Name: synthesis and characterization of an aspirin-fumarate prodrug that inhibits nf&#954;b activity and breast cancer stem cells
Uploaded: 2017-01-18T12:30:00
Description: Watch this Scientific Journal Video about Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFÎºB Activity and Breast Cancer Stem Cells at JoVE.com

This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).

1. Synthesis of Aspirin-fumarate Prodrug GTCpFE
<ol>
	<li>Using a plastic plunger syringe, measure 0.81 ml (20 mmol) of methanol and mix it in water (10 ml) in a round bottom flask. Cool the resulting mixture to 0 &#176;C by placing the flask in an ice-water bath. Add 4-hydroxybenzyl alcohol (2.48 mg, 20 mmol) and stir the reaction mixture until the solution is clear.</li>
	<li>Prepare a solution of O-acetylsalicyloyl chloride (3.77 mg, 19 mmol) in anhydrous toluene (10 ml) by weighing the desired amount of <e...

<ol>
	<li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Cuzick, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aspirin+and+non-steroidal+anti-inflammatory+drugs+for+cancer+prevention:+an+international+consensus+statement.">Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement.</a> Lancet Oncol. 10, 501-507 (2009).</li><li>Terry, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+of+frequency+and+duration+of+aspirin+use+and+hormone+receptor+status+with+breast+cancer+risk.">Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk.</a> JAMA. 291, 2433-2440 (2004).</li><li>Wang, D., Dubois, R. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclooxygenase-2:+a+potential+target+in+breast+cancer.">Cyclooxygenase-2: a potential target in breast cancer.</a> Semin Oncol. 31, 64-73 (2004).</li><li>Howe, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammation+and+breast+cancer.+Cyclooxygenase/prostaglandin+signaling+and+breast+cancer.">Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer.</a> Breast Cancer Res. 9. 9, 210 (2007).</li><li>Kopp, E., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+NF-kappa+B+by+sodium+salicylate+and+aspirin.">Inhibition of NF-kappa B by sodium salicylate and aspirin.</a> Science. 265, 956-959 (1994).</li><li>Yin, M. J., Yamamoto, Y., Gaynor, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+anti-inflammatory+agents+aspirin+and+salicylate+inhibit+the+activity+of+I(kappa)B+kinase-beta.">The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta.</a> Nature. 396, 77-80 (1998).</li><li>Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salicylates+inhibit+I+kappa+B-alpha+phosphorylation,+endothelial-leukocyte+adhesion+molecule+expression,+and+neutrophil+transmigration.">Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration.</a> J Immunol. 156, 3961-3969 (1996).</li><li>Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NFkappaB+affects+estrogen+receptor+expression+and+activity+in+breast+cancer+through+multiple+mechanisms.">NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms.</a> Mol Cell Endocrinol. 418, 235-239 (2014).</li><li>Perkins, N. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diverse+and+complex+roles+of+NF-kappaB+subunits+in+cancer.">The diverse and complex roles of NF-kappaB subunits in cancer.</a> Nat Rev Cancer. 12, 121-132 (2012).</li><li>DiDonato, J. A., Mercurio, F., Karin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NF-kappaB+and+the+link+between+inflammation+and+cancer.">NF-kappaB and the link between inflammation and cancer.</a> Immunol Rev. 246, 379-400 (2012).</li><li>Scarpignato, C., Hunt, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonsteroidal+antiinflammatory+drug-related+injury+to+the+gastrointestinal+tract:+clinical+picture,+pathogenesis,+and+prevention.">Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention.</a> Gastroenterol Clin North Am. 39, 433-464 (2010).</li><li>Sostres, C., Gargallo, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastrointestinal+lesions+and+complications+of+low-dose+aspirin+in+the+gastrointestinal+tract.">Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract.</a> Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).</li><li>Kastrati, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethyl+Fumarate+Inhibits+the+Nuclear+Factor+kappaB+Pathway+in+Breast+Cancer+Cells+by+Covalent+Modification+of+p65+Protein.">Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein.</a> J Biol Chem. 291, 3639-3647 (2016).</li><li>Kastrati, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+aspirin+prodrug+inhibits+NFkappaB+activity+and+breast+cancer+stem+cell+properties.">A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties.</a> BMC Cancer. 15, 845 (2015).</li><li>Cao, Y., Luo, J. L., Karin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IkappaB+kinase+alpha+kinase+activity+is+required+for+self-renewal+of+ErbB2/Her2-transformed+mammary+tumor-initiating+cells.">IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells.</a> Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).</li><li>Liu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+canonical+NF-kappaB+pathway+governs+mammary+tumorigenesis+in+transgenic+mice+and+tumor+stem+cell+expansion.">The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion.</a> Cancer Res. 70, 10464-10473 (2010).</li><li>Korkaya, H., Liu, S., Wicha, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+cancer+stem+cells+by+cytokine+networks:+attacking+cancer's+inflammatory+roots.">Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots.</a> Clin Cancer Res. 17, 6125-6129 (2011).</li><li>Hinohara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ErbB+receptor+tyrosine+kinase/NF-kappaB+signaling+controls+mammosphere+formation+in+human+breast+cancer.">ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer.