Name: bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses
Uploaded: 2015-12-29T13:00:00
Duration: 12 min 20 s
Description: Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

The current protocol has been successfully used to generate full-length infectious cDNA clones for two different strains (CNU/LP227 and SA14-14-228) of JEV, a flavivirus whose functional cDNA has proved to be inherently difficult to construct and propagate because of host cell toxicity and the genetic instability of the cloned cDNA.8,74-76 This protocol involves three major components: first, maximizing the synthesis/amplification of a faithful cDNA copy of the viral RNA using high-fidelity reverse transcriptase/DNA polymerase; second, cloning the viral prM-E coding region containing toxic sequences (unpublished data)74,77,78 in a very low-copy number vector BAC from the initial cDNA subcloning to the final full-length cDNA assembly steps; and third, utilizing a cloning vector BAC that can accommodate a foreign DNA with an average size of 120-350 kb,19-21 which apparently tolerates larger DNA inserts than do other cloning vectors. This cloning approach will be generally applicable to many other positive-strand RNA viruses, particularly those with a large RNA genome of ~10 to 32 kb. Generation of an infectious cDNA clone is a key step in developing a reverse genetics system for RNA viruses, especially for positive-strand RNA viruses, because its genome acts as viral mRNA that is translated into proteins by host cell ribosomes. Thus, viral replication can be initiated by the introduction of a cDNA-derived genome-length RNA molecule into a susceptible host cell. The availability of an infectious JEV cDNA clone, when combined with recombinant DNA technology, has increased our understanding of various aspects of the viral life cycle at the molecular level, such as gene expression73,79 and genome replication.63,64 Also, a full-length JEV cDNA clone has proven to be a valuable tool for the development of antiviral vaccines28 and gene delivery vectors.80,81
As with all positive-strand RNA viruses, there are multiple critical steps in constructing a reliable functional cDNA for JEV from which highly infectious RNAs can be synthesized in vitro. Ideally, the sequence of the synthetic RNAs transcribed from a clone of the full-length cDNA should be identical to that of the viral genomic RNA, particularly the 5&#39;- and 3&#39;-terminal sequences that are required for the initiation of viral RNA replication.60-62 In the current protocol, the authentic 5&#39;- and 3&#39;-ends were ensured by placing the SP6 promoter sequence upstream of the first adenine nucleotide of the viral genome and positioning a unique artificial Xba I restriction site downstream of the last thymine nucleotide of the viral genome, respectively. Capped synthetic RNAs with the authentic 5&#39; and 3&#39; ends were produced by run-off transcription of an Xba I-linearized and MBN-treated cDNA template using SP6 RNA polymerase primed with the m7G(5&#39;)ppp(5&#39;)A cap analog. This protocol can be modified in several ways. For in vitro transcription, another bacteriophage RNA polymerase (e.g., T3 or T7) can be used in conjunction with its well-defined promoter sequence.27 As a run-off site, a different restriction site can be utilized if it is not present in the viral genome and if synthetic RNA from the linearized cDNA ends with the authentic 3&#39; end. The importance of the 3&#39;-end nucleotide sequence has been demonstrated by a ~10-fold decrease in RNA infectivity when a synthetic RNA contains three or four virus-unrelated nucleotides at its 3&#39; end.27 In an in vitro transcription reaction, both the m7G(5&#39;)ppp(5&#39;)A and m7G(5&#39;)ppp(5&#39;)G cap analog can be used equally well, although the latter places an unrelated extra G nucleotide upstream of the viral 5&#39;-end, but that addition does not alter the infectivity or replication of synthetic RNA.27 Moreover, removal of the cDNA template from the RNA transcripts by DNase I digestion is not necessary for RNA infectivity tests, because the cDNA template itself is not infectious.27
The BAC technology has now been applied to constructing infectious cDNA clones for a handful of positive-strand RNA viruses, namely, two JEVs, CNU/LP227 and SA14-14-228 (genome size, ~11 kb); two dengue viruses, BR/9026 and NGC29 (~11 kb); the bovine viral diarrhea virus, SD1 (~12 kb);25 two classical swine fever viruses, C and Paderborn (~12 kb);24 the border disease virus, Gifhorn (~12 kb);24 the porcine reproductive and respiratory syndrome virus, PL97-1/LP1 (~15 kb);30 the transmissible gastroenteritis virus, PUR46-MAD (~29 kb);16 the feline infectious peritonitis virus, DF-2 (~29 kb);32 the severe acute respiratory syndrome coronavirus, Urbani (~30 kb);9 the Middle East respiratory syndrome coronavirus, EMC/2012 (~30 kb);17 and the human coronavirus, OC43 (~31 kb).31 The main advantage of using BACs for cDNA construction is the high genetic stability of the large, 1- or 2-copy BAC plasmids; however, the intrinsic nature of its extremely low-copy number is also a great disadvantage, because of very low yields of BAC DNA and the consequent reduction in the purity of the BAC DNA with respect to host chromosomal DNA. In the current protocol, the yield of BAC DNA is maximized by growing E. coli DH10B transformed with the infectious BAC pBAC/SA14-14-2 in a nutrient-rich medium, 2xYT. Despite this effort, the average yield is only ~15 &#181;g of BAC DNA from 500 ml of 2xYT broth. Also, the purity of the BAC DNA is best achieved by using CsCl-EtBr density gradient centrifugation for purification, rather than the commonly used column-based plasmid isolation. However, it is important to keep in mind that the BAC-transformed E. coli should not overgrow because it might jeopardize the genetic stability of the cloned cDNA, and higher growth does not necessarily lead to greater yields or higher-purity BAC DNA.
The protocol described here is an optimized, efficient, and streamlined method for the construction and propagation of a genetically stable full-length infectious cDNA clone as a BAC for JEV, a procedure once thought practically impossible. This same cloning strategy may also be applied to many other positive-strand RNA viruses. In general, infectious cDNA clones enable us to introduce a variety of mutations (e.g., deletions, insertions, and point mutations) into a viral RNA genome to study their biological functions in viral replication and pathogenesis. This cDNA-based reverse genetics system makes it possible to develop and test vaccine and therapeutic candidates targeting a virulence factor(s) of a particular positive-strand RNA virus of interest. In addition, this infectious cDNA technology can also be utilized as a viral vector, capable of expressing a foreign gene(s) of interest for many applications in biomedical research.

For RNA virologists, the advent of recombinant DNA technology in the late 1970s made it possible to convert viral RNA genomes into cDNA clones, which could then be propagated as plasmids in bacteria for the genetic manipulation of RNA viruses.1 The first RNA virus to be molecularly cloned was bacteriophage Q&#946;, a positive-strand RNA virus that infects Escherichia coli. A plasmid containing a complete cDNA copy of the Q&#946; genomic RNA gave rise to infectious Q&#946; phages when introduced into E. coli.2 Shortly thereafter, this technique was applied to poliovirus, a positive-strand RNA virus of humans and animals. A plasmid bearing a full-length cDNA of the poliovirus genomic RNA was infectious when transfected into mammalian cells and capable of producing infectious virions.3 In this &#34;DNA-launched&#34; approach, the cloned cDNAs should be transcribed intracellularly to initiate viral RNA replication; however, it is unclear how the transcription is initiated and how the transcripts are processed to the correct viral sequence. This concern has led to the development of an alternative &#34;RNA-launched&#34; approach, whereby a complete cDNA copy of the viral RNA genome is cloned under a promoter recognized by an E. coli or phage RNA polymerase for the production of synthetic RNAs in vitro with defined 5&#39; and 3&#39; termini, which undergo the complete viral replication cycle when introduced into host cells.4,5 The first success with this approach was reported for brome mosaic virus,6,7 a positive-strand RNA virus of plants. Since then, the RNA-launched approach has been developed for a wide range of positive-strand RNA viruses, including caliciviruses, alphaviruses, flaviviruses, arteriviruses, and coronaviruses.1,4,5,8
In both the DNA- and RNA-launched reverse genetics systems, the construction of a full-length cDNA clone is the key to generating infectious DNA or RNA of positive-strand RNA viruses, but it becomes a considerable technical challenge as the size of the viral genome increases.9-17 In particular, a large RNA genome of ~10-32 kb presents three major obstacles to the cloning of a full-length functional cDNA.18 The first difficulty is the synthesis of a faithful cDNA copy, since the fidelity of RT-PCR is inversely proportional to the length of the viral RNA. The second hurdle is the presence of potentially toxic sequences, since long RNA molecules are more likely to contain unexpected sequences capable of making the cDNA fragment in plasmids unstable in E. coli. The third and most critical issue is the availability of a suitable vector, since it is difficult to find a cloning vector that can house a viral cDNA insert of &#62;10 kb. Over the past three decades, these barriers have been overcome by several advances in enzymology, methodology, and vectorology.1,4,5,8 Of these, the most promising and innovative development is the cloning of large positive-strand RNA viruses as infectious bacterial artificial chromosomes (BACs). The BAC vector is a low-copy cloning plasmid (1-2 copies/cell) based on the E. coli fertility factor, with an average DNA insert size of ~120-350 kb.19-21 A DNA fragment is inserted into the BAC vector in a similar fashion to cloning into general cloning vectors; the resulting BAC clones are stable over many generations in E. coli.22,23 To date, the BAC technology has been used to create infectious cDNA clones for &#62;10 members of three positive-strand RNA virus families, i.e., Flaviviridae,24-29Arteriviridae,30 and Coronaviridae.9,16,17,31,32
Using Japanese encephalitis virus (JEV) as an example, the present work reports the detailed procedures that can be used to construct a genetically stable full-length infectious BAC for a variety of positive-strand RNA viruses. JEV is a zoonotic flavivirus33 that is transmitted in nature between birds, pigs, and other vertebrate hosts by mosquito vectors.34,35 In humans, JEV infection can cause the severe often fatal neurological disease Japanese encephalitis (JE),36 which occurs in Asia and parts of the Western Pacific,37,38 with an estimated annual incidence of ~50,000-175,000 clinical cases.39,40 The genome of JEV is an ~11-kb, single-stranded, positive-sense RNA molecule and consists of a single open reading frame (ORF) flanked by two non-coding regions (NCRs) at the 5&#39; and 3&#39; ends.41,42 The ORF encodes a polyprotein that is cleaved by host and viral proteases to generate 10 individual proteins, designated C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 in the N- to C-terminal direction.34,43,44 Also, an extended form of NS1 (NS1&#39;) is expressed by -1 ribosomal frameshifting at codons 8-9 of NS2A.45,46 Of these 11 proteins, the three structural proteins (C, prM, and E) are essential for the formation of infectious virions,47,48 and the remaining eight nonstructural proteins (NS1 to NS5, and NS1&#39;) are crucial for viral RNA replication,49-51 particle assembly,52-56 and innate immunity evasion.57-59 Both the 5&#39; and 3&#39; NCRs contain conserved primary sequences and form RNA secondary/tertiary structures,60-62 which are important for modulating viral RNA replication.63,64
This protocol describes the tools, methods, and strategies for generating a full-length infectious BAC of JEV SA14-14-2.28 This functional BAC clone contains a complete cDNA copy of the JEV genomic RNA,65 which is encompassed by a promoter for the SP6 RNA polymerase upstream of the viral 5&#39;-end and a unique Xba I restriction site downstream of the viral 3&#39;-end for in vitro run-off transcription. This BAC technology is applicable to constructing a fully functional cDNA molecular clone for an array of positive-strand RNA viruses.

<table border="0" cellpadding="0" cellspacing="0" width="1054">
	<tbody>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">1. Molecular Cloning</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td style="width:235px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2xYT Broth</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">Y2377</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">[3H]UTP</td>
			<td style="width:275px;">PerkinElmer</td>
			<td style="width:243px;">NET380250UC</td>
			<td>Radioactive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">50-mL Tube</td>
			<td style="width:275px;">Thermo Scientific (Nalgene)</td>
			<td style="width:243px;">3114-0050</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">250-mL Bottle</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">356011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose</td>
			<td style="width:275px;">Lonza</td>
			<td style="width:243px;">50004</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose (Low Melting Point)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">16520-100</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvaI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0152S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">AvrII</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0174S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BamHI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsiWI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0553S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">BsrGI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0575S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Butanol</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">A399-1&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cap Analog [m7G(5&#697;)ppp(5&#697;)A]</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">S1405S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cesium Chloride</td>
			<td style="width:275px;">Fisher Scientific</td>
			<td style="width:243px;">BP1595-1</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloramphenicol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0378</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Chloroform</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C2432</td>
			<td>Carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">DE-81 Filter Paper</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">3658-023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">dNTP mix</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18427-088</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">E. coli DH10B&#160;</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18297-010</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">EDTA</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E5134</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethanol&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7023</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Ethidium Bromide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">E7637</td>
			<td>Toxic and highly mutagenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Filter Column (Plasmid Maxiprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-26</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glacial Acetic Acid</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">A6283</td>
			<td>Irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glucose</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">G5400</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glycogen&#160;</td>
			<td style="width:275px;">Roche</td>
			<td style="width:243px;">10901393001</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">High-Fidelity DNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isoamyl Alcohol</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">I9392</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Isopropanol&#160;</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0918</td>
			<td>Flammable</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">LB Broth</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">12795-027</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lithium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">L9650</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Lysozyme</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0663</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Magnesium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M8266</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">M-MLV Reverse Transcriptase</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">18080-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Mung Bean Nuclease</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0250S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Needle (18G, 20G)</td>
			<td style="width:275px;">BD</td>
			<td style="width:243px;">305196, 305175</td>
			<td>Biohazardous (Sharps waste)</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">NotI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0189S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Oligonucleotide</td>
			<td style="width:275px;">Integrated DNA Technologies</td>
			<td style="width:243px;">Custom Oligonucleotide Synthesis</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">PacI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0547S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">pBeloBAC11</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">ER2420S (E4154S)</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol (Buffer-Saturated)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15513-039</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15593-031</td>
			<td>Toxic and highly corrosive</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Phenol:Guanidine Isothiocyanate</td>
			<td style="width:275px;">Life Technologies (Ambion)</td>
			<td style="width:243px;">10296-010</td>
			<td>Toxic, corrosive, and irritating</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Pme I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0560S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Acetate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0698</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">RNase Inhibitor</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">10777-019</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">rNTP Set</td>
			<td style="width:275px;">GE Healthcare Life Sciences</td>
			<td style="width:243px;">27-2025-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sealable Polypropylene Tube (16 &#215; 76 mm)&#160;</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">342413</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SfiI</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0123S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sma I</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0141S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Acetate</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S2889</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Dodecyl Sulfate</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0227</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Hydroxide</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S5881</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">SP6 RNA Polymerase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0207S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Spin Column (Plasmid Miniprep Kit)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">K2100-11</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Syringe</td>
			<td style="width:275px;">HSW NORM-JECT</td>
			<td style="width:243px;">4200.000V0</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">T4 DNA Ligase</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tris</td>
			<td style="width:275px;">Amresco</td>
			<td style="width:243px;">0826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">tRNA (yeast)</td>
			<td style="width:275px;">Life Technologies (Invitrogen)</td>
			<td style="width:243px;">15401-011</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">XbaI&#160;</td>
			<td style="width:275px;">New England BioLabs</td>
			<td style="width:243px;">R0145S</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">2. Cell Culture</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Alpha Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">12561-049</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Conical Tube (50 mL)</td>
			<td style="width:275px;">VWR</td>
			<td style="width:243px;">21008-242</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Crystal Violet&#160;</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">C0775</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Culture Dish (150 mm)&#160;</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">93150&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Cuvette (2-mm Gap)</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">450125&#160;</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Fetal Bovine Serum&#160;</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Formaldehyde</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">F1635</td>
			<td>Toxic and carcinogenic</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Glutamine</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25030-081</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Minimal Essential Medium</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">61100-061</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Penicillin/Streptomycin</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">15070-063</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P3911</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Potassium Phosphate Monobasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">P9791</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Six-Well Plate</td>
			<td style="width:275px;">TPP</td>
			<td style="width:243px;">92006</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Chloride</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3014</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Sodium Phosphate Dibasic</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">S3264</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Trypsin-EDTA (0.25%)</td>
			<td style="width:275px;">Life Technologies (Gibco)</td>
			<td style="width:243px;">25200-056</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vitamins</td>
			<td style="width:275px;">Sigma-Aldrich</td>
			<td style="width:243px;">M6895</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Name</td>
			<td style="width:275px;">Company</td>
			<td style="width:243px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">3. Equipment</td>
			<td style="width:275px;"></td>
			<td style="width:243px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Agarose Gel Electrophoresis System</td>
			<td style="width:275px;">Mupid</td>
			<td style="width:243px;">MPDEXU-01</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">CO2 Incubator</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">Heracell 150i</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Desktop Centrifuge&#160;</td>
			<td style="width:275px;">Thermo Scientific</td>
			<td style="width:243px;">ST16R</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Electroporator</td>
			<td style="width:275px;">Harvard Apparatus</td>
			<td style="width:243px;">ECM 830</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Longwave Ultraviolet Lamps (Handheld)</td>
			<td style="width:275px;">UVP</td>
			<td style="width:243px;">UVGL-58</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Tabletop Centrifuge</td>
			<td style="width:275px;">Beckman Coulter</td>
			<td style="width:243px;">368826</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Thermocycler</td>
			<td style="width:275px;">Life Technologies (Applied Biosystems)</td>
			<td style="width:243px;">GeneAmp PCR System 9700</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Vortexer</td>
			<td style="width:275px;">Scientific Industries</td>
			<td style="width:243px;">G-560</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:304px;">Water Bath</td>
			<td style="width:275px;">Jeio Tech</td>
			<td style="width:243px;">WB-10E</td>
			<td></td>
		</tr>
	</tbody>
</table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

For all positive-strand RNA viruses, the reliability and efficiency of a reverse genetics system depend on the genetic stability of a cloned full-length cDNA, whose sequence is equivalent to the consensus sequence of viral genomic RNA.27 Figure 1 shows a five-step strategy for the construction of a full-length infectious cDNA as a BAC for JEV SA14-14-228: Step 1, purification of viral RNA from the cell culture supernatant of JEV-infected BHK-21 cells (Figure 1A); Step 2, synthesis of four overlapping cDNA amplicons (F1 to F4) spanning the whole viral genome (Figure 1B); Step 3, subcloning of each of the four contiguous cDNA fragments into a BAC vector, creating pBAC/F1 to pBAC/F4 (Figure 1C); Step 4, modification of the cloned cDNAs for in vitro run-off transcription with SP6 RNA polymerase, i.e., placing an SP6 promoter sequence immediately upstream of the viral 5&#39;-end (pBAC/F1SP6), eliminating a pre-existing internal Xba I site at nucleotide 9131 by introducing a silent point mutation, A9134&#8594;T (pBAC/F3KO), and inserting a new artificial Xba I run-off site immediately downstream of the viral 3&#39;-end (pBAC/F4RO) (Figure 1D); and Step 5, assembly of a full-length SA14-14-2 cDNA BAC, pBAC/SA14-14-2 (Figure 1E). Table 1 lists the oligonucleotides used in this cloning procedure.28
For the construction of a functional JEV cDNA, the first important step is the synthesis of the four overlapping cDNA fragments using the purified viral RNA as a template for RT-PCR. Figure 2 provides a representative result for the four RT-PCR products that were electrophoresed on a 0.8% agarose gel. This gel demonstrates clearly that a full-length JEV cDNA is amplified into four overlapping cDNA fragments. Occasionally, RT-PCR reactions might yield one or more additional virus-specific or nonspecific products that are mostly smaller than the expected product, because of the nonspecific annealing of primers during cDNA synthesis/amplification. On the other hand, little or no expected RT-PCR product would be amplified because of accidental RNase contamination during the viral RNA isolation or improper RT-PCR performance.
The next key step is the cloning and modification of a partial- or full-length JEV cDNA in BAC, which is a relatively straightforward procedure that uses standard recombinant DNA techniques.69 Figure 3 presents a representative outcome for the purification of the BAC clone containing a full-length cDNA of JEV SA14-14-2 by banding in a CsCl-EtBr gradient. In this experiment, after centrifugation for 16 hr at 401,700 &#215; g, two distinct bands, i.e., the E. coli chromosomal DNA above and the supercoiled BAC plasmid DNA below, are visible in the middle of the tube under long-wave ultraviolet light. A minimal volume (~400 &#181;l) of the lower BAC DNA band was carefully collected by poking a hole with a syringe on the side of the tube. Subsequently, the EtBr was extracted from the BAC DNA by butanol extraction, and the EtBr-free BAC DNA was concentrated by ethanol precipitation.
The final step is the determination of the specific infectivity of the synthetic RNAs transcribed in vitro from the full-length SA14-14-2 BAC (pBAC/SA14-14-2) after RNA transfection into permissive cells (Figure 4). This step involves three sequential steps: Step 1, linearization of the full-length SA14-14-2 cDNA at the 3&#39;-end of the viral genome (Figure 4A); Step 2, production of synthetic RNAs from the linearized cDNA by run-off transcription (Figure 4B); and Step 3, rescue of the recombinant viruses in BHK-21 cells transfected with the synthetic RNAs (Figure 4C). Experimentally, two independent clones of pBAC/SA14-14-2 were linearized with Xba I digestion and treated with MBN to remove the four-base 5&#39; overhang generated by the Xba I digestion. The linearized BACs were cleaned up by phenol-chloroform extraction, followed by ethanol precipitation. The linearization of the two purified BACs was demonstrated on a 0.8% agarose gel (Figure 5A). The phenol-chloroform extraction must be done carefully to ensure that the linearized BACs are RNase-free. Each of the two linearized BACs served as a cDNA template for run-off transcription using SP6 RNA polymerase in the presence of the m7G(5&#39;)ppp(5&#39;)A cap analog. The integrity of the synthetic RNAs was shown by running aliquots of the two transcription reaction mixtures on a 0.6% agarose gel, along with a reference 1 kb DNA ladder (Figure 5B). In this simple assay, the major prominent RNA band always migrated just below the 3 kb reference DNA band and appeared to be sharp. However, degraded RNA would have a smeared appearance on the same gel.
