JoVE 비디오를 활용하시려면 도서관을 통한 기관 구독이 필요합니다. 전체 비디오를 보시려면 로그인하거나 무료 트라이얼을 시작하세요.
이 프로토콜 논문은 렌즈 발달 중 단백질의 in situ 기능 및 발현을 연구하기 위한 도구로서 RCAS(A) 레트로바이러스의 배아 닭 수정체 미세 주입 방법론을 설명합니다.
배아 닭(Gallus domesticus)은 인간의 수정체와 높은 수준의 유사성을 감안할 때 수정체 발달 및 생리학 연구를 위한 잘 확립된 동물 모델입니다. RCAS(A)는 분열하는 세포를 감염시키는 복제가 가능한 닭 레트로바이러스로, 초기 발달 단계에서 수정체 소포의 빈 내강에 미세 주입하여 수정체 발달 중 야생형 및 돌연변이 단백질의 in situ 발현 및 기능을 연구하는 강력한 도구 역할을 합니다. 형질전환 모델 및 체외 배양과 같은 다른 접근법과 비교했을 때, RCAS(A) 복제가 가능한 조류 레트로바이러스를 사용하면 병아리 배아에서 외 인성 단백질을 발현하는 매우 효과적이고 신속하며 맞춤형 시스템을 제공할 수 있습니다. 특히, 표적 유전자 전달은 조직 특이적 프로모터(tissue-specific promoter) 없이 증식성 수정체 섬유 세포(proliferative lens fiber cell)로 제한될 수 있습니다. 이 글에서는 재조합 레트로바이러스 RCAS(A) 제제에 필요한 단계를 간략하게 살펴보고, 미세주입 절차에 대한 상세하고 포괄적인 개요를 제공하며, 이 기법의 샘플 결과를 제공합니다.
이 프로토콜의 목표는 RCAS(A)(복제 가능한 조류 육종/백혈병 레트로바이러스 A)의 배아 닭 렌즈 미세 주입 방법론을 설명하는 것입니다. 배아 닭 수정체에서 효과적인 레트로바이러스 전달은 정상 수정체 생리학, 병리학적 조건 및 발달에서 수정체 단백질의 분자 메커니즘 및 구조-기능에 대한 생체 내 연구를 위한 유망한 도구임이 입증되었습니다. 또한, 이 실험 모델은 인간 선천성 백내장과 같은 질환에 대한 치료 표적 식별 및 약물 스크리닝에 사용될 수 있습니다. 전체적으로, 이 프로토콜은 수정체 단백질 연구를 위한 맞춤형 플랫폼 개발에 필요한 단계를 제시하는 것을 목표로 합니다.
배아 병아리(Gallus domesticus)는 수정체 구조와 기능이 인간의 수정체와 유사하기 때문에 수정체 발달 및 생리학 연구를 위한 잘 확립된 동물 모델입니다 1,2,3,4. RCAS(A) 복제가 가능한 조류 레트로바이러스의 사용은 병아리 배아에서 외인성 단백질을 발현하는 매우 효과적이고 신속하며 맞춤형 ....
본 연구는 동물복지법 및 동물복지 시행 규정의 '실험동물 관리 및 이용 지침서'의 원칙에 따라 수행되었다. 모든 동물 시술은 샌안토니오에 있는 텍사스 대학교 보건 과학 센터의 기관 동물 관리 및 사용 위원회의 승인을 받았습니다. 프로토콜에 대한 개요는 그림 1을 참조하십시오. 이 프로토콜에 사용되는 모든 재료, 시약 및 기기에 대한 자세한 내용은 재료 표를 참조하십시오.
그림 1: 실험 개요. 1 . 프로토콜의 첫 번째 단계는 특정 표적 단백질의 결정, 관련 유전자 서열의 식별 및 DNA 단편 생성입니다. 2 . 접합기 벡터로의 초기 클로닝에 의한 레트로바이러스 벡터로의 유전자 서열 클로닝, 3. 바이러스 벡터에 뒤따름 . ....
특정 표적 단백질을 결정하고 관련 유전자 서열을 식별한 후, 전반적인 실험 접근법은 어댑터 벡터로의 초기 클로닝에 의해 유전자 서열을 레트로바이러스 RCAS(A) 벡터로 클로닝한 후 바이러스 벡터를 클로닝하는 것을 포함합니다. 둘째, 고역가 바이러스 입자는 비리온을 채취하고 농축하기 위해 포장 세포를 사용하여 준비됩니다. 이 처음 두 가지 주요 단계는 대체로 설명되었으며 대표적인 결과.......
