재조합 RCAS(A) 레트로바이러스를 배아 닭 수정체에 미세주입

요약

이 프로토콜 논문은 렌즈 발달 중 단백질의 in situ 기능 및 발현을 연구하기 위한 도구로서 RCAS(A) 레트로바이러스의 배아 닭 수정체 미세 주입 방법론을 설명합니다.

초록

배아 닭(Gallus domesticus)은 인간의 수정체와 높은 수준의 유사성을 감안할 때 수정체 발달 및 생리학 연구를 위한 잘 확립된 동물 모델입니다. RCAS(A)는 분열하는 세포를 감염시키는 복제가 가능한 닭 레트로바이러스로, 초기 발달 단계에서 수정체 소포의 빈 내강에 미세 주입하여 수정체 발달 중 야생형 및 돌연변이 단백질의 in situ 발현 및 기능을 연구하는 강력한 도구 역할을 합니다. 형질전환 모델 및 체외 배양과 같은 다른 접근법과 비교했을 때, RCAS(A) 복제가 가능한 조류 레트로바이러스를 사용하면 병아리 배아에서 외 인성 단백질을 발현하는 매우 효과적이고 신속하며 맞춤형 시스템을 제공할 수 있습니다. 특히, 표적 유전자 전달은 조직 특이적 프로모터(tissue-specific promoter) 없이 증식성 수정체 섬유 세포(proliferative lens fiber cell)로 제한될 수 있습니다. 이 글에서는 재조합 레트로바이러스 RCAS(A) 제제에 필요한 단계를 간략하게 살펴보고, 미세주입 절차에 대한 상세하고 포괄적인 개요를 제공하며, 이 기법의 샘플 결과를 제공합니다.

서문

이 프로토콜의 목표는 RCAS(A)(복제 가능한 조류 육종/백혈병 레트로바이러스 A)의 배아 닭 렌즈 미세 주입 방법론을 설명하는 것입니다. 배아 닭 수정체에서 효과적인 레트로바이러스 전달은 정상 수정체 생리학, 병리학적 조건 및 발달에서 수정체 단백질의 분자 메커니즘 및 구조-기능에 대한 생체 내 연구를 위한 유망한 도구임이 입증되었습니다. 또한, 이 실험 모델은 인간 선천성 백내장과 같은 질환에 대한 치료 표적 식별 및 약물 스크리닝에 사용될 수 있습니다. 전체적으로, 이 프로토콜은 수정체 단백질 연구를 위한 맞춤형 플랫폼 개발에 필요한 단계를 제시하는 것을 목표로 합니다.

배아 병아리(Gallus domesticus)는 수정체 구조와 기능이 인간의 수정체와 유사하기 때문에 수정체 발달 및 생리학 연구를 위한 잘 확립된 동물 모델입니다 1,2,3,4. RCAS(A) 복제가 가능한 조류 레트로바이러스의 사용은 병아리 배아에서 외인성 단백질을 발현하는 매우 효과적이고 신속하며 맞춤형 ....

프로토콜

본 연구는 동물복지법 및 동물복지 시행 규정의 '실험동물 관리 및 이용 지침서'의 원칙에 따라 수행되었다. 모든 동물 시술은 샌안토니오에 있는 텍사스 대학교 보건 과학 센터의 기관 동물 관리 및 사용 위원회의 승인을 받았습니다. 프로토콜에 대한 개요는 그림 1을 참조하십시오. 이 프로토콜에 사용되는 모든 재료, 시약 및 기기에 대한 자세한 내용은 재료 표를 참조하십시오.

그림 1: 실험 개요. 1 . 프로토콜의 첫 번째 단계는 특정 표적 단백질의 결정, 관련 유전자 서열의 식별 및 DNA 단편 생성입니다. 2 . 접합기 벡터로의 초기 클로닝에 의한 레트로바이러스 벡터로의 유전자 서열 클로닝, 3. 바이러스 벡터에 뒤따름 . ....

토론

이 실험 모델은 온전한 수정체에서 관심 있는 단백질을 발현할 수 있는 기회를 제공하여 렌즈 구조 및 기능에서 이러한 단백질의 기능적 관련성을 연구할 수 있습니다. 배아 병아리 미세주입 모델은 부분적으로 Fekete 등의 연구를 기반으로 합니다. ^al.6 및 Jiang et에 의해 더욱 개발되었습니다. ^al.8 및 바이러스 플라스미드 및 작용제, 작은 간섭 RNA(siRNA) 및 펩타이?.......

자료

Name	Company	Catalog Number	Comments
0.22 µm Filter	Corning	431118	For removing cellular debris from media
35 mm x 10 mm Culture Dish	FisherScientific	50-202-030	For using during microinjection
Centrifuge	Fisherbrand	13-100-676	Spinning down solution
Constructs	GENEWIZ	-	For generation of constructs
Dissecting microscope	AmScope	SM-4TZ-144A	Visualization of lens for microinjection
DNA PCR primers	Integrated DNA Technologies	-	Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were  obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively
Drummond Nanoject II Automatic Nanoliter Injector	Drummond Scientific	3-000-204	Microinjection Pipet
Dual Gooseneck Lights Microscope Illuminator	AmScope	LED-50WY	Lighting for visualization
Dulbecco’s Modified Eagle Medium (DMEM)	Invitrogen		For cell culture
Egg Holder	-	-	Homemade styrofoam rings with 2-inch diameter and one-half inch height
Egg Incubator	GQF Manufacturing Company Inc.	1502	For incubation of fertilized eggs
Fast Green	Fisher scientific	F99-10	For visualization of viral stock injection
Fertilized white leghorn chicken eggs	Texas A&M University	N/A	Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/)
Fetal Bovine Serum (FBS)	Hyclone Laboratories		For cell culture
Fluorescein-conjugated anti-mouse IgG	Jackson ImmunoResearch	115-095-003	For anti-FLAG  1:500
Forceps	FisherScientific	22-327379	For moving things around and isolation
Glass capillaries	Sutter Instruments	B100-75-10	Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length)
Lipofectamine	Invitrogen	L3000001	For transfection
Manual vertical micropipette puller	Sutter Instruments	P-30	To obtain glass micropipette of the correct size
Microcentrifuge Tubes	FisherScientific	02-682-004	Dissolving solution
Microscope	Keyence	BZ-X710	For imaging staining
Parafilm	FisherScientific	03-448-254	Placing solution
Penicillin/Streptomycin	Invitrogen		For cell culture
Pico-Injector	Harvard Apparatus	PLI-100	For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time
rabbit anti-chick AQP0	Self generated	-	Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363.
rabbit anti-FLAG antibody	Rockland Immunichemicals	600-401-383	For staining FLAG
Rhodamine-conjugated anti-rabbit IgG	Jackson ImmunoResearch	111-295-003	For anti-AQP0  1:500
Sponge clamping pad	Sutter Instruments	BX10	For storage of glass micropipette