시약을 설정 및 젤류를 따르고하고 UCLA의 에린 샌더스에 영감,지도 및 지원을하고 원고를 교정을위한 UCLA의 크리스 Reddi에 대한 특별 감사합니다. 나는 또한 GAL3 유전자를 증폭하기 위해 효모 게놈의 DNA와 primers를 공급을위한 감사 Giancarlo Costaguta과 그레고리 S. 페인에게 싶습니다. 4 - 나는 또한 실험실 장비 및 숫자 2를 만들기 위해 사용되는 시약의 사진을내어 Bhairav​​의 샤 감사드립니다. 이 프로젝트에 대한 자금 지원은 HHMI (HHMI 그랜트 번호 52006944)에 의해 제공되었다.

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

나는 공개 할게 없다.

PCR은 생물 학적 과학 병기의 indispensible 도구가되었습니다. PCR은 genomes과 다양성뿐만 아니라, 더욱 생화 학적 분석을 위해 간단하게 복제 유전자에 대한 통찰력을 얻고, 구체적이고 정확한 임상 테스트를 수 있도록 생물학 자들이 genomes을 통해 권력을 양보하고, 새로운 기능과 하이브리드 유전자를 만들 수 있도록 과학의 진로를 변경했다. PCR 응용 프로그램은 자사의 강력한 힘을 가졌 과학자의 상상력에 의해 제한됩니다. 이 PCR의 새로운 특수 용도를 설명하는 많은 서적과 논문이 있으며, 많은는 생물 학적 과학의 차세대 걸쳐 개발됩니다. 그러나 관계없이 예상 접근법, 기본 프레임 워크는 동일 남아있다. PCR은 모든 과대에 DNA가 특정 세그먼트의 대량 생성의 체외 응용 프로그램입니다. PCR 실험을 설계하는 것은 사상과 인내가 필요합니다. 그림 3에 표시된 결과는 주요 채널 중 하나를 예시PCR을위한 최적화 전략을 디자인할 때 allenges. PCR 중 하나가 매개 변수가 변경되면 그것은, 그것은 또 다른 영향을 미칠 수 있습니다. 초기 PCR은 최적의 MG이 2.0 mm의 + 농도와 하위 최적 어닐링 온도 (58 ° C)에서 실시되었다 경우 예를 들어, 다음, 결과는 그림 3C에서 볼로 얼룩을 생산합니다. 얼룩을 해결하기위한 시도가 2.0 밀리미터 MgCl 2를 포함하는 반응과 PCR 조건을 설정하고 61 ° C.로 어닐링 온도를 조정 관련 됐을지도 몰라요 그러나, 같은 그림 3A에서 본,이 모든 제품을 얻을 수없는 것이다. 따라서, 그것은 오히려 가짜 결과를 해결할 때, 단일 반응을 한 농도를 추가하는 것보다, 시약을 적정하다 것이 좋습니다. 또한, PCR 실험을 최적화하는 데 필요한 가장 일반적인 조정 MG 2 + 농도를 변경하고 어닐링 온도를 수정하는 것입니다. 그러나 이러한 변화는 최소화하거나 탈선 결과를 폐기하다, additi의 적정하지 않을 경우ves 및 / 또는 같은 표 2-6에 설명된 사이클링 조건 프로토콜을 변경하는 문제를 줄일 수 있습니다. 다른 모든 실패하면 primers를 다시 디자인하고 시도 다시 시도하십시오.