</a> Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).</li><li>Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Canonical+and+non-canonical+NF-kappaB+signaling+promotes+breast+cancer+tumor-initiating+cells.">Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells.</a> Oncogene. 33, 1297-1305 (2014).</li><li>Yamamoto, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NF-kappaB+non-cell-autonomously+regulates+cancer+stem+cell+populations+in+the+basal-like+breast+cancer+subtype.">NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype.</a> Nat Commun. 4, 2299 (2013).</li><li>Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+RNA+using+TRIzol+(TRI+reagent).">Purification of RNA using TRIzol (TRI reagent).</a> Cold Spring Harb Protoc. , (2010).</li><li>Frasor, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positive+cross-talk+between+estrogen+receptor+and+NF-kappaB+in+breast+cancer.">Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer.</a> Cancer Res. 69, 8918-8925 (2009).</li><li>Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+identification+of+tumorigenic+breast+cancer+cells.">Prospective identification of tumorigenic breast cancer cells.</a> Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).</li><li>Vandermeeren, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+is+an+inhibitor+of+cytokine-induced+nuclear+translocation+of+NF-kappa+B1,+but+not+RelA+in+normal+human+dermal+fibroblast+cells.">Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells.</a> J Invest Dermatol. 116, 124-130 (2001).</li><li>Loewe, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+inhibits+TNF-induced+nuclear+entry+of+NF-kappa+B/p65+in+human+endothelial+cells.">Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells.</a> J Immunol. 168, 4781-4787 (2002).</li><li>Seidel, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+inhibits+NF-{kappa}B+function+at+multiple+levels+to+limit+airway+smooth+muscle+cell+cytokine+secretion.">Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion.</a> Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).</li><li>Wilms, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+inhibits+microglial+and+astrocytic+inflammation+by+suppressing+the+synthesis+of+nitric+oxide,+IL-1beta,+TNF-alpha+and+IL-6+in+an+in-vitro+model+of+brain+inflammation.">Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation.</a> J Neuroinflammation. 7, 30 (2010).</li><li>Peng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethyl+fumarate+inhibits+dendritic+cell+maturation+via+nuclear+factor+kappaB+(NF-kappaB)+and+extracellular+signal-regulated+kinase+1+and+2+(ERK1/2)+and+mitogen+stress-activated+kinase+1+(MSK1)+signaling.">Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling.</a> J Biol Chem. 287, 28017-28026 (2012).</li><li>Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer-stimulated+mesenchymal+stem+cells+create+a+carcinoma+stem+cell+niche+via+prostaglandin+E2+signaling.">Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling.</a> Cancer Discov. 2, 840-855 (2012).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+resistance+of+tumorigenic+breast+cancer+cells+to+chemotherapy.">Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy.</a> J Natl Cancer Inst. 100, 672-679 (2008).</li><li>Diehn, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+of+reactive+oxygen+species+levels+and+radioresistance+in+cancer+stem+cells.">Association of reactive oxygen species levels and radioresistance in cancer stem cells.</a> Nature. 458, 780-783 (2009).</li><li>Hollier, B. G., Evans, K., Mani, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-to-mesenchymal+transition+and+cancer+stem+cells:+a+coalition+against+cancer+therapies.">The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies.</a> J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).</li><li>Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+breast+cancer+stem+cells+in+metastasis+and+therapeutic+implications.">The role of breast cancer stem cells in metastasis and therapeutic implications.</a> Am J Pathol. 179, 2-11 (2011).</li><li>Dontu, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+propagation+and+transcriptional+profiling+of+human+mammary+stem/progenitor+cells.">In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells.</a> Genes Dev. 17, 1253-1270 (2003).</li><li>Charafe-Jauffret, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells+in+breast:+current+opinion+and+future+challenges.">Cancer stem cells in breast: current opinion and future challenges.</a> Pathobiology. 75, 75-84 (2008).</li><li>Clayton, H., Titley, I., Vivanco, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+differentiation+of+progenitor/stem+cells+derived+from+the+human+mammary+gland.">Growth and differentiation of progenitor/stem cells derived from the human mammary gland.</a> Exp Cell Res. 297, 444-460 (2004).</li><li>Ginestier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALDH1+is+a+marker+of+normal+and+malignant+human+mammary+stem+cells+and+a+predictor+of+poor+clinical+outcome.">ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome.</a> Cell Stem Cell. 1, 555-567 (2007).</li><li>Rosen, J. M., Jordan, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+increasing+complexity+of+the+cancer+stem+cell+paradigm.">The increasing complexity of the cancer stem cell paradigm.</a> Science. 324, 1670-1673 (2009).</li><li>Visvader, J. E., Lindeman, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells+in+solid+tumours:+accumulating+evidence+and+unresolved+questions.">Cancer stem cells in solid tumours: accumulating evidence and unresolved questions.</a> Nat Rev Cancer. 8, 755-768 (2008).</li></ol>