An infectious center assay is the gold standard for determining the specific infectivity of the synthetic RNAs. This assay was done by electroporating BHK-21 cells with RNA samples, seeding equal aliquots of the 10-fold serially diluted electroporated cells in 6-well plates containing na&#239;ve BHK-21 cells (3 &#215; 105 cells/well), and overlaying agarose onto the cell monolayers. After incubation for 4 days, surviving cells were fixed with formaldehyde and stained with a crystal violet solution to quantify the number of infectious centers (plaques), which corresponds to the number of infectious RNA molecules delivered into the cells (Figure 6A). Since the cDNA template used for in vitro transcription has been proven to be non-infectious,27 an aliquot of the transcription reaction mixture was directly used for electroporation. Electroporation is the preferred method for RNA transfection; alternatively, RNAs can be transfected by other methods using DEAE-dextran and cationic liposomes. RNA electroporation is very effective, but &#34;arcing&#34; of the electric pulse occurs rarely if salts are present in the electroporation reaction or if the electroporation cuvette is reused. The expression of viral proteins in RNA-transfected cells was examined by immunofluorescence assays using an anti-NS1 rabbit antiserum (Figure 6B). The production of viral particles accumulated in the supernatants of RNA-transfected cells was analyzed by plaque assays (Figure 6C). The results of these experiments show clearly that the cDNA-derived synthetic RNAs are infectious in permissive BHK-21 cells, generating a high titer of recombinant viruses.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Oligonucleotide</td>
			<td>Sequencea (5&#39; to 3&#39;)</td>
			<td>Positionb</td>
			<td>Polarity</td>
		</tr>
		<tr>
			<td>1RT</td>
			<td>TAGGGATCTGGGCGTTTCTG 
			GCAAAT</td>
			<td>2578&#8211;2603</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>1F</td>
			<td>aatcccgggAGAAGTTTATC 
			TGTGTGAACTT</td>
			<td>1&#8211;22</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>1R</td>
			<td>attgcggccgcCCACGTCGT 
			TGTGCACGAAGAT</td>
			<td>2532&#8211;2553</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>2RT</td>
			<td>TTCTGCCTACTCTGCCCCTC 
			CGTTGA</td>
			<td>5975&#8211;6000</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>2F</td>
			<td>aatcccgggTCAAGCTCAGT 
			GATGTTAACAT</td>
			<td>1800&#8211;1821</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>2R</td>
			<td>attgcggccgcGATGGGTTT 
			CCGAGGATGACTC</td>
			<td>5929&#8211;5950</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>3RT</td>
			<td>ACGGTCTTTCCTTCTGCTGC 
			AGGTCT</td>
			<td>9426&#8211;9451</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>3F</td>
			<td>aatcccgggGAGGATACATT 
			GCTACCAAGGT</td>
			<td>5500&#8211;5521</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>3R</td>
			<td>attgcggccgcGTAAGTCAG 
			TTCAATTATGGCT</td>
			<td>9380&#8211;9401</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>4RT</td>
			<td>AGATCCTGTGTTCTTCCTCA 
			CCACCA</td>
			<td>10952&#8211;10977</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>4F</td>
			<td>aatcccgggAGTGGAAGGCT 
			CAGGCGTCCAA</td>
			<td>9200&#8211;9221</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>4R</td>
			<td>attgcggccgcAGATCCTGT 
			GTTCTTCCTCACC</td>
			<td>10956&#8211;10977</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>SP6F</td>
			<td>cataccccgcgtattcccac 
			ta</td>
			<td></td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>SP6R</td>
			<td>ACAGATAAACTTCTctatag 
			tgtcccctaaa</td>
			<td>1&#8211;14</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>F1F</td>
			<td>aggggacactatagAGAAGT 
			TTATCTGTGTG</td>
			<td>1&#8211;17</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>F1R</td>
			<td>TGGATCATTGCCCATGGTAA 
			GCTTA</td>
			<td>638&#8211;662</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>X1F</td>
			<td>CGAATGGATCGCACAGTGTG 
			GAGAG</td>
			<td>8403&#8211;8427</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>X1R</td>
			<td>AAAGCTTCAAACTCAAGATA 
			CCGTGCTCC</td>
			<td>9120&#8211;9148</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>X2F</td>
			<td>GGAGCACGGTATCTTGAGTT 
			TGAAGCTTT</td>
			<td>9120&#8211;9148</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>X2R</td>
			<td>cacgtggacgagggcatgcc 
			tgcag</td>
			<td></td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>ROF</td>
			<td>CCAGGAGGACTGGGTTACCA 
			AAGCC</td>
			<td>10670&#8211;10694</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>ROR</td>
			<td>agggcggccgctctagAGAT 
			CCTGTGTTCTTCCTCACCAC</td>
			<td>10954&#8211;10977</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td colspan="4">aJEV sequences are shown in uppercase letters, and BAC sequences are indicated in lowercase letters. 