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 댓글 </td></tr><tr><td> DNA 형성 촉매 Polymeras </td><td> 시그마 </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTPs </td><td> Qiagen </td><td> 201,225 </td><td></td></tr><tr><td> 0.2 ML 얇은 벽 튜브 PCR 튜브 </td><td> 바이오는 힘이에요 </td><td> 223-9469 </td><td></td></tr><tr><td> 0.2 ML 얇은 벽 튜브 모자 </td><td> 바이오는 힘이에요 </td><td> 223-9472 </td><td></td></tr><tr><td> TE 버퍼 : </td><td></td><td></td><td></td></tr><tr><td> EDTA (에틸렌 다이아 민 테트라 초산) 나트륨 소금의 이수화물 </td><td> 시그마 </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCL </td><td> 시그마 </td><td> T-3253 </td><td></td></tr><tr><td> 사용자 정의 파지의 프라이머 </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> 사용자 정의 파지의 프라이머 </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> 사용자 정의 효모 프라이머 </td><td> 통합의 DNA 기술 </td><td colspan="2"> SacI-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> 사용자 정의 효모 프라이머 </td><td> 통합의 DNA 기술 </td><td colspan="2"> Gal3 (1848) - SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG에게 </td></tr><tr><td> 열전달 자전거 타는 사람 </td><td> 바이오는 힘이에요 </td><td> 170-9703 </td><td> 내 자전거 타는 사람 </td></tr><tr><td> 아가로 오스 </td><td> ISC BioExpress </td><td> 전자 3120-500 </td><td></td></tr><tr><td> 겔 전기 영동 </td><td> Hoeffer 과학 계측기 </td><td> 모델 HE33 </td><td></td></tr><tr><td> 1킬로바이트의 DNA 사다리 </td><td> 뉴잉글랜드 BioLabs </td><td> N3232S </td><td></td></tr><tr><td> 바이오 방사선 파워 팩 </td><td> 바이오는 힘이에요 </td><td> 164-5050 </td><td> PowerPac 기본 </td></tr><tr><td> 젤 닥 시스템 </td><td> Fotodyne 법인 </td><td colspan="2"> FOTO / 분석 탐정 FX 워크 스테이션 </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

생명 공학 발견의 황금 시대로 징계를 쇠뇌 기술 진보가 있었다. 예를 들어, 미생물학 분야는 과학자들이 처음으로 prokaryotes을 시각화 수 안톤 반 리웬허크와의 현미경의 출현으로 변모되었다. 중합 효소 사슬 반응 (PCR)의 개발 미치는 영향은 생물학에서 수많은 subdisciplines를 스팬과 분자 과학의 진로를 변경 이들 혁신 중 하나입니다. 이론 과정은 1971 년에 Keppe와 동료에 의해 제시된되었다; 전체 PCR 절차 주면 주식 회사에서 1985 년 동안 Kary Mullis에 의해 설명하고 실험적으로 적용되기 전까지는하지만, 그건 다른 14년했습니다. 이 기법의 자동화 및 개선은 세균의 Thermus aquaticus의, 따라서 이름이 DNA 형성 촉매 장치의 DNA 중합 효소의 열 안정성의 DNA 중합 효소의 도입과 함께 진행. PCR은 포웨입니다시작하는 재료만을 소량 (즉, DNA를 템플릿이나 대상 시퀀스)의 DNA (즉, amplicon)의 특정 세그먼트의 충분한 공급을 생성할 수 rful 증폭 기술. 간단하고 일반적으로 문제가없는 반면, 가짜 결과를 생산하는 반응을 복잡하게 함정이 있습니다. PCR이 실패했을 때 그것은 아가로 오스의 젤에 대한 밴드의 사다리 또는 얼룩으로 나타 다양한 규모의 다수가 아닌 특정 DNA의 제품으로 이어질 수 있습니다. 가끔 제품이 전혀 나오지. 변이가 실수로 PCR 제품의 이질적인 인구 결과, amplicons에 소개되면 또 다른 잠재적인 문제가 발생합니다. 인내와 신중 문제 해결이 정리 및 문제 (들)을 해결하기 위해 고용하지 않는 경우 PCR 실패는 절망적이 될 수 있습니다. 이 프로토콜은 PCR의 기본 원리를 설명 대부분의 대상 시퀀스의 증폭집니다 방법론을 제공하고 반응을 최적화하기위한 전략을 제시합니다. 이 PCR 가이드, 일에 따라udents는 할 수 있어야합니다 : <ul><li> 종래의 PCR 실험에 대한 반응 및 열 사이클링 조건을 설정 </li><li> 다양한 반응 구성 요소의 기능과 PCR 실험에 미치는 전반적인 영향을 이해 </li><li> 어떤 DNA를 템플릿에 대한 PCR 실험을 설계하고 최적화 </li><li> 실패 PCR 실험 문제 해결 </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR은 많은 분자 생물학 연구소의 일반적인 기법으로 부상하고있다. 여러 기존의 PCR 프로토콜에 대한 안내서가 여기에 제공됩니다. 각 반응은 독특한 실험, 제품이 다양 생성하는 데 필요한 최적의 조건이기 때문에. 반응의 변수를 이해하는 것은 크게함으로써 원하는 결과를 얻을 수있는 기회를 증가 문제 해결 효율성을 향상시킬 것입니다.