In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NF&#312;B activity in breast cancer cells. GTCpFE is an effective NF&#312;B inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NF&#312;B signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal...

Inflammation is a hallmark that underlies multiple aspects of tumorigenesis, such as incidence and promotion, and eventually progression to metastasis1. In breast cancer, this is further supported by epidemiological observations showing that regular use of the classical non-steroidal anti-inflammatory drug aspirin (acetyl salicylic acid, ASA) is associated with a reduction in both breast cancer incidence, and risk of metastasis and recurrence2,3. ASA acts primarily by inhibiting cyclooxygenase-2 activity, which is often upregulated in breast cancer4,5. However, the anti-cancer effects of ASA may also be mediated by suppressing aberrant nuclear factor &#954;B (NF&#954;B) signaling6-8. This is important because a deregulated NF&#954;B pathway promotes tumor cell survival, proliferation, migration, invasion, angiogenesis, and resistance to therapy9-11. NF&#954;B pathway activation is also critical for mounting an immune response. Therefore, for anti-cancer therapy where prolonged NF&#954;B inhibition is required, one must consider the detrimental side effects involving long-lasting immune suppression. Hence, ASA may serve as a good starting point for therapeutic optimization.
One limitation for ASA application in cancer therapy is the elevated doses required for cyclooxygenase 2 and NF&#954;B inhibition, which are associated with gastrointestinal toxicity, such as ulcers and stomach bleeding12,13. However, converting ASA into as ester prodrug, may reduce ASA&#39;s gastrointestinal toxicity. To further enhance potency and/or add functionality, additional structural elements or ancillary pharmacophores may also be incorporated into ester prodrug design. One such pharmacophore added to enhance ASA potency against the NF&#954;B pathway is fumarate, which we have previously shown to be important for NF&#954;B pathway inhibition14,15.
We synthesized an aspirin-fumarate prodrug15, GTCpFE, and hypothesized that such hybrid molecule would be safe yet potent against the NF&#954;B pathway. We tested its anti-NF&#954;B activity in breast cancer cells and its ability to block breast cancer stem cells (CSCs)15, which rely on NF&#954;B signaling for survival and growth16-21. We find that the potency of GTCpFE against the NF&#954;B pathway is significantly improved over ASA15. In addition, GTCpFE blocks mammosphere formation and attenuates the CSC surface marker CD44+CD24- immunophenotype, indicating that GTCpFE is capable of eradicating CSCs15. These results establish the aspirin-fumarate prodrug as an effective anti-inflammatory agent that can also target breast CSCs. In terms of breast cancer therapy, GTCpFE may have the potential to treat aggressive and deadly disease.

<table border="0" cellpadding="0" cellspacing="0" width="663">
	<tbody>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">RPMI 1640 Red Medium</td>
			<td style="width:123px;">Life Technologies&#160;</td>
			<td style="width:119px;">11875-093</td>
			<td style="width:205px;">Warm up to 37&#176;C before use</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">IMEM</td>
			<td style="width:123px;">Corning</td>
			<td style="width:119px;">10-024-CV</td>
			<td style="width:205px;">Warm up to 37&#176;C before use</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">DMEM / F12 Medium</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">21041-025</td>
			<td style="width:205px;">Warm up to 37&#176;C before use</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">MEM NEAA 10mM 100X</td>
			<td style="width:123px;">Life Technologies&#160;</td>
			<td style="width:119px;">11140</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Penicillin Streptomycin</td>
			<td style="width:123px;">Life Technologies&#160;</td>
			<td style="width:119px;">15140-122</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">L-Glutamine 100X</td>
			<td style="width:123px;">Life Technologies&#160;</td>
			<td style="width:119px;">25030-081</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Insulin</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:123px;">Atlanta Biologicals</td>
			<td style="width:119px;">S11150</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Trypsin 2.5% 10X</td>
			<td style="width:123px;">Invitrogen</td>
			<td style="width:119px;">15090046</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Methyl Cellulose</td>
			<td style="width:123px;">Sigma&#160;</td>
			<td style="width:119px;">M0262</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">B27 Supplement 50X</td>
			<td style="width:123px;">Gibco</td>
			<td style="width:119px;">17504-044</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">EGF</td>
			<td style="width:123px;">Gibco</td>
			<td style="width:119px;">PHG0311L</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">NF&#954;B-RE Luciferase Construct&#160;</td>
			<td>Clontech&#160;</td>
			<td style="width:119px;">pGL4.32</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">Renilla Luciferase Construct&#160;</td>
			<td style="width:123px;">Promega</td>
			<td style="width:119px;">pGL4.70</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Lipofectamine 2000</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">11668-019</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Dual-Luciferase Reporter Assay&#160;</td>
			<td style="width:123px;">Promega</td>
			<td style="width:119px;">120000032</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">NanoDrop Spectrophotometer</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">Eppendorf Mastercycler&#160;</td>
			<td style="width:123px;">Eppendorf</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">StepOne Real Time PCR System</td>
			<td style="width:123px;">Thermo Scientific</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">Eclipse Microscope</td>
			<td style="width:123px;">Nikon</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">CyAn ADP Analyzer&#160;</td>
			<td style="width:123px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">QCapture Software</td>
			<td style="width:123px;">QImaging</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">Summit Software</td>
			<td style="width:123px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">GraphPad Software</td>
			<td style="width:123px;">Prism</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">TRIzol</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">M-MLV Reverse Transcriptase</td>
			<td style="width:123px;">Invitrogen</td>
			<td style="width:119px;">28025-013</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">100 mM dNTP Set</td>
			<td style="width:123px;">Invitrogen</td>
			<td style="width:119px;">10297-018</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Random Hexamers&#160;</td>
			<td style="width:123px;">Invitrogen</td>
			<td style="width:119px;">48190-011</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Fast SYBR Green Master Mix</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">4385612</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Costar 96W, ultra low attachment&#160;</td>
			<td style="width:123px;">Corning</td>
			<td style="width:119px;">3474</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">HBSS, 1X</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">14025134</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">CD44-APC conjugated antibody&#160;</td>
			<td style="width:123px;">BD Pharmingen</td>
			<td style="width:119px;">560990</td>
			<td style="width:205px;">Store at 4&#176;C, protect from light</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">CD24-PE antibody</td>
			<td style="width:123px;">BD Pharmingen</td>
			<td style="width:119px;">560991</td>
			<td style="width:205px;">Store at 4&#176;C, protect from light</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Recombinant Human TNF&#945;</td>
			<td style="width:123px;">Fisher</td>
			<td style="width:119px;">210TA100&#160;</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">CCL2 Primer Forward Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">AGAATCACCAGCAGCAAGTGTCC</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">CCL2 Primer Reverse Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">TCCTGAACCCACTTCTGCTTGG</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">ICAM1 Primer Reverse Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">TGACGAAGCCAGAGGTCTCAG</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">ICAM1 Primer Forward Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">AGCGTCACCTTGGCTCTAGG</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">TNF Primer Forward Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">AAGGGTGACCGACTCAGCG</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">TNF Primer Reverse Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">ATCCCAAAGTAGACCTGCCCA</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">36B4 Primer Forward Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">GTGTTCGACAATGGCAGCAT</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">36B4 Primer Reverse Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">GACACCCTCCAGGAAGCGA</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Sodium Hydroxide</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">S5881-500G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">4-Hydroxybenzyl Alcohol</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">20806-10G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">O-Acetylsalicyloyl Chloride</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">165190-5G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Phosphorous Pentoxide</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">79610-100G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Ethyl Fumaroyl Chloride</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">669695-1G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Sodium Sulfate</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">246980-500G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">4-Dimethylaminopyridine</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">714844-100ML</td>
			<td style="width:205px;">0.5&#160;M in tetrahydrofuran</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Triethylamine</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">T0886-100ML</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Toluene</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">244511-100ML</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Ethyl Acetate</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">270989-100ML</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Tetrahydrofuran</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">401757-2L</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:216px;">400 MHz FT NMR spectrometer&#160;</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">See Bruker&#8217;s Avance User&#8217;s Manual, version 000822 for details</td>
		</tr>
	</tbody>
</table>

