A subscription to JoVE is required to view this content. Sign in or start your free trial.
The THP-1 cell line is widely used as a model to investigate the functions of human monocytes/macrophages across various biology-related research areas. This article describes a protocol for efficient CRISPR-Cas9-based engineering and single-cell clone isolation, enabling the production of robust and reproducible phenotypic data.
The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including their interplay with significant human pathogens such as the human immunodeficiency virus (HIV). Compared to other immortalized cell lines of myeloid origin, THP-1 cells retain many intact inflammatory signaling pathways and display phenotypic characteristics that more closely resemble those of primary monocytes, including the ability to differentiate into macrophages when treated with phorbol-12-myristate 13-acetate (PMA). The use of CRISPR-Cas9 technology to engineer THP-1 cells through targeted gene knockout (KO) provides a powerful approach to better characterize immune-related mechanisms, including virus-host interactions. This article describes a protocol for efficient CRISPR-Cas9-based engineering using electroporation to deliver pre-assembled Cas9:sgRNA ribonucleoproteins into the cell nucleus. Using multiple sgRNAs targeting the same locus at slightly different positions results in the deletion of large DNA fragments, thereby increasing editing efficiency, as assessed by the T7 endonuclease I assay. CRISPR-Cas9-mediated editing at the genetic level was validated by Sanger sequencing followed by Inference of CRISPR Edits (ICE) analysis. Protein depletion was confirmed by immunoblotting coupled with a functional assay. Using this protocol, up to 100% indels in the targeted locus and a decrease of over 95% in protein expression were achieved. The high editing efficiency makes it convenient to isolate single-cell clones by limiting dilution.
THP-1 is a human monocyte-derived cell line isolated from a patient suffering from acute leukemia (AML), which displays phenotypic features closely resembling those of primary monocytes1. As compared to primary monocyte-derived macrophages, which do not divide and display both limited lifespan and inter-/intra-donor variability in phenotype, THP-1 cells can be cultured virtually forever and have a more homogeneous behavior that favors results reproducibility2,3,4,5,6. Notably, THP-1 ....
The details of the reagents and the equipment used in this study are listed in the Table of Materials.
1. Guide design with CRISPOR (Figure 1.1)
NOTE: SnapGene Viewer software may be used in steps 4, 7, and 10 to annotate the editing target site and the location of the PCR primer hybridization within the gene of interest.
A THP-1 cell line was generated stably expressing the GFP reporter protein (THP-1_GFP) (Figure 2A) and used as a tool to establish a protocol for an efficient CRISPR-Cas9-mediated gene edition. To this aim, 3 sgRNA targeting the EGFP gene was designed with the CRISPOR web tool29 (Figure 2B), which were simultaneously complexed with Cas9 at a molar ratio of 9:1 to form RNPs before delivery into the cells by electroporation us.......
Here, a protocol is described to obtain a successful CRISPR-mediated editing of the THP-1 cell line. The approach relies on the transfer of pre-assembled sgRNA/Cas9 RNPs by electroporation/nucleofection. This strategy was chosen to limit the off-target effects that potentially arise upon lentiviral-mediated integration of the sgRNA/Cas9 cassette, yielding persistent expression of the nuclease. Multiple sgRNAs targeting the gene of interest were selected to achieve reliable and efficient editing, which increases the likel.......
All authors have no conflicts of interest.
We are grateful to JP Concordet (MNHN, U1154/UMR7196, Paris), G. Bossis (IGMM, Montpellier), and D. Schlüter (Hannover Medical School, Germany) for sharing protocols and for discussion. This project has received funding from the European Union's Horizon 2020 research and innovation program (grant agreement No 101017572 to AZ) and ANRS (grant ECTZ162721 to AZ). The Infectious Disease Model and Innovative Therapies (IDMIT) research infrastructure is supported by the "programme investissement d'avenir (PIA)" under reference ANR_11_INSB_0008.