중합 효소 사슬 반응 : 기본 프로토콜 플러스 문제 해결 및 최적화 전략

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

polymerase-chain-reaction-basic-protocol-plus-troubleshooting

Research

JoVE Journal

Biology

399.4K 조회수.  University of California, Los Angeles. PCR은 많은 분자 생물학 연구소의 일반적인 기법으로 부상하고있다. 여러 기존의 PCR 프로토콜에 대한 안내서가 여기에 제공됩니다. 각 반응은 독특한 실험, 제품이 다양 생성하는 데 필요한 최적의 조건이기 때문에. 반응의 변수를 이해하는 것은 크게함으로써 원하는 결과를 얻을 수있는 기회를 증가 문제 해결 효율성을 향상시킬 것입니다.

비디오: Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

Optimization of the Ugi Reaction Using Parallel Synthesis and Automated Liquid Handling

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described. Triplicate runs of 48 parallel experiments are reported, varying concentration, solvent and the excess of some of the reagents. The isolation of the product was achieved by a simple filtration and wash procedure. The highest yield obtained was 66% from 0.4 M methanol with 1.2 eq. of imine. This is significantly above the 49% yield obtained from the initial reaction under equimolar concentration at 0.4 M in methanol. Methanol solutions with reagent concentrations of 0.4M or 0.2M gave superior yields while all solvent systems at 0.07M performed poorly. At 0.2M, methanol and ethanol/methanol (60/40) mixtures were statistically equally good while THF/methanol (60/40) was poor and acetonitrile/methanol (60/40) was intermediate. Good reproducibility of the precipitate yields was obtained in these replicate experiments, allowing for subtle interaction effects to be positively identified.

The Ugi reaction has proved to be a convenient way to quickly create diverse libraries of compounds. It involves the reaction of an amine, an aldehyde, a carboxylic acid and an isonitrile typically in methanol at room temperature. In this video, we utilize a 48-slot Mettler-Toledo MiniBlock equipped with filtration tubes and a Mettler-Toledo MiniMapper automated liquid handler was used to deliver the reagents and solvent. The parameters of interest were the concentration, the solvent composition and the excess of some of the reagents.

병렬 합성 및 자동 액체 처리를 사용하여 Ugi 반응의 최적화

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described.  Triplicate runs ...

연구

생물학

Elevated Plus Maze for Mice

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given gene on a specific behavior can be determined by behavioral analysis of mutant mice. If a target gene is expressed in the brain, behavioral phenotype of the mutant mice could elucidate the genetic mechanism of normal behaviors. The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior. The test is based on the natural aversion of mice for open and elevated areas, as well as on their natural spontaneous exploratory behavior in novel environments. The apparatus consists of open arms and closed arms, crossed in the middle perpendicularly to each other, and a center area. Mice are given access to all of the arms and are allowed to move freely between them. The number of entries into the open arms and the time spent in the open arms are used as indices of open space-induced anxiety in mice. Unfortunately, the procedural differences that exist between laboratories make it difficult to duplicate and compare results among laboratories. Here, we present a detailed movie demonstrating our protocol for the elevated plus maze test. In our laboratory, we have assessed more than 90 strains of mutant mice using the protocol shown in the movie. These data will be disclosed as a part of a public database that we are now constructing.
Visualization of the protocol will promote better understanding of the details of the entire experimental procedure, allowing for standardization of the protocols used in different laboratories and comparisons of the behavioral phenotypes of various strains of mutant mice assessed using this test. 


The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior in mice. Here, we present a movie showing the detailed procedures for conducting the test.

마우스에 대한 고가 플러스 메이즈

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given ...