			bNucleotide position refers to the complete genome sequence of JEV SA14-14-2 (Genbank accession number JN604986).</td>
		</tr>
	</tbody>
</table>
Table 1: Oligonucleotides used for cDNA synthesis, PCR amplification, and BAC mutagenesis.
<img alt="Figure 1" src="/files/ftp_upload/53164/53164fig1.jpg" /> 
Figure 1.&#160;Strategy for the construction of a full-length cDNA of JEV SA14-14-2 as a BAC. (A) Isolation of viral RNA from JEV particles. Shown is a schematic diagram of the genomic RNA of JEV SA14-14-2. (B) Synthesis of four overlapping cDNA fragments (F1 to F4) covering the entire viral genome. (C) Subcloning of four overlapping cDNA fragments into a BAC vector, creating pBAC/F1 to pBAC/F4. (D) Modification of the cloned cDNAs for run-off transcription in vitro. pBAC/F1SP6 is a derivative of pBAC/F1 that contains the SP6 promoter sequence upstream of the viral 5&#39;-end. pBAC/F3KO is a derivative of pBAC/F3 that contains a silent point mutation (A9134&#8594;T, asterisk). pBAC/F4RO is a derivative of pBAC/F4 that contains an artificial Xba I run-off site downstream of the viral 3&#39;-end. (E) Assembly of a full-length SA14-14-2 BAC (pBAC/SA14-14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53164/53164fig2.jpg" /> 
Figure 2.&#160;Synthesis of four overlapping cDNA fragments (F1 to F4) spanning the full-length genomic RNA of JEV SA14-14-2. The four RT-PCR products are evaluated by electrophoresis in a 0.8% agarose gel. M, 1 kb DNA ladder. The expected sizes of the four cDNA fragments are indicated at the bottom of the gel image. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53164/53164fig3.jpg" /> 
Figure 3.&#160;Purification of the BAC containing a full-length cDNA of JEV SA14-14-2. The BAC plasmid is isolated from E. coli DH10B by the SDS-alkaline lysis method and further purified by banding in a CsCl-EtBr gradient. Presented is an example of the CsCl-EtBr gradient using a 16 &#215; 76 mm sealable polypropylene tube. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53164/53164fig4.jpg" /> 
Figure 4.&#160;Overview of the recovery of infectious viruses from a full-length JEV SA14-14-2 cDNA assembled in a BAC. (A) Linearization of the cDNA template. The full-length JEV BAC is cut with Xba I and treated with MBN. (B) Synthesis of the RNA transcripts. The linearized cDNA is transcribed by SP6 RNA polymerase in the presence of the m7G(5&#39;)ppp(5&#39;)A cap analog. (C) Recovery of the synthetic JEVs. The in vitro transcribed RNAs are transfected into BHK-21 cells by electroporation, which generates a high titer of synthetic virus. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/53164/53164fig5.jpg" /> 
Figure 5.&#160;Synthesis of the RNAs by in vitro transcription using a full-length JEV BAC as a cDNA template. (A) Generation of the linearized full-length JEV BAC, pBAC/SA14-14-2. Two independent clones of pBAC/SA14-14-2 (Cl.1 and Cl.2) are linearized by digestion with Xba I and subsequent treatment with MBN. The linearized BACs are examined by electrophoresis in a 0.8% agarose gel. (B) Production of the synthetic RNAs by run-off transcription. Each of the two linearized BACs is used as a template for SP6 RNA polymerase run-off transcription. Aliquots of the two transcription reactions are run on a 0.6% agarose gel. M, 1 kb DNA ladder. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" src="/files/ftp_upload/53164/53164fig6.jpg" /> 
Figure 6. Specific infectivity of the synthetic RNAs transcribed from a full-length JEV BAC and the recovery of synthetic virus. BHK-21 cells are mock-electroporated (Mock) or electroporated with the RNA transcripts derived from each of the two independent clones of the full-length JEV BAC (Cl.1 and Cl.2). (A) RNA infectivity. The cells are overlaid with agarose and stained with crystal violet at 4 days post-transfection. RNA infectivity is determined by infectious center assays to estimate the amount of infectious RNA electroporated into the cells (left panel). Also, representative images of infectious centers are shown (right panel). (B) Protein expression. The cells are cultured in 4-well chamber slides. Viral protein expression in RNA-electroporated cells at 20 hr post-transfection (hpt) is analyzed by immunofluorescence assays using a primary anti-NS1 rabbit antiserum and a secondary Cy3-conjugated goat anti-rabbit IgG (red). The nuclei are counterstained with 4&#39;,6-diamidino-2-phenylindole (blue). The immunofluorescence images are overlaid on their corresponding differential interference contrast images. (C) Virus yield. The cells are cultured in 150 mm culture dishes. The production of infectious virions accumulated in the culture supernatants of RNA-electroporated cells at 22 and 40 hpt is examined by plaque assays. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

