his work was funded by the Spanish Ministry of Economy and Competitiveness (AGL2015-70140-R to D. Rizos, AGL2015-66145R to A. Gutierrez-Adan and J. F. P&#233;rez-Guti&#233;rrez) and Seneca Foundation of Murcia (Grant 20040/GERM/16 to F. Garc&#237;a-V&#225;zquez)

Ethics statement: All the experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee of the Instituto Nacional de Investigaci&#243;n y Tecnolog&#237;a Agraria y Alimentaria (INIA). All the experiments were performed in accordance to the Guide for the Care and Use of Laboratory Animals, as adopted by the Society for the Study of Reproduction, and to the Animal Welfare Act for the care of Marine Mammals.
1. Dolphin Sperm Collection and Cryopreservation
<ol>
	<li>Preparation
	<ol>
		<li>Make FERT medium (heparin- and hypotaurine-free). Prepare FERT-TALP medium supplemented with 25 mM bicarbonate, 22 mM sodium lactate, 1 mM sodium pyruvate, 6-mg/mL fatty acid-free BSA, and 10 mg/mL heparin (pH 7.4). 
		NOTE: Prepare this medium on the day of use and keep it at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity for at least 2 h before use.</li>
		<li>Prepare TRIS egg yolk-based buffer. Dissolve 30.28 g/L Tris, 16.75 g/L citric acid, 12.5 g/L fructose, and 0.5 g/L streptomycin in ultrapure water (pH 7.3, osmolality = 310 mOsm/kg). Add 20% egg yolk (v/v).</li>
	</ol>
	</li>
	<li>Train a proven breeding male bottlenose dolphin to lie in dorsal recumbence near the edge of the pool for voluntary semen collection. 
	NOTE: The male dolphