים מופרש למערכת ביטוי תא baculovirus-חרק שונתה כדי לשפר את התשואה איכות, ייצור חלבונים. חוץ-תאית לתחומי TDR והן PRK3 בהצלחה כבר הביעו באמצעות שני וקטורים ביטוי שונה במערכת הביטוי תא baculovirus-חרק. יש כבר גיבש בשני תחומים חוץ-תאית החלבונים TDR ו- PRK3. מאמר זה מדווח את הביטוי ואת טיהור של כמויות גדולות של חלבונים רקומביננטי צמח מופרשים עם שני baculovirus ששונה ביטוי וקטורים על ידי שילוב של GP67 או hemolin אות רצף בין יזם את שיבוט מרובים אתרים.

<table>
	<tbody>
		<tr>
			<td>Incubator shaker</td>
			<td>VWR</td>
			<td>Model Excella E25</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>VWR</td>
			<td>Model 2005</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>BECKMAN</td>
			<td>Model J-6</td>
			<td>with a swing bucket rotor</td>
		</tr>
		<tr>
			<td>Herculase II Fusion DNA Polymerase</td>
			<td>Agilent</td>
			<td>600677-51</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>BIO-RAD</td>
			<td>Model C1000 Touch</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Incubator shaker</td>
			<td>New Brunswick Scientific</td>
			<td>Model I 24</td>
			<td>For growing baceria culture</td>
		</tr>
		<tr>
			<td>Customer DNA synthesis</td>
			<td>GENSCRIPT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3136S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>BglII</td>
			<td>New England Biolabs</td>
			<td>R0144S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>NotI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3189S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>New England Biolabs</td>
			<td>R0146S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td>DNA ligation</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td>DNA purification from Agorase gel</td>
		</tr>
		<tr>
			<td>QIAprep Spin Miniprep Kit</td>
			<td>Qiagen</td>
			<td>27104</td>
			<td>Plasmid DNA purification from bacteria culture</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Thermo Fisher Scientific</td>
			<td>15510-019</td>
			<td>For DNA gel electropherosis</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH5&#945; competen cell</td>
			<td>Invitrogen</td>
			<td>18-258-012</td>
			<td>For transformation of DNA ligation mixture</td>
		</tr>
		<tr>
			<td>Lennox L LB Broth</td>
			<td>Research Product International Corp.</td>
			<td>L24066-5000.0</td>
			<td>For making bacteria culture</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Thermo Fisher Scientific</td>
			<td>11593-019</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Thermo Fisher Scientific</td>
			<td>15160-054</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Thermo Fisher Scientific</td>
			<td>64-75-5</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15710-064</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH10Bac competent cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>10361-012</td>
			<td>For making bacmid DNA</td>
		</tr>
		<tr>
			<td>S.O.C. Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>15544-034</td>
			<td>For DNA transformation</td>
		</tr>
		<tr>
			<td>CellFECTIN II Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>10362-101</td>
			<td>Insect cell transfection reagent</td>
		</tr>
		<tr>
			<td>Bac-to-Bac Expression System</td>
			<td>Thermo Fisher Scientific</td>
			<td>10359-016</td>
			<td>Baculovirus-insect cells expression kit</td>
		</tr>
		<tr>
			<td>Bluo-gal</td>
			<td>Thermo Fisher Scientific</td>
			<td>15519-028</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Thermo Fisher Scientific</td>
			<td>15529-019</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>pFastBac1</td>
			<td>Thermo Fisher Scientific</td>
			<td>10360014</td>
			<td>Baculorirus expression vector</td>
		</tr>
		<tr>
			<td>Sf9 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>11496015</td>
			<td>Sf9 monolayer cells</td>
		</tr>
		<tr>
			<td>Hi5 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>B85502</td>
			<td>High Five insect cells</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, unsupplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11595030</td>
			<td>Sf9 cell transfection minimum medium</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, supplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11605102</td>
			<td>Sf9 monolayer cell culture complete medium</td>
		</tr>
		<tr>
			<td>Sf-900 II SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10902104</td>
			<td>Sf9 suspension cell culture medium without FBS</td>
		</tr>
		<tr>
			<td>Express Five SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10486025</td>
			<td>Hi5 cell culture medium</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td>100 ml (10,000 I.U./ml)</td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>25030081</td>
			<td>100 ml</td>
		</tr>
		<tr>
			<td>FBS Certified</td>
			<td>Thermo Fisher Scientific</td>
			<td>16000-044</td>
			<td>500 ml</td>
		</tr>
		<tr>
			<td>6-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>08-772-1B</td>
			<td>Flat-bottom</td>
		</tr>
		<tr>
			<td>150 mm plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>353025</td>
			<td>100/case</td>
		</tr>
		<tr>
			<td>1.5 ml Microcentrifuge Tubes</td>
			<td>USA Scientific</td>
			<td>1415-2500</td>
			<td>500 tubes/bag</td>
		</tr>
		<tr>
			<td>15 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1475-0511</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>50 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1500-1211</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>Ni-NTA Superflow</td>
			<td>Qiagen</td>
			<td>30430</td>
			<td>NiNTA resin</td>
		</tr>
		<tr>
			<td>pH-indicator strips</td>
			<td>EMD Millipore Corporation</td>
			<td>1.09535.0001</td>
			<td>pH 0 - 14</td>
		</tr>
	</tbody>
</table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