Separation of Single-stranded DNA, Double-stranded DNA and RNA from an Environmental Viral Community Using Hydroxyapatite Chromatography

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2. Viruses modulate host cell abundance and diversity, contribute to the cycling of nutrients, alter host cell phenotype, and influence the evolution of both host cell and viral communities through the lateral transfer of genes 3. Numerous studies have highlighted the staggering genetic diversity of viruses and their functional potential in a variety of natural environments. 
Metagenomic techniques have been used to study the taxonomic diversity and functional potential of complex viral assemblages whose members contain single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) and RNA genotypes 4-9. Current library construction protocols used to study environmental DNA-containing or RNA-containing viruses require an initial nuclease treatment in order to remove nontargeted templates 10. However, a comprehensive understanding of the collective gene complement of the virus community and virus diversity requires knowledge of all members regardless of genome composition. Fractionation of purified nucleic acid subtypes provides an effective mechanism by which to study viral assemblages without sacrificing a subset of the community&#x2019;s genetic signature. 
Hydroxyapatite, a crystalline form of calcium phosphate, has been employed in the separation of nucleic acids, as well as proteins and microbes, since the 1960s11. By exploiting the charge interaction between the positively-charged Ca2+ ions of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acid subtypes, it is possible to preferentially elute each nucleic acid subtype independent of the others. We recently employed this strategy to independently fractionate the genomes of ssDNA, dsDNA and RNA-containing viruses in preparation of DNA sequencing 12. Here, we present a method for the fractionation and recovery of ssDNA, dsDNA and RNA viral nucleic acids from mixed viral assemblages using hydroxyapatite chromotography.