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the richness of biological information it provides. MR does not require any ionizing radiation and can noninvasively provide higher resolution and better signal-to-noise ratio in comparison to other tomographic or spectroscopic modalities. In this protocol, we will focus on small animal MR imaging and MR spectroscopy (MRI/MRS) to noninvasively acquire relaxation weighted 1H images of mouse and to obtain 31P spectra of mouse muscle. This work does not attempt to cover every aspect of small animal MRI/MRS but rather introduces basic procedures of mouse MRI/MRS experiments. The main goal of this work is to inform researchers of the basic procedures for in vivo MR experiments on small animals. The goal is to provide a better understanding of basic experimental procedures to allow researchers new to the MR field to better plan for non-MR components of their studies so that both MR and non-MR procedures are seamlessly integrated.

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

This work describes basic procedures of noninvasive small animal MRI and MRS in vivo.

비침 투 VIVO에서 스몰 애니멀 MRI 및 MRS : 기본 실험 절차

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Multiplexed Fluorometric ImmunoAssay Testing Methodology and Troubleshooting

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if animals have been exposed to adventitious infectious agents (viruses, mycoplasma, and other fastidious microorganisms). Infections of immunocompetent animals are generally transient, yet serum antibody responses to infection often can be detected within days to weeks and persist throughout the life of the host. Serology is the primary diagnostic methodology by which laboratory animals are monitored. Historically the indirect enzyme-linked immunosorbent assay (ELISA) has been the main screening method for serosurveillance. The ELISA is performed as a singleplex, in which one microbial antigen-antibody reaction is measured per well. In comparison the MFIA is performed as a multiplexed assay. Since the microspheres come in 100 distinct color sets, as many as 100 different assays can be performed simultaneously in a single microplate well. This innovation decreases the amount of serum, reagents and disposables required for routine testing while increasing the amount of information obtained from a single test well. In addition, we are able to incorporate multiple internal control beads to verify sample and system suitability and thereby assure the accuracy of results. These include tissue control and IgG anti-test serum species immunoglobulin (&alpha;Ig) coated bead sets to evaluate sample suitability. As in the ELISA and IFA, the tissue control detects non-specific binding of serum immunoglobulin. The &alpha;Ig control (Serum control) confirms that serum has been added and contains a sufficient immunoglobulin concentration while the IgG control bead (System Suitability control), coated with serum species immunoglobulin, demonstrates that the labeled reagents and Luminex reader are functioning properly.

Using Luminex Corporation&#x2019;s xMAP microsphere technology, we have developed the Multiplexed Fluorometric ImmunoAssay (MFIA) for serosurveillance of various laboratory animal species. The MFIA is a suspension microarray where antigen, tissue control or immunoglobulins are covalently linked to color-coded polystyrene microspheres. The MFIA testing method as well as various troubleshooting topics is addressed.

멀티 플렉스 Fluorometric 면역 분석법 테스트 방법론 및 문제 해결

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if ...

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has since been used extensively as a model organism 1. C. elegans possesses key attributes such as simplicity, transparency and short life cycle that have made it a suitable experimental system for fundamental biological studies for many years 2. Discoveries in this nematode have broad implications because many cellular and molecular processes that control animal development are evolutionary conserved 3.
C. elegans life cycle goes through an embryonic stage and four larval stages before animals reach adulthood. Development can take 2 to 4 days depending on the temperature. In each of the stages several characteristic traits can be observed. The knowledge of its complete cell lineage 4,5 together with the deep annotation of its genome turn this nematode into a great model in fields as diverse as the neurobiology 6, aging 7,8, stem cell biology 9 and germ line biology 10. 
An additional feature that makes C. elegans an attractive model to work with is the possibility of obtaining populations of worms synchronized at a specific stage through a relatively easy protocol. The ease of maintaining and propagating this nematode added to the possibility of synchronization provide a powerful tool to obtain large amounts of worms, which can be used for a wide variety of small or high-throughput experiments such as RNAi screens, microarrays, massive sequencing, immunoblot or in situ hybridization, among others. 
Because of its transparency, C. elegans structures can be distinguished under the microscope using Differential Interference Contrast microscopy, also known as Nomarski microscopy. The use of a fluorescent DNA binder, DAPI (4',6-diamidino-2-phenylindole), for instance, can lead to the specific identification and localization of individual cells, as well as subcellular structures/defects associated to them.

Basic Caenorhabditis elegans Methods: Synchronization and Observation

The easiness of maintaining and propagating the nematode C. elegans make it a nice model organism to work with. The possibility of synchronizing worms allows the work with a significant amount of subjects at the same developmental stage, what facilitates the study of one particular process in many animals.