זה כבר אתגר עבור מדענים לבטא הפרשה האיקריוטים חומרים ללימודי הביוכימי מבניים. מערכת ביטוי בתיווך baculovirus תא חרקים היא אחת ממערכות שנועדה להביע האיקריוטים הפרשה חומרים עם מספר שינויים post-translational. הפרשה החלבונים צריכים להיות מנותב המסלולים הפרשה גליקוזילציה חלבון, היווצרות חוב דיסולפידי של שינויים post-translational אחרים. כדי לשפר את הביטוי תא חרקים הקיים של פרוטאינים צמחיים הפרשה, וקטור ביטוי baculovirus הוא שונה על-ידי התוספת של או GP67 או hemolin אות פפטיד רצף בין מקדם אתרים שכפול מרובה. מערכת זו וקטור שונה שעוצבו לאחרונה הפיקה בהצלחה תשואה גבוהה של חלבונים מסיסים צמח המופרש רקומביננטי קולטן של תודרנית לבנה. שני החלבונים צמח ביטוי, התחומים חוץ-תאי של קולטני ממברנה פלזמה תודרנית TDR ו- PRK3, היו גיבש ללימודי לחקר הגבישים רנטגן. מערכת וקטור ששונה הוא כלי משופרת פוטנציאל שיכול לשמש עבור הביטוי של חומרים הפרשה בממלכת החיות גם כן.

כפי שמוצג באיור1, שני וקטורים הביטוי baculovirus pFastBac1 ששונה שימשו כדי לבטא את החלבונים מופרשים עם GP67 או את רצף אות hemolin להחליף את האות מהותי רצף הגן היעד. את GP67 ויראלי, הגנים hemolin חרקים הוכחו יש רמות הביטוי הפרשת גבוהה בתאים. פיוז'ן חלבונים עם אחת משתי אלה שני סיקו...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

שינוי Baculovirus וקטורים ביטוי לייצר מופרש צמח חלבונים בתאי חרקים

כאן, אנו מציגים את הפרוטוקולים עבור ניצול של חרקים תא baculovirus חלבון ביטוי ומערכת לייצר כמויות גדולות של חלבונים צמח מופרש על התגבשות חלבון. וקטור ביטוי baculovirus השתנה עם GP67 או hemolin חרקים פפטיד אות לביטוי הפרשת חלבון צמחי בתאי חרקים.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Research

JoVE Journal

Biochemistry

11.4K Views.  North Carolina State University. כאן, אנו מציגים את הפרוטוקולים עבור ניצול של חרקים תא baculovirus חלבון ביטוי ומערכת לייצר כמויות גדולות של חלבונים צמח מופרש על התגבשות חלבון. וקטור ביטוי baculovirus השתנה עם GP67 או hemolin חרקים פפטיד אות לביטוי הפרשת חלבון צמחי בתאי חרקים.

Video: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

Thermostabilization, ביטוי, טיהור, התגבשות של Transporter סרוטונין האדם Bound כדי<em&gt; S</em&gt; -citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

בידוד, מדידות הנשימה של המיטוכונדריה מ תודרנית לבנה

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

מיצוי קפאין, פעילות אנזימטיות, ביטוי גנים של קפאין סינתאז מ המתלים תא צמח

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Dissipative Microgravimetry to Study the Binding Dynamics of the Phospholipid Binding Protein Annexin A2 to Solid-supported Lipid Bilayers Using a Quartz Resonator

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic properties of the absorbed/immobilized mass on sensor surfaces, allowing the measurements of the interaction of proteins with solid-supported surfaces, such as lipid bilayers, in real-time and with a high sensitivity. Annexins are a highly conserved group of phospholipid-binding proteins that interact reversibly with the negatively charged headgroups via the coordination of calcium ions. Here, we describe a protocol that was employed to quantitatively analyze the binding of annexin A2 (AnxA2) to planar lipid bilayers prepared on the surface of a quartz sensor. This protocol is optimized to obtain robust and reproducible data and includes a detailed step-by-step description. The method can be applied to other membrane-binding proteins and bilayer compositions.

Here, we present an experimental protocol that can be employed to determine the binding affinities and mode of interaction of label-free phospholipid-binding protein annexin A2 with immobilized solid-supported bilayers (SLB) by simultaneously measuring the mass uptake and the viscoelastic properties of the protein annexin A2.

Microgravimetry dissipative ללמוד את הדינמיקה איגוד של פוספוליפיד איגוד חלבון Annexin A2 כדי Bilayers השומנים הנתמכות על-ידי מוצק באמצעות מהוד קוורץ

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic ...

