Microinjection of Recombinant RCAS(A) Retrovirus into Embryonic Chicken Lens

Summary

This protocol paper describes the methodology of embryonic chicken lens microinjection of an RCAS(A) retrovirus as a tool for studying in situ function and expression of proteins during lens development.

Abstract

Embryonic chicken (Gallus domesticus) is a well-established animal model for the study of lens development and physiology, given its high degree of similarity with the human lens. RCAS(A) is a replication-competent chicken retrovirus that infects dividing cells, which serves as a powerful tool to study the in situ expression and function of wild-type and mutant proteins during lens development by microinjection into the empty lumen of lens vesicle at early developmental stages, restricting its action to surrounding proliferating lens cells. Compared to other approaches, such as transgenic models and ex vivo cultures, the use of an RCAS(A) replication-competent avian retrovirus provides a highly effective, rapid, and customizable system to express exogenous proteins in chick embryos. Specifically, targeted gene transfer can be confined to proliferative lens fiber cells without the need for tissue-specific promoters. In this article, we will briefly overview the steps needed for recombinant retrovirus RCAS(A) preparation, provide a detailed, comprehensive overview of the microinjection procedure, and provide sample results of the technique.

Introduction

The goal of this protocol is to describe the methodology of embryonic chicken lens microinjection of an RCAS(A) (replication-competent avian sarcoma/leukosis retrovirus A). Effective retroviral delivery in an embryonic chicken lens has been demonstrated to be a promising tool for the in vivo study of the molecular mechanism and structure-function of lens proteins in normal lens physiology, pathological conditions, and development. Moreover, this experimental model could be used for the identification of therapeutic targets and drug screening for conditions such as human congenital cataracts. In all, this protocol aims to lay out the necessary steps for the de....

Protocol

This study was conducted in compliance with the Animal Welfare Act and the Implementing Animal Welfare Regulations in accordance with the principles of the Guide for the Care and Use of Laboratory Animals. All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of Texas Health Science Center at San Antonio. For an overview of the protocol, see Figure 1; see the Table of Materials for details on all materials, reagents, and ins.......

Discussion

This experimental model offers the opportunity to express the protein(s) of interest in the intact lens leading to the study of the functional relevance of these proteins in lens structure and function. The embryonic chick microinjection model is based partially on the work of Fekete et. al.⁶ and was further developed by Jiang et. al.⁸ and has been utilized as a means of inserting both viral plasmids and agents such as agonists, small interfering RNA (siRNA), and peptides i.......

Materials

Name	Company	Catalog Number	Comments
0.22 µm Filter	Corning	431118	For removing cellular debris from media
35 mm x 10 mm Culture Dish	FisherScientific	50-202-030	For using during microinjection
Centrifuge	Fisherbrand	13-100-676	Spinning down solution
Constructs	GENEWIZ	-	For generation of constructs
Dissecting microscope	AmScope	SM-4TZ-144A	Visualization of lens for microinjection
DNA PCR primers	Integrated DNA Technologies	-	Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were  obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively
Drummond Nanoject II Automatic Nanoliter Injector	Drummond Scientific	3-000-204	Microinjection Pipet
Dual Gooseneck Lights Microscope Illuminator	AmScope	LED-50WY	Lighting for visualization
Dulbecco’s Modified Eagle Medium (DMEM)	Invitrogen		For cell culture
Egg Holder	-	-	Homemade styrofoam rings with 2-inch diameter and one-half inch height
Egg Incubator	GQF Manufacturing Company Inc.	1502	For incubation of fertilized eggs
Fast Green	Fisher scientific	F99-10	For visualization of viral stock injection
Fertilized white leghorn chicken eggs	Texas A&M University	N/A	Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)
Fetal Bovine Serum (FBS)	Hyclone Laboratories		For cell culture
Fluorescein-conjugated anti-mouse IgG	Jackson ImmunoResearch	115-095-003	For anti-FLAG  1:500
Forceps	FisherScientific	22-327379	For moving things around and isolation
Glass capillaries	Sutter Instruments	B100-75-10	Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)
Lipofectamine	Invitrogen	L3000001	For transfection
Manual vertical micropipette puller	Sutter Instruments	P-30	To obtain glass micropipette of the correct size
Microcentrifuge Tubes	FisherScientific	02-682-004	Dissolving solution
Microscope	Keyence	BZ-X710	For imaging staining
Parafilm	FisherScientific	03-448-254	Placing solution
Penicillin/Streptomycin	Invitrogen		For cell culture
Pico-Injector	Harvard Apparatus	PLI-100	For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time
rabbit anti-chick AQP0	Self generated	-	Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.
rabbit anti-FLAG antibody	Rockland Immunichemicals	600-401-383	For staining FLAG
Rhodamine-conjugated anti-rabbit IgG	Jackson ImmunoResearch	111-295-003	For anti-AQP0  1:500
Sponge clamping pad	Sutter Instruments	BX10	For storage of glass micropipette