synthesis and characterization of an aspirin-fumarate prodrug that inhibits nf&#954;b activity and breast cancer stem cells

Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an anti-inflammatory drug to standard cancer regiments may improve patient outcome. One such drug, aspirin (acetylsalicylic acid, ASA), has been explored for cancer chemoprevention and anti-tumor activity. Besides inhibiting the cyclooxygenase 2-prostaglandin axis, ASA&#39;s anti-cancer activities have also been attributed to nuclear factor &#312;B (NF&#312;B) inhibition. Because prolonged ASA use may cause gastrointestinal toxicity, a prodrug strategy has been implemented successfully. In this prodrug design the carboxylic acid of ASA is masked and additional pharmacophores are incorporated.
This protocol describes how we synthesized an aspirin-fumarate prodrug, GTCpFE, and characterized its inhibition of the NF&#312;B pathway in breast cancer cells and attenuation of the cancer stem-like properties, an important NF&#312;B-dependent phenotype. GTCpFE effectively inhibits the NF&#312;B pathway in breast cancer cell lines whereas ASA lacks any inhibitory activity, indicating that adding fumarate to ASA structure significantly contributes to its activity. In addition, GTCpFE shows significant anti-cancer stem cell activity by blocking mammosphere formation and attenuating the cancer stem cell associated CD44+CD24- immunophenotype. These results establish a viable strategy to develop improved anti-inflammatory drugs for chemoprevention and cancer therapy.

In Figure 1, the chemical structure of aspirin-fumarate prodrug, GTCpFE, and its inhibitory activity on cytokine induced NF&#312;B pathway in breast cancer cells are indicated. GTCpFE inhibits both NF&#312;B endpoints, NF&#312;B-RE luciferase activity (Figure 1B) and expression of NF&#312;B target genes, such as Intercellular Adhesion Molecule 1 (ICAM1), Chemokine C-C Motif Ligand 2 (CCL2), and Tumor Necrosis Factor (TNF) (Figure 1C) in M...

Watch this Scientific Journal Video about Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFÎºB Activity and Breast Cancer Stem Cells at JoVE.com

Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NF&#954;B Activity and Breast Cancer Stem Cells

This procedure will demonstrate how we synthesized and characterized the anti-NF&#954;B and anti-cancer stem cell activity of an aspirin-fumarate prodrug.

Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an ...