기본<em&gt; Caenorhabditis elegans</em&gt; 방법 : 동기화 및 전망

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has ...

A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins within complex biological samples. Since then, western blotting methodology has become a common component of the molecular biologists experimental repertoire. A cursory search of PubMed using the term &#8220;western blot&#8221; suggests that in excess of two hundred and twenty thousand published manuscripts have made use of this technique by the year 2014. Importantly, the last ten years have seen technical imaging advances coupled with the development of sensitive fluorescent labels which have improved sensitivity and yielded even greater ranges of linear detection. The result is a now truly Quantifiable Fluorescence based Western Blot (QFWB) that allows biologists to carry out comparative expression analysis with greater sensitivity and accuracy than ever before. Many &#8220;optimized&#8221; western blotting methodologies exist and are utilized in different laboratories. These often prove difficult to implement due to the requirement of subtle but undocumented procedural amendments. This protocol provides a comprehensive description of an established and robust QFWB method, complete with troubleshooting strategies.

The advancement of western blotting using fluorescence has allowed detection of subtle changes in protein expression enabling quantitative analyses. Here we describe a robust methodology for detection of a range of proteins across a variety of species and tissue types. A strategy to overcome common technical problems is also provided.

문제 해결 전략 현대 양적 형광 웨스턴 블로 팅에 가이드

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins ...

A Strategy to Validate the Role of Callose-mediated Plasmodesmal Gating in the Tropic Response

The plant hormone auxin plays an important role in many growth and developmental processes, including tropic responses to light and gravity. The establishment of an auxin gradient is a key event leading to phototropism and gravitropism. Previously, polar auxin transport (PAT) was shown to establish an auxin gradient in different cellular domains of plants. However, Han et al. recently demonstrated that for proper auxin gradient formation, plasmodesmal callose-mediated symplasmic connectivity between the adjacent cells is also a critical factor. In this manuscript, the strategy to elucidate the role of particular genes, which can affect phototropism and gravitropism by altering the symplasmic connectivity through modulating plasmodesmal callose synthesis, is discussed. The first step is to screen aberrant tropic responses from 3-day-old etiolated seedlings of mutants or over-expression lines of a gene along with the wild type. This preliminary screening can lead to the identification of a range of genes functioning in PAT or controlling symplasmic connectivity. The second screening involves the sorting of candidates that show altered tropic responses by affecting symplasmic connectivity. To address such candidates, the movement of a symplasmic tracer and the deposition of plasmodesmal callose were examined. This strategy would be useful to explore new candidate genes that can regulate symplasmic connectivity directly or indirectly during tropic responses and other developmental processes.

This article describes the methods for screening the genes controlling plasmodesmal permeability and hence auxin gradient during tropic response. This includes the measurement of the degree of tropic response in hypocotyl of Arabidopsis thaliana and checking plasmodesmal permeability by 8-hydroxypyrene-1,3,6-trisulfonic acid (HPTS) loading and finally callose level assessment.

전략은 트로픽 응답에 Callose 매개 Plasmodesmal 게이팅의 역할을 확인하려면

The plant hormone auxin plays an important role in many growth and developmental processes, including tropic responses to light and gravity. The ...

A Rapid Automated Protocol for Muscle Fiber Population Analysis in Rat Muscle Cross Sections Using Myosin Heavy Chain Immunohistochemistry

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle composition. Various time-consuming methods have traditionally been used to study fiber populations in many fields of research. However, recently developed immunohistochemical methods based on myosin heavy chain protein expression provide a quick alternative to identify multiple fiber types in a single section. Here, we present a rapid, reliable and reproducible protocol for improved staining quality, allowing automatic acquisition of whole cross sections and automatic quantification of fiber populations with ImageJ. For this purpose, embedded skeletal muscles are cut in cross sections, stained using myosin heavy chains antibodies with secondary fluorescent antibodies and DAPI for cell nuclei staining. Whole cross sections are then scanned automatically using a slide scanner to obtain high-resolution composite pictures of the entire specimen. Fiber population analyses are subsequently performed to quantify slow, intermediate and fast fibers using an automated macro for ImageJ. We have previously shown that this method can identify fiber populations reliably to a degree of &#177;4%. In addition, this method reduces inter-user variability and time per analyses significantly using the open source platform ImageJ.