We describe an efficient method to separate single-stranded DNA, double-stranded DNA and RNA molecules from environmental viral communities. Nucleic acids are fractionated using hydroxyapatite chromatography with increasing concentrations of phosphate-containing buffers. This method permits the isolation of all viral nucleic acid types from environmental samples.

Viruses, particularly bacteriophages (phages), are the most numerous biological entities on Earth1,2.  Viruses modulate host cell abundance and diversity, ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Genetic Manipulation in &Delta;ku80 Strains for Functional Genomic Analysis of Toxoplasma gondii

Targeted genetic manipulation using homologous recombination is the method of choice for functional genomic analysis to obtain a detailed view of gene function and phenotype(s). The development of mutant strains with targeted gene deletions, targeted mutations, complemented gene function, and/or tagged genes provides powerful strategies to address gene function, particularly if these genetic manipulations can be efficiently targeted to the gene locus of interest using integration mediated by double cross over homologous recombination.
Due to very high rates of nonhomologous recombination, functional genomic analysis of Toxoplasma gondii has been previously limited by the absence of efficient methods for targeting gene deletions and gene replacements to specific genetic loci. Recently, we abolished the major pathway of nonhomologous recombination in type I and type II strains of T. gondii by deleting the gene encoding the KU80 protein1,2. The &Delta;ku80 strains behave normally during tachyzoite (acute) and bradyzoite (chronic) stages in vitro and in vivo and exhibit essentially a 100% frequency of homologous recombination. The &Delta;ku80 strains make functional genomic studies feasible on the single gene as well as on the genome scale1-4.
Here, we report methods for using type I and type II &Delta;ku80&Delta;hxgprt strains to advance gene targeting approaches in T. gondii. We outline efficient methods for generating gene deletions, gene replacements, and tagged genes by targeted insertion or deletion of the hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) selectable marker. The described gene targeting protocol can be used in a variety of ways in &Delta;ku80 strains to advance functional analysis of the parasite genome and to develop single strains that carry multiple targeted genetic manipulations. The application of this genetic method and subsequent phenotypic assays will reveal fundamental and unique aspects of the biology of T. gondii and related significant human pathogens that cause malaria (Plasmodium sp.) and cryptosporidiosis (Cryptosporidium).

Here we report a method for using type I and type II &Delta;ku80 strains of Toxoplasma gondii to efficiently generate targeted gene deletions and gene replacements for functional genomic analysis.

Targeted genetic manipulation using homologous recombination is the method of choice for functional genomic analysis to obtain a detailed view of gene ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. Polysaccharides such as glycogen, glycoproteins, and glycolipids stain bright magenta making it easy to enumerate positive and negative cells within the tissue. In muscle cells PAS staining is used to determine the glycogen content in different types of muscle cells, while in blood cell samples PAS staining has been explored as a diagnostic tool for a variety of conditions. Blood contains a proportion of white blood cells that belong to the immune system. The notion that cells of the immune system possess glycogen and use it as an energy source has not been widely explored. Here, we describe an adapted version of the PAS staining protocol that can be applied on peripheral blood mononuclear immune cells from human venous blood. Small cells with PAS-positive granules and larger cells with diffuse PAS staining were observed. Treatment of samples with amylase abrogates these patterns confirming the specificity of the stain. An alternate technique based on enzymatic digestion confirmed the presence and amount of glycogen in the samples. This protocol is useful for hematologists or immunologists studying polysaccharide content in blood-derived lymphocytes.

Periodic acid Schiff staining is a technique that visualizes the polysaccharide content of tissues. This article demonstrates periodic acid Schiff staining protocol adapted for use on peripheral blood mononuclear cells purified from human venous blood. Such samples are enriched for lymphocytes and other white blood cells of the immune system.

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Electroporation of Functional Bacterial Effectors into Mammalian Cells

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. This information is particularly valuable in the context of host-pathogen interactions. Many pathogen proteins function within host cells in a variety of way such as, enabling evasion of the host immune system and survival within the intracellular environment. To study these pathogen-protein host-cell interactions, several approaches are commonly used, including: in vivo infection with a strain expressing a tagged or mutant protein, or introduction of pathogen genes via transfection or transduction. Each of these approaches has advantages and disadvantages. We sought a means to directly introduce exogenous proteins into cells. Electroporation is commonly used to introduce nucleic acids into cells, but has been more rarely applied to proteins although the biophysical basis is exactly the same. A standard electroporator was used to introduce affinity-tagged bacterial effectors into mammalian cells. Human epithelial and mouse macrophage cells were cultured by traditional methods, detached, and placed in 0.4 cm gap electroporation cuvettes with an exogenous bacterial pathogen protein of interest (e.g. Salmonella Typhimurium GtgE). After electroporation (0.3 kV) and a short (4 hr) recovery period, intracellular protein was verified by fluorescently labeling the protein via its affinity tag and examining spatial and temporal distribution by confocal microscopy. The electroporated protein was also shown to be functional inside the cell and capable of correct subcellular trafficking and protein-protein interaction. While the exogenous proteins tended to accumulate on the surface of the cells, the electroporated samples had large increases in intracellular effector concentration relative to incubation alone. The protocol is simple and fast enough to be done in a parallel fashion, allowing for high-throughput characterization of pathogen proteins in host cells including subcellular targeting and function of virulence proteins.

Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

The study of protein interactions in the context of living cells can generate critical information about localization, dynamics, and interacting partners. ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...