How to Quantify the Fraction of Photoactivated Fluorescent Proteins in Bulk and in Live Cells

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells and protein ensembles. Thus far, no method has been available to quantify in bulk and in live cells how many of the PA-FPs expressed are photoactivated to fluoresce.
Here, we present a protocol involving internal rulers, i.e., genetically coupled spectrally distinct (photoactivatable) fluorescent proteins, to ratiometrically quantify the fraction of all PA-FPs expressed in a cell that are switched on to be fluorescent. Using this protocol, we show that different modes of photoactivation yielded different photoactivation efficiencies. Short high-power photoactivation with a confocal laser scanning microscope (CLSM) resulted in up to four times lower photoactivation efficiency than hundreds of low-level exposures applied by CLSM or a short pulse applied by widefield illumination. While the protocol has been exemplified here for (PA-)GFP and (PA-)Cherry, it can in principle be applied to any spectrally distinct photoactivatable or photoconvertible fluorescent protein pair and any experimental set-up.

Here, we present a protocol that involves genetically coupled spectrally distinct photoactivatable and fluorescent proteins. These fluorescent protein chimeras permit quantification of the PA-FP fraction that is photoactivated to be fluorescent, i.e., the photoactivation efficiency. The protocol reveals that different modes of photoactivation yield different photoactivation efficiencies.

כיצד ניתן לכמת את השבר של Photoactivated פלורסנט חלבונים בכמות גדולה, תאים חיים

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

שימוש בהעברת אנרגיה פלורסצנטיות תהודה חוץ גופית ללמוד את הדינמיקה של חלבון מתחמי בקנה מידה הזמן אלפיות השנייה

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

ביטוי, טיהור, התגבשות ואנזים אנזימים המכילים חלבונים בתחום הידרוקלז

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Obtaining High-Quality Transcriptome Data from Cereal Seeds by a Modified Method for Gene Expression Profiling

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality RNA is often hindered by high starch and sugar content. These compounds can reduce both the yield and the quality of the extracted total RNA. The deterioration in quantity and quality of total RNA can subsequently have a significant impact on the downstream transcriptomic analyses, which may not accurately reflect the spatial and/or temporal variation in the gene expression profile of the samples being tested. In this protocol, we describe an optimized method for extraction of total RNA with sufficient quantity and quality to be used for whole transcriptome analysis of cereal grains. The described method is suitable for several downstream applications used for transcriptomic profiling of developing, germinating, and mature cereal seeds. The method of transcriptome profiling using a microarray platform is shown. This method is specifically designed for gene expression profiling of cereals with described genome sequences. The detailed procedure from microarray handling to final quality control is described. This includes cDNA synthesis, cRNA labelling, microarray hybridization, slide scanning, feature extraction, and data quality validation. The data generated by this method can be used to characterize the transcriptome of cereals during germination, in various stages of grain development, or at different biotic or abiotic stress conditions. The results presented here exemplify high-quality transcriptome data amenable for downstream bioinformatics analyses, such as the determination of differentially expressed genes (DEGs), characterisation of gene regulatory networks, and conducting transcriptome-wide association study (TWAS).

A method for transcriptome profiling of cereals is presented. The microarray-based gene expression profiling starts with the isolation of high-quality total RNA from cereal grains and continues with the generation of cDNA. After cRNA labelling and microarray hybridization, recommendations are given for signal detection and quality control.

קבלת נתונים באיכות גבוהה טראנסקריפט מזרעי דגנים על ידי שיטה שהשתנתה ליצירת פרופיל ביטוי גנים

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality ...

Transverse Sectioning of Mature Rice (Oryza sativa L.) Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm phenotyping can be used to classify genotypes based on SG morphotype using scanning electron microscopic (SEM) analysis. SGs can be visualized using SEM by slicing through the kernel (pericarp, aleurone layers, and endosperm) and exposing the organellar contents. Current methods require the rice kernel to be embedded in plastic resin and sectioned using a microtome or embedded in a truncated pipette tip and sectioned by hand using a razor blade. The former method requires specialized equipment and is time-consuming, while the latter introduces a new host of problems depending on rice genotype. Chalky rice varieties, particularly, pose a problem for this type of sectioning due to the friable nature of their endosperm tissue. Presented here is a technique for preparing translucent and chalky rice kernel sections for microscopy, requiring only pipette tips and a scalpel blade. Preparing the sections within the confines of a pipette tip prevents rice kernel endosperm from shattering (for translucent or &#8216;vitreous&#8217; phenotypes) and crumbling (for chalky phenotypes). Using this technique, endosperm cell patterning and the structure of intact SGs can be observed.

Transverse Sectioning of Mature Rice Oryza sativa L. Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

This protocol allows for the preparation of transverse sections of cereal seeds (e.g., rice) for the analysis of endosperm and starch granule morphology using scanning electron microscopy.

חתך רוחבי של אורז בוגר (Oryza sativa L.) גרעינים לסריקת הדמיית מיקרוסקופיה אלקטרונית באמצעות טיפים פיפטה כתמיכה ללא תנועה

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm ...

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

שינוי Baculovirus וקטורים ביטוי לייצר מופרש צמח חלבונים בתאי חרקים

PLAYLIST