Here, we present a protocol for rapid muscle fiber analyses, which allows improved staining quality, and thereby automatic acquisition and quantification of fiber populations using the freely available software ImageJ.

마이 오신 중쇄 면역를 사용하여 쥐의 근육 크로스 섹션에서 근육 섬유 인구 분석을위한 신속한 자동화 프로토콜

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle ...

Procedure and Key Optimization Strategies for an Automated Capillary Electrophoretic-based Immunoassay Method

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. However, similar to other antibody-based protein assays, optimization of capillary-based immunoassay parameters, such as protein concentration, antibody dilution, and exposure time is an important prerequisite to the generation of meaningful and reliable data. Measurements must fall within the linear range of the assay where changes in signal are directly proportional to changes in lysate concentration. The process of choosing appropriate lysate concentrations, antibody dilutions, and exposure times in the human bronchial epithelial cell line, BEAS-2B, is demonstrated here. Assay linearity is shown over a range of whole cell extract protein concentrations with p53 and &#945;-tubulin antibodies. An example of signal burnout is seen at the highest concentrations with long exposure times, and an &#945;-tubulin antibody dilution curve is shown demonstrating saturation. In addition, example experimental results are reported for doxorubicin-treated cells using optimized parameters.

A capillary-based immunoassay using a commercial platform to measure target proteins from total protein preparations is demonstrated. In addition, assay parameters of exposure time, protein concentration, and antibody dilution are optimized for a cell culture model system.

절차 및 자동화 된 모 세관 전기 이동 기반 Immunoassay 방법에 대 한 중요 한 최적화 전략

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. ...

Simultaneous Measurements of Intracellular Calcium and Membrane Potential in Freshly Isolated and Intact Mouse Cerebral Endothelium

Cerebral arteries and their respective microcirculation deliver oxygen and nutrients to the brain via blood flow regulation. Endothelial cells line the lumen of blood vessels and command changes in vascular diameter as needed to meet the metabolic demand of neurons. Primary endothelial-dependent signaling pathways of hyperpolarization of membrane potential (Vm) and nitric oxide typically operate in parallel to mediate vasodilation and thereby increase blood flow. Although integral to coordinating vasodilation over several millimeters of vascular length, components of endothelium-derived hyperpolarization (EDH) have been historically difficult to measure. These components of EDH entail intracellular Ca2+ [Ca2+]i increases and subsequent activation of small- and intermediate conductance Ca2+-activated K+ (SKCa/IKCa) channels.
Here, we present a simplified illustration of the isolation of fresh endothelium from mouse cerebral arteries; simultaneous measurements of endothelial [Ca2+]i and Vm using Fura-2 photometry and intracellular sharp electrodes, respectively; and a continuous superfusion of salt solutions and pharmacological agents under physiological conditions (pH 7.4, 37 &#176;C). Posterior cerebral arteries from the Circle of Willis are removed free of the posterior communicating and the basilar arteries. Enzymatic digestion of cleaned posterior cerebral arterial segments and subsequent trituration facilitates removal of adventitia, perivascular nerves, and smooth muscle cells. Resulting posterior cerebral arterial endothelial &#34;tubes&#34; are then secured under a microscope and examined using a camera, photomultiplier tube, and one to two electrometers while under continuous superfusion. Collectively, this method can simultaneously measure changes in endothelial [Ca2+]i and Vm in discrete cellular locations, in addition to the spreading of EDH through gap junctions up to millimeter distances along the intact endothelium. This method is expected to yield a high-throughput analysis of the cerebral endothelial functions underlying mechanisms of blood flow regulation in the normal and diseased brain.

Demonstrated here are protocols for (1) freshly isolating intact cerebral endothelial "tubes" and (2) simultaneous measurements of endothelial calcium and membrane potential during endothelium-derived hyperpolarization. Further, these methods allow for pharmacological tuning of endothelial cell calcium and electrical signaling as individual or interactive experimental variables.

세포내 칼슘과 갓 고립과 그대로 마우스 대뇌 피에 막 잠재력의 동시 측정

Cerebral arteries and their respective microcirculation deliver oxygen and nutrients to the brain via blood flow regulation. Endothelial cells line the ...