....Name | Company | Catalog Number | Comments |
0.2 µm syringe filter | ClearLine | 146560 | _ |
0.4 % trypan blue | Beckman Coulter | 383200 | _ |
1.5 mL tube | Eppendorf | 3810X | _ |
24-well plate | Corning | 353047 | _ |
6x TriTrack DNA Loading Dye | Thermo scientific | R1161 | _ |
75 cm² Culture Flask Vented Cap | Corning | 353136 | _ |
8-Strip PCR Tubes with Caps | Life technologies | AM12230 | _ |
96-well plates Flat bottom | Corning | 353072 | _ |
96-well plates Round bottom | Corning | 353077 | _ |
Agarose | Euromedex | D5 | _ |
ATGpr | _ | _ | https://atgpr.dbcls.jp/ |
ChemiDoc Imaging System | BIO-RAD | 12003153 | _ |
Counting slide | NanoEntek | DHC-N04 | _ |
CRISPOR | _ | _ | http://crispor.gi.ucsc.edu/ |
DPBS | Gibco | 14190094 | _ |
Ensembl | EMBL-EBI | _ | https://www.ensembl.org/index.html |
Fetal Bovine Serum | Sigma-Aldrich | F7524 | _ |
FlowJo | BD Life Sciences | v10.10 | _ |
GeneRuler 100 bp Plus DNA Ladder | Thermo scientific | SM0323 | _ |
Genome Data Viewer | NCBI | _ | https://www.ncbi.nlm.nih.gov/gdv/ |
GraphPad Prism | Dotmatics | _ | Version 9.3.1 |
Herculase II Fusion DNA Polymerases | Agilent | 600679 | _ |
ICE CRISPR Analysis Tool | Synthego | _ | https://www.synthego.com/products/bioinformatics/crispr-analysis |
Image Lab Touch | BIO-RAD | _ | Version 2.4.0.03 |
NEBuffer 2 | New England Biolabs | B7002S | Included with T7EI M0302S |
Neon Kit, 10 µL | Invitrogen | MPK1025K | Electroporation kit containing tips, tubes, buffer R and E |
Neon Transfection System | Invitrogen | MPK5000 | _ |
NetStart 1.0 | _ | _ | https://services.healthtech.dtu.dk/services/NetStart-1.0/ |
Nuclease-free Water | Synthego | _ | _ |
PCR primer (EGFP) | Eurofins | _ | Fw : GGAATGCAAGGTCTGTTGAATG ; Rev : CACCTTGATGCCGTTCTTCT |
PCR primer (SAMHD1) | Eurofins | _ | Fw : CGGGATTGATTTGAGGACGA ; Rev : GGGTGGCAAGTTAGTGAAGA |
Penicillin-streptomycin (10,000 U/mL) | Gibco | 15140122 | _ |
PFA | Electron Microscopy Sciences | 15714 | _ |
PMA | Sigma-Aldrich | P8139 | _ |
PrimerQuest | IDT | _ | https://eu.idtdna.com/pages/tools/primerquest |
QIAquick PCR Purification Kit | Qiagen | 28104 | _ |
QuickExtract DNA Extraction Solution | Biosearch Technologies | QE09050 | _ |
RPMI 1640, GlutaMAX | Gibco | 61870010 | _ |
SnapGene Viewer | Dotmatics | _ | Version 7 |
SpCas9 2NLS Nuclease | Synthego | _ | _ |
SYBR Safe DNA Gel Stain | Invitrogen | S33102 | _ |
Synthetic sgRNA (EGFP) | Synthego | _ | #1 : CGCGCCGAGGUGAAGUUCGA ; #2 : UUCAAGUCCGCCAUGCCCGA ; #3 : CAACUACAAGACCCGCGCCG |
Synthetic sgRNA (SAMHD1) | Synthego | _ | #1 : AUCGCAACGGGGACGCUUGG ; #2 : GCAGUCAAGAACCUCGGCGC ; #3 : CCAUCCCGACUACAAGACAU |
Syringe Plastipak Luer Lock | BD | 301229 | _ |
T100 Thermal Cycler | BIO-RAD | 1861096 | _ |
T7 endonuclease I | New England Biolabs | M0302S | _ |
TAE buffer UltraPure, 10x | Invitrogen | 15558026 | 400 mM Tris-Acetate, 10 mM EDTA |
THP-1 cells | ATCC | TIB-202 | _ |
Trypsin-EDTA (0,05 %) | Gibco | 25300054 | _ |
ZE5 Cell Analyzer | BIO-RAD | 12014135 | _ |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
ISSN 2689-3649
Copyright © 2025 MyJoVE Corporation. All rights reserved
We use cookies to enhance your experience on our website.
By continuing to use our website or clicking “Continue”, you are agreeing to accept our cookies.