The overall goals of this procedure are to demonstrate how the anti-inflammatory aspirin-fumarate prodrug GTCpFE is synthesized, and how it improves anti-NFkappaB and anti-cancer stem cell activity in breast cancer cells. This method can help answer key questions in the cancer therapeutics field by showing how we can repurpose or even improve anti-inflammatory drugs to target therapy resistant breast cancer stem cells. The main advantage of this technique is that we utilize the multidisciplinary approach to obtain and characterize the improved aspirin-fumarate prodrug.Demonstrating the synthesis of the aspirin-fumarate prodrug GTCpFE will be Loruhama Delgado-Rivera, a graduate student in Dr.Gregory Thatcher's laboratory. Whereas the anti-NFkappaB activity of GTCpFE in breast cancer cells will be demonstrated by Gergana Georgieva, a pharmacy student researcher in Dr.Jonna Frasor's laboratory. Using a plastic plunger syringe, measure 0.81 milliliters of methanol and mix it in 10 milliliters of water in a round-bottom flask.Cool the resulting mixture to zero degrees Celsius by placing the flask in an ice water bath. Add 2.48 milligrams of 4-hydroxybenzyl alcohol to the reaction mixture. Stir until the solution is clear.Next, prepare a solution of O-acetylsalicyloyl chloride in anhydrous toluene by dissolving the solute in the solvent in a separate flask. Using a plastic plunger syringe add this solution to the 4-hydroxybenzyl alcohol mixture and leave the reaction stirring at zero degrees celsius. Monitor the reaction using thin-layer chromatography, or TLC, as described in the text protocol.When the reaction is complete remove the ice water bath and allow the reaction to stir at room temperature for 20 hours. Filter the precipitate using a Buchner funnel with a fritted disc of medium porosity. Then, place the solid in a scintillation vial and leave the compound in vacuo overnight in a desiccator at room temperature.Next, seal a thoroughly dried round-bottom flask with a septum and pierce it with a needle that is connected to a vacuum pump system. Inflate a balloon using argon gas and connect it to a plastic syringe with a needle. Insert the needle connected to the argon balloon through the septum sealing the round-bottom flask and remove the needle connected to the vacuum pump.Then, add 4-hydroxymethyl-phenyl ester, of 2-acetyloxybenzoic acid, 4-dimethylaminopyridine and trimethylamine to a separate flask. Dissolve the chemicals in five milliliters of anhydrous tetrahydrofuran. With a plastic syringe attached to a needle add the solution to the sealed round-bottom flask.Cool the mixture down to zero degrees Celsius by placing the flask in an ice water bath. To the previous mixture, add a solution of ethyl fumaroyl chloride and anhydrous tetrahydrofuran dropwise over a period of 10 minutes. Stir the resulting mixture for two to four hours monitoring the reaction by TLC as described in the protocol.Extract the reaction mixture by adding it to a separatory funnel along with 100 milliliters of ethyl acetate and 50 milliliters of brine. Cap the funnel and shake it vigorously. Tilting the funnel to the side of the cap, slowly open the valve to allow air to escape.Once the extraction is complete, remove the aqueous phase and repeat the extraction two more times. After removing the aqueous phase, dry the mixture by adding sodium sulfate to the organic phase until the solid does not clump up when the glassware is stirred. Using another Buchner funnel with a fritted disk filter the mixture to a round-bottom flask to remove the sodium sulfate.Then, evaporate to dryness using a rotary evaporator with the temperature set at 40 degrees celsius. Next, prepare a column with silica gel and the appropriate solvent phase. Once the compound has been added, add a layer of sodium sulfate to protect the column as the solvent is added.As the column runs, monitor the eluate by TLC. Spot every other test tube as they are collected from the column. When the product of interest dilutes, mix all the samples containing pure product into a large round-bottom flask.Dry the products using a rotary evaporator with the bath temperature set at 40 degrees celsius. Perform cell culture and transfect the cells with DNA for the NFkappaB response element luciferase reporter assay as described in the text protocol. Then dissolve drug stock solutions of the GTCpFE or aspirin drugs in dimethyl sulfoxide at 1000x concentration.After 16 hours of transfection and 1 microliter of vehicle or different drug stock solutions to each well. After adding the drugs, incubate the cells for two hours at 37 degrees Celsius. To activate the NFkappaB pathway, at the proinflammatory cytokine, TNFalpha, into each well for a final concentration of 10 nanograms per milliliter.Also include a TNFalpha alone control. After incubating the cells for four hours at 37 degrees Celsius, aspirate the medium. Store the cells at minus 80 degrees Celsius.Measure luciferase using a luciferase reporter assay system according the manufacturer's instructions. To perform the mammosphere assay, first prepare mammosphere medium as described in the text protocol. Next prepare singles cells of the MDA-MB-231 cell line by trypsin digestion of monolayer cultures and filter through mesh sieves.After manually counting the single dissociated cells, plate them in 96 well ultra low attachment plates at a density of 400 cells per well. Then place the cells in the incubator at 37 degrees Celsius overnight. The next day, add different concentrations of GTCpFE to a final volume of 100 microliters.Conduct every treatment in triplicate. After seven days of culture in the incubator at 37 degrees Celsius, acquire images via imaging software using an inverted microscope. Manually count the number of mammospheres greater than 75 microns in diameter.To measure the CD44 high, CD24 low cancer stem cell immunophenotype, trypsonize MDA-MB-231 cells with 0.25%trypsin for five minutes at 37 degrees Celsius. After counting the cells using a hemocytometer, seed the cells at three million cells per dish in 10 milliliter of medium as described in the text protocol. Then add vehicle or GTCpFE to the cells and incubate at 37 degrees Celsius for 72 hours.Following incubation trypsinize the cells and distribute one million trypsinized cells in five milliliter polystyrene tubes. The tubes should contain two milliliters of 1x HBSS buffer supplemented with 2%FBS and be labeled as test or control. To stain for the surface marker CD44 and CD24, spin the cells down, aspirate the buffer, then add 20 microliters of each conjugated antibody and 80 microliters of the HBSS buffer to test tubes for a final volume of 100 microliters.Next, add 100 microliters of the same buffer to the control tubes. Also include CD44 APC-conjugated antibody and CD24 PE antibody single stained contols or the ITG immuno isotype controls. Incubate the cells in the dark at four degrees Celsius for 30 minutes.Spin down the cells for five minutes at 400 times g and reconstitute them in 200 microliters of buffer. Keep the cells on ice and in the dark. FACS analysis can now be performed.GTCpFE inhibits NFkappaB-RE luciferase activity and expression of NFkappaB target genes, such as Intercellular Adhesion Molecule 1, Chemokine C-C Motif Ligand 2, and Tumor Necrosis Factor in MCF-7 breast cancer cells. The calculated inhibitory concentration at 50%of both endpoints is approximately 20 micromolar GTCpFE. By comparison, 200 micromolar aspirin shows no inhibitory activity in breast cancer cells.This indicates that the prodrug strategy of adding the Fumarate pharmacore to aspirin significantly improves it's anti-NFkappaB activity. GTCpFE inhibits mammosphere formation of MDA-MB-231 breast cancer cells in a dose dependent manner. Similar to NFkappaB pathway inhibition in adherent cultures, the IC50 value for mammosphere formation is approximately 20 micromolar.Also measured was the population of cells expressing the CD44 high, CD24 low immunophenotype which is a bonafide cancer stem cell surface marker in breast cancer. GTCpFE pretreament resulted in a significant depletion of the CD44 high, CD24 low population in MDA-MB-231 cells. Together these results establish GTCpFE's ability to effectively target breast cancer stem cells.After watching this video, you should have a good understanding of how the design and synthesize in aspirin fumarate prodrug and how to characterize its anti-NFkappaB and anti-cancer stem cell activity on breast cancer cells. We first had the idea for this method when aspirin failed to inhibit the NFkappaB pathway in breast cancer cells as it was previously reported in the literature. The implications of this technique extend toward anti-cancer stem cell therapy, because we showed that by targeting multiple proinflammatory pathways we can in fact, effectively eradicate breast cancer stem cells.Although this method can provide insight into how to design and synthesize and characterize anti-inflammatory agents in breast cancer, this can be applied to other malignancies where multiple proinflammatory pathways are active and contribute to the pathology of the disease. Following this procedure, other methods such as the aldefluor assay and in vivo tumorigenicity can be utilized in order to asses the effect of the drug on breast cancer stem cells. The technique can pave the way for researchers in cancer therapeutics to explore prodrug design of antiinflammatory agents.GTCpFE may serve as a prototype for developing new fumarate and aspirin based antiinflammatory agents. And this could also be the basis of a new class of anti-cancer stem cell agents.

synthesis-characterization-an-aspirin-fumarate-prodrug-that-inhibits

Research

JoVE Journal

Cancer Research

Invasive Behavior of Human Breast Cancer Cells in Embryonic Zebrafish

In many cases, cancer patients do not die of a primary tumor, but rather because of metastasis. Although numerous rodent models are available for studying cancer metastasis in vivo, other efficient, reliable, low-cost models are needed to quickly access the potential effects of (epi)genetic changes or pharmacological compounds. As such, we illustrate and explain the feasibility of xenograft models using human breast cancer cells injected into zebrafish embryos to support this goal. Under the microscope, fluorescent proteins or chemically labeled human breast cancer cells are transplanted into transgenic zebrafish embryos, Tg (fli:EGFP), at the perivitelline space or duct of Cuvier (Doc) 48 h after fertilization. Shortly afterwards, the temporal-spatial process of cancer cell invasion, dissemination, and metastasis in the living fish body is visualized under a fluorescent microscope. The models using different injection sites, i.e., perivitelline space or Doc are complementary to one another, reflecting the early stage (intravasation step) and late stage (extravasation step) of the multistep metastatic cascade of events. Moreover, peritumoral and intratumoral angiogenesis can be observed with the injection into the perivitelline space. The entire experimental period is no more than 8 days. These two models combine cell labeling, micro-transplantation, and fluorescence imaging techniques, enabling the rapid evaluation of cancer metastasis in response to genetic and pharmacological manipulations.

Here, we describe xenograft zebrafish models using two different injection sites, i.e., perivitelline space and duct of Cuvier, to investigate the invasive behavior and to assess the intravasation and extravasation potential of human breast cancer cells, respectively.

In many cases, cancer patients do not die of a primary tumor, but rather because of metastasis. Although numerous rodent models are available for studying ...

Synthesis and Characterization of Placental Chondroitin Sulfate A (plCSA)-Targeting Lipid-Polymer Nanoparticles

An effective cancer therapeutic method reduces and eliminates tumors with minimal systemic toxicity. Actively targeting nanoparticles offer a promising approach to cancer therapy. The glycosaminoglycan placental chondroitin sulfate A (plCSA) is expressed on a wide range of cancer cells and placental trophoblasts, and malarial protein VAR2CSA can specifically bind to plCSA. A reported placental chondroitin sulfate A binding peptide (plCSA-BP), derived from malarial protein VAR2CSA, can also specifically bind to plCSA on cancer cells and placental trophoblasts. Hence, plCSA-BP-conjugated nanoparticles could be used as a tool for targeted drug delivery to human cancers and placental trophoblasts. In this protocol, we describe a method to synthesize plCSA-BP-conjugated lipid-polymer nanoparticles loaded with doxorubicin (plCSA-DNPs); the method consists of a single sonication step and bioconjugate techniques. In addition, several methods for characterizing plCSA-DNPs, including determining their physicochemical properties and cellular uptake by placental choriocarcinoma (JEG3) cells, are described.

Synthesis and Characterization of Placental Chondroitin Sulfate A plCSA-Targeting Lipid-Polymer Nanoparticles

Here, we present a protocol for the synthesis of placental chondroitin sulfate A binding peptide (plCSA-BP)-conjugated lipid-polymer nanoparticles via single-step sonication and bioconjugate techniques. These particles constitute a novel tool for the targeted delivery of therapeutics to most human tumors and placental trophoblasts to treat cancers and placental disorders.

An effective cancer therapeutic method reduces and eliminates tumors with minimal systemic toxicity. Actively targeting nanoparticles offer a promising ...

Flow Cytometric Detection of Newly-formed Breast Cancer Stem Cell-like Cells After Apoptosis Reversal

Cancer recurrence has long been studied by oncologists while the underlying mechanisms remain unclear. Recently, we and others found that a phenomenon named apoptosis reversal leads to increased tumorigenicity in various cell models under different stimuli. Previous studies have been focused on tracking this process in vitro and in vivo; however, the isolation of real reversed cells has yet to be achieved, which limits our understanding on the consequences of apoptosis reversal. Here, we take advantage of a Caspase-3/7 Green Detection dye to label cells with activated caspases after apoptotic induction. Cells with positive signals are further sorted out by fluorescence-activated cell sorting (FACS) for recovery. Morphological examination under confocal microscopy helps confirm the apoptotic status before FACS. An increase in tumorigenicity can often be attributed to the elevation in the percentage of cancer stem cell (CSC)-like cells. Also, given the heterogeneity of breast cancer, identifying the origin of these CSC-like cells would be critical to cancer treatment. Thus, we prepare breast non-stem cancer cells before triggering apoptosis, isolating caspase-activated cells and performing the apoptosis reversal procedure. Flow cytometry analysis reveals that breast CSC-like cells re-appear in the reversed group, indicating breast CSC-like cells are transited from breast non-stem cancer cells during apoptosis reversal. In summary, this protocol includes the isolation of apoptotic breast cancer cells and detection of changes in CSC percentage in reversed cells by flow cytometry.

