Isolation and Detection of Telomeric DNA C-Circles from Mammalian Cells

Summary

Cancer cells can overcome replicative senescence by activating the alternative lengthening of telomeres (ALT) pathway. ALT positive cancer cells are uniquely characterized by the production of circular C-rich telomeric DNA sequences (C-circle). This protocol describes how to detect C-circles isolated from ALT-positive mammalian cells.

Abstract

The identification of cancer cells that promote telomere elongation in the absence of telomerase activity led to the identification of the alternative lengthening of telomeres (ALT) pathway. The ALT pathway is active in approximately 10-15% of all human cancers. However, ALT is most prevalent in some of the most aggressive forms of human cancer including, glioblastoma, osteosarcoma, and pancreatic neuroendocrine tumors. These cancers are highly refractory to common therapeutic strategies and have poor overall survival. Therefore, there has been a growing interest in understanding how, and under what conditions, the ALT pathway is active in an effort to identify therapies that uniquely target the ALT mechanism. These efforts necessitate the use of a robust biomarker to not only identify ALT positive cancers, but also to monitor ALT activity throughout treatment. Several cellular phenotypes have been identified and demonstrated to correlate with ALT activity including the production of extrachromosomal telomeric repeat (ECTR) DNA. ECTR exist in both linear and circular forms containing either C-rich or G-rich partially double-stranded telomeric sequences. To date, the circular C-rich telomeric sequences (C-circles) are the only ECTR DNA products that have been demonstrated to be exclusive to ALT positive cancer cells. In this protocol, we demonstrate a technique used to isolate and detect C-circles from mammalian cells highlighting the utility of this assay in the determination of ALT status.

Introduction

Telomeres are repetitive DNA sequences that cap the ends of linear chromosomes to protect chromosome ends from degradation and end-to-end fusions. Given the semiconservative nature of DNA replication telomeres shorten with each successive cell division. Eventually, telomeres reach a critically short length and induce cellular senescence and crisis. Cancer cells must overcome telomere shortening to bypass cellular senescence and gain replicative immortality.¹ Approximately 85% of cancers promote telomere elongation by reactivating the enzyme telomerase.² Another 10% of cancers activate a second mechanism called t....

Protocol

1. Isolate genomic DNA

1. Collect cells from a 10 cm dish with trypsin or by scraping and collect in a microcentrifuge tube.
   1. Wash cells with 3-5 ml of PBS.
   2. If collecting cells by scraping, scrape dish and collect. Otherwise, aspirate PBS from dish.
   3. Add 1.5 ml of 0.05% trypsin-EDTA and incubate at 37 °C for 3-5 min or until cells detach from plate.
   4. Add 5-10 ml of media containing 10% fetal bovine serum and wash the plate.
      NOTE: This step is only necessary .......

Discussion

The identification of cancer cells that maintain telomere length for over 100 population doublings in culture, in the absence of telomerase activity, led to the identification of the ALT pathway³. Since that initial discovery twenty years ago there has been a growing interest in defining mechanistically how, and under what conditions, the ALT pathway is active in cancer. To date, the literature suggests that the ALT pathway is active in approximately 10-15% of all human cancers, with the highest p.......

Materials

Name	Company	Catalog Number	Comments
Microcentrifuge			Any microcentrifuge will work, eg. Eppendorf 5424
Nanodrop	Thermo Scientific	2000	Any DNA quantitation spectrophotometer is sufficient
Water bath			A heat block can be used in place of a water bath for incubations
Thermocycle			Any thermocycler is sufficient, e.g. BioRad C1000 touch
Dot blot apparatus	BioRad	1706545
UV Crosslinker			Any UV Crosslinker is sufficient, e.g. Boekel Scientific 234100
Hybridization bags			Any boilable heat seal pouch will work, e.g. Kapak Sealpak
Hybridization oven			Any hybridization oven is sufficient, e.g. Thermo Scientific Shake 'n' Stack
Glass hybridization bottle			Any hybridization bottle that fits the rotisserie in the hybridization oven, e.g. Wheaton borosilicate glass hybridization bottle
Autoclave
Chemiluminscent imager			Any chemiluminescence imager is sufficient, e.g. BioRad ChemiDoc XRS+with Image Lab software
Impulse heat sealer			Any impulse heat sealer is sufficient, e.g. FS-305 impulse sealer
D-PBS (1X)	Invitrogen	14190-144	Any PBS can be used to wash cell pellet
0.05% Trypsin-EDTA	Thermo Scientific	25300062	Any cell dissociation reagent is sufficient, use reagent approriate for the cell line
QIAmp DNA Mini kit	Qiagen	51304
Alu1	New England Biolabs	R0137L
Mbo1	New England Biolabs	R0147L
CutSmart Buffer (10X)	New England Biolabs	B7204S	Buffer is normally supplied with restriction enzymes
PureLink Rnase A	Invitrogen	12091-021
GeneJET PCR Purification Kit	Thermo Scientific	K0701	Qiagen QIAquick PCR purification kit can be used without effect on assay outcome
Bovine Serum Albumin	Sigma	A2153	Any BSA is sufficient
phi29 DNA polymerase	New England Biolabs	MO269L
phi29 DNA  pol reaction buffer (10X)	New England Biolabs	BO269S	Buffer is normally supplied with polymerase
Tween-20	Sigma	P1379	Any Tween 20 is sufficient
dATP solution (100mM)	Invitrogen	55082
dTTP solution (100mM)	Invitrogen	55085
dGTP solution (100mM)	Invitrogen	55084
Sodium Chloride	Sigma	S5886	Any sodium chloride is sufficient
Sodium citrate tribasic dihydrate	Sigma	S4641
Chromatography paper	Fisherbrand	05-714-4	Any chromatography filter paper is sufficient
Amersham Hybond-XL	GE Healthcare	RPN 203 S
ULTRAHyb Ultrasensitive Hybridization buffer	Invitrogen	AM8670	Warm in water bath to 65° C before use
Sodium dodecyl sulfate	Fisher Scientific	BP166	Any SDS is sufficient
Telomere probe (5' - CCCTAACCCTAACCCTAACCCTAA - 3')	Invitrogen		25nmoles; standard desalting; resuspend at 250µM
DIG oligonucleotide 3' - End labeling kit, 2nd generation	Roche	3353575910	Kit contains 5X reaction buffer, CoCl2 solution, DIG-ddUTP solution and recombinant terminal transferase
EDTA	Sigma	6381-92-6	Any EDTA is sufficient
Maleic Acid	Sigma	110-16-7	Any maleic acid is sufficient
Blocking Reagent	Roche	11096176001
Tris-HCl	Sigma	77-86-1	Any Tris-HCl is sufficient
anti-Digoxigenin-AP Fab fragments	Roche	11093274910
CDP-Star	Roche	11759051001