이 실험 모델은 온전한 수정체에서 관심 있는 단백질을 발현할 수 있는 기회를 제공하여 렌즈 구조 및 기능에서 이러한 단백질의 기능적 관련성을 연구할 수 있습니다. 배아 병아리 미세주입 모델은 부분적으로 Fekete 등의 연구를 기반으로 합니다. al.6 및 Jiang et에 의해 더욱 개발되었습니다. al.8 및 바이러스 플라스미드 및 작용제, 작은 간섭 RNA(siRNA) 및 펩타이?.......
저자는 이 연구가 잠재적인 이해 상충으로 해석될 수 있는 상업적 또는 재정적 관계가 없는 상태에서 수행되었음을 선언합니다.
이 연구는 미국 국립보건원(NIH) 보조금: RO1 EY012085(J.X.J) 및 F32DK134051(F.M.A.)와 웰치 재단 보조금: AQ-1507(J.X.J.)의 지원을 받았습니다. 내용은 전적으로 저자의 책임이며 반드시 미국 국립보건원(National Institutes of Health)의 공식 견해를 나타내는 것은 아닙니다. 피규어는 부분적으로 Biorender.com 로 만들어졌습니다.
....Name | Company | Catalog Number | Comments |
0.22 µm Filter | Corning | 431118 | For removing cellular debris from media |
35 mm x 10 mm Culture Dish | FisherScientific | 50-202-030 | For using during microinjection |
Centrifuge | Fisherbrand | 13-100-676 | Spinning down solution |
Constructs | GENEWIZ | - | For generation of constructs |
Dissecting microscope | AmScope | SM-4TZ-144A | Visualization of lens for microinjection |
DNA PCR primers | Integrated DNA Technologies | - | Generation of primers: Intracellular loop (IL)-deleted Cx50 (residues 1–97 and 149–400) as well as the Cla12NCO vector were obtained with the following pair of primers: sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTACAC ILs of Cx43 (residues 98–150) and Cx46 (residues 98–166) were obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCC AT ACGGATTC, respectively Cla12NCO-Cx43 construct template was obtained with the following pair of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC GTGCGCCAGGTAC ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and Cla12NCO-Cx46 constructs as the templates with the following pair of primers: sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCC TC CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCATACGGATTC, respectively |
Drummond Nanoject II Automatic Nanoliter Injector | Drummond Scientific | 3-000-204 | Microinjection Pipet |
Dual Gooseneck Lights Microscope Illuminator | AmScope | LED-50WY | Lighting for visualization |
Dulbecco’s Modified Eagle Medium (DMEM) | Invitrogen | For cell culture | |
Egg Holder | - | - | Homemade styrofoam rings with 2-inch diameter and one-half inch height |
Egg Incubator | GQF Manufacturing Company Inc. | 1502 | For incubation of fertilized eggs |
Fast Green | Fisher scientific | F99-10 | For visualization of viral stock injection |
Fertilized white leghorn chicken eggs | Texas A&M University | N/A | Animal model of choice for microinjection (https://posc.tamu.edu/fertile-egg-orders/) |
Fetal Bovine Serum (FBS) | Hyclone Laboratories | For cell culture | |
Fluorescein-conjugated anti-mouse IgG | Jackson ImmunoResearch | 115-095-003 | For anti-FLAG 1:500 |
Forceps | FisherScientific | 22-327379 | For moving things around and isolation |
Glass capillaries | Sutter Instruments | B100-75-10 | Glass micropipette for microinjection (O.D. 1.0 mm, I.D. 0.75 mm, 10 cm length) |
Lipofectamine | Invitrogen | L3000001 | For transfection |
Manual vertical micropipette puller | Sutter Instruments | P-30 | To obtain glass micropipette of the correct size |
Microcentrifuge Tubes | FisherScientific | 02-682-004 | Dissolving solution |
Microscope | Keyence | BZ-X710 | For imaging staining |
Parafilm | FisherScientific | 03-448-254 | Placing solution |
Penicillin/Streptomycin | Invitrogen | For cell culture | |
Pico-Injector | Harvard Apparatus | PLI-100 | For delivering small liquid volumes precisely through micropipettes by applying a regulated pressure for a digitally set period of time |
rabbit anti-chick AQP0 | Self generated | - | Jiang JX, White TW, Goodenough DA, Paul DL. Molecular cloning and functional characterization of chick lens fiber connexin 45.6. Mol Biol Cell. 1994 Mar;5(3):363-73. doi: 10.1091/mbc.5.3.363. |
rabbit anti-FLAG antibody | Rockland Immunichemicals | 600-401-383 | For staining FLAG |
Rhodamine-conjugated anti-rabbit IgG | Jackson ImmunoResearch | 111-295-003 | For anti-AQP0 1:500 |
Sponge clamping pad | Sutter Instruments | BX10 | For storage of glass micropipette |
JoVE'article의 텍스트 или 그림을 다시 사용하시려면 허가 살펴보기
허가 살펴보기This article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. 판권 소유