Here, we present a protocol to isolate apoptotic breast cancer cells by fluorescence-activated cell sorting and further detect the transition of breast non-stem cancer cells to breast cancer stem cell-like cells after apoptosis reversal by flow cytometry.

Cancer recurrence has long been studied by oncologists while the underlying mechanisms remain unclear. Recently, we and others found that a phenomenon ...

Establishment and Characterization of Three Afatinib-resistant Lung Adenocarcinoma PC-9 Cell Lines Developed with Increasing Doses of Afatinib

Acquired resistance to molecular target inhibitors is a severe problem in cancer therapy. Lung cancer remains the leading cause of cancer-related death in most countries. The discovery of "oncogenic driver mutations," such as epidermal growth factor receptor (EGFR)-activating mutations, and subsequent development of molecular targeted agents of EGFR tyrosine kinase inhibitors (TKIs) (gefitinib, erlotinib, afatinib, dacomitinib, and osimertinib) have dramatically altered lung cancer treatment in recent decades. However, these drugs are still not effective in patients with non-small cell lung cancer (NSCLC) carrying EGFR-activating mutations. Following acquired resistance, the systemic progression of NSCLC remains a significant obstacle in treating patients with EGFR mutation-positive NSCLC. Here, we present a stepwise dose escalation method for establishing three independent acquired afatinib-resistant cell lines from NSCLC PC-9 cells harboring EGFR-activating mutations of 15-base pair deletions in EGFR exon 19. Methods for characterizing the three independent afatinib-resistance cell lines are briefly presented. The acquired resistance mechanisms to EGFR TKIs are heterogeneous. Therefore, multiple cell lines with acquired resistance to EGFR-TKIs must be examined. Ten to twelve months are required to obtain cell lines with acquired resistance using this stepwise dose escalation approach. The discovery of novel acquired resistance mechanisms will contribute to the development of more effective and safe therapeutic strategies.

A method for establishing afatinib-resistance cell lines from lung adenocarcinoma PC-9 cells was developed, and resistant cells were characterized. The resistant cells can be used to investigate epidermal growth factor receptor tyrosine kinase inhibitor-resistance mechanisms, applicable for patients with non-small cell lung cancer.

Acquired resistance to molecular target inhibitors is a severe problem in cancer therapy. Lung cancer remains the leading cause of cancer-related death in ...

Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented with increasing depth, the incidence rate of cutaneous melanoma has shown a rapid and continuous increase during recent decades. In order to find effective preventative methods, it is important to understand the early steps of melanoma initiation in the skin. Previous data has demonstrated that follicular melanocyte stem cells (MCSCs) in the adult skin tissues can act as melanoma cells of origin when expressing oncogenic mutations and genetic alterations. Tumorigenesis arising from melanoma-prone MCSCs can be induced when MCSCs transition from a quiescent to active state. This transition in melanoma-prone MCSCs can be promoted by the modulation of either hair follicle stem cells&#39; activity state or through extrinsic environmental factors such as ultraviolet-B (UV-B). These factors can be artificially manipulated in the laboratory by chemical depilation, which causes transition of hair follicle stem cells and MCSCs from a quiescent to active state, and by UV-B exposure using a benchtop light. These methods provide successful spatial and temporal control of cutaneous melanoma initiation in the murine dorsal skin. Therefore, these in vivo model systems will be valuable to define the early steps of cutaneous melanoma initiation and could be used to test potential methods for tumor prevention.

The following procedure describes a method for spatial and temporal control of melanocytic tumor initiation in murine dorsal skin, using a genetically engineered mouse model. This protocol describes macroscopic as well as microscopic cutaneous melanoma initiation.

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented ...

Obtaining Cancer Stem Cell Spheres from Gynecological and Breast Cancer Tumors

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and recurrent disease. This population can be identified by surface markers, enzymatic activity and a functional profile. These approaches per se are limited, due to phenotypic heterogeneity and CSC plasticity. Here, we update the sphere-forming protocol to obtain CSC spheres from breast and gynecological cancers, assessing functional properties, CSC markers and protein expression. The spheres are obtained with single-cell seeding at low density in suspension culture, using a semi-solid methylcellulose medium to avoid migration and aggregates. This profitable protocol can be used in cancer cell lines but also in primary tumors. The tridimensional non-adherent suspension culture thought to mimic the tumor microenvironment, particularly the CSC-niche, is supplemented with epidermal growth factor and basic fibroblast growth factor to ensure CSC signaling. Aiming for robust identification of CSC, we propose a complementary approach, combining functional and phenotypic evaluation. Sphere-forming capacity, self-renewal and sphere projection area establish CSC functional properties. Additionally, characterization comprises flow cytometry evaluation of the markers, represented by CD44+/CD24- and CD133, and Western blot, considering ALDH. The presented protocol was also optimized for primary tumor samples, following a sample digestion procedure, useful for translational research.

The aim of this methodology is to identify cancer stem cells (CSC) in cancer cell lines and primary human tumor samples with the sphere-forming protocol, in a robust manner, using functional assays and phenotypic characterization with flow cytometry and Western blot.

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and ...

Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines

The presence of cancer stem cells (CSCs) has been associated with relapse or poor outcomes after radiotherapy. Studying radioresistant CSCs may provide clues to overcoming radioresistance. Voltage-gated calcium channel &#945;2&#948;1 subunit isoform 5 has been reported as a marker for radioresistant CSCs in non-small cell lung cancer (NSCLC) cell lines. Using calcium channel &#945;2&#948;1 subunit as an example of a CSC marker, methods to study the radiosensitivity of CSCs in NSCLC cell lines are presented. CSCs are sorted with putative markers by flow cytometry, and the self-renewal capacity of sorted cells is evaluated by sphere formation assay. Colony formation assay, which determines how many cells lose the ability to generate descendants forming the colony after a certain dose of radiation, is then performed to assess the radiosensitivity of sorted cells. This manuscript provides initial steps for studying the radiosensitivity of CSCs, which establishes the basis for further understanding of the underlying mechanisms.

The presence of cancer stem cells have been associated with relapse or poor outcomes after radiotherapy. This manuscript describes the methods to study the radiosensitivity of cancer stem cells in lung cancer cell lines.

The presence of cancer stem cells (CSCs) has been associated with relapse or poor outcomes after radiotherapy. Studying radioresistant CSCs may provide ...

Differentiation of Mouse Breast Epithelial HC11 and EpH4 Cells

Cadherins play an important role in the regulation of cell differentiation as well as neoplasia. Here we describe the origins and methods of the induction of differentiation of two mouse breast epithelial cell lines, HC11 and EpH4, and their use to study complementary stages of mammary gland development and neoplastic transformation.
The HC11 mouse breast epithelial cell line originated from the mammary gland of a pregnant Balb/c mouse. It differentiates when grown to confluence attached to a plastic Petri dish surface in medium containing fetal calf serum and Hydrocortisone, Insulin and Prolactin (HIP medium). Under these conditions, HC11 cells produce the milk proteins &#946;-casein and whey acidic protein (WAP), similar to lactating mammary epithelial cells, and form rudimentary mammary gland-like structures termed &#34;domes&#34;.
The EpH4 cell line was derived from spontaneously immortalized mouse mammary gland epithelial cells isolated from a pregnant Balb/c mouse. Unlike HC11, EpH4 cells can fully differentiate into spheroids (also called mammospheres) when cultured under three-dimensional (3D) growth conditions in HIP medium. Cells are trypsinized, suspended in a 20% matrix consisting of a mixture of extracellular matrix proteins produced by Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells, plated on top of a layer of concentrated matrix coating a plastic Petri dish or multiwell plate, and covered with a layer of 10% matrix-containing HIP medium. Under these conditions, EpH4 cells form hollow spheroids that exhibit apical-basal polarity, a hollow lumen, and produce &#946;-casein and WAP.
Using these techniques, our results demonstrated that the intensity of the cadherin/Rac signal is critical for the differentiation of HC11 cells. While Rac1 is necessary for differentiation and low levels of activated RacV12 increase differentiation, high RacV12 levels block differentiation while inducing neoplasia. In contrast, EpH4 cells represent an earlier stage in mammary epithelial differentiation, which is inhibited by even low levels of RacV12.

We describe techniques for differentiation induction of two breast epithelial lines, HC11 and EpH4. While both require fetal calf serum, insulin, and prolactin to produce milk proteins, EpH4 cells can fully differentiate into mammospheres in three-dimensional culture. These complementary models are useful for signal transduction studies of differentiation and neoplasia.

Cadherins play an important role in the regulation of cell differentiation as well as neoplasia. Here we describe the origins and methods of the induction ...

Studying Triple Negative Breast Cancer Using Orthotopic Breast Cancer Model

Triple-negative breast cancer (TNBC) is an aggressive breast cancer subtype with limited therapeutic options. When compared to patients with less aggressive breast tumors, the 5-year survival rate of TNBC patients is 77% due to their characteristic drug-resistant phenotype and metastatic burden. Toward this end, murine models have been established aimed at identifying novel therapeutic strategies limiting TNBC tumor growth and metastatic spread. This work describes a practical guide for the TNBC orthotopic model where MDA-MB-231 breast cancer cells suspended in a basement membrane matrix are implanted in the fourth mammary fat pad, which closely mimics the cancer cell behavior in humans. Measurement of tumors by caliper, lung metastasis assessment via in vivo and ex vivo imaging, and molecular detection are discussed. This model provides an excellent platform to study therapeutic efficacy and is especially suitable for the study of the interaction between the primary tumor and distal metastatic sites.

This work presets an advanced protocol to accurately assess tumor loading by detection of green fluorescent protein and bioluminescence signals as well as the integration of quantitative molecular detection technique.

Triple-negative breast cancer (TNBC) is an aggressive breast cancer subtype with limited therapeutic options. When compared to patients with less ...

Orthotopic Transplantation of Breast Tumors as Preclinical Models for Breast Cancer

Preclinical models that faithfully recapitulate tumor heterogeneity and therapeutic response are critical for translational breast cancer research. Immortalized cell lines are easy to grow and genetically modify to study molecular mechanisms, yet the selective pressure from cell culture often leads to genetic and epigenetic alterations over time. Patient-derived xenograft (PDX) models faithfully recapitulate the heterogeneity and drug response of human breast tumors. PDX models exhibit a relatively short latency after orthotopic transplantation that facilitates the investigation of breast tumor biology and drug response. The transplantable genetically engineered mouse models allow the study of breast tumor immunity. The current protocol describes the method to orthotopically transplant breast tumor fragments into the mammary fat pad followed by drug treatments. These preclinical models provide valuable approaches to investigate breast tumor biology, drug response, biomarker discovery and mechanisms of drug resistance.

Patient-derived xenograft (PDX) models and transplantable genetically engineered mouse models faithfully recapitulate human disease and are preferred models for basic and translational breast cancer research. Here, a method is described to orthotopically transplant breast tumor fragments into the mammary fat pad to study tumor biology and evaluate drug response.

Preclinical models that faithfully recapitulate tumor heterogeneity and therapeutic response are critical for translational breast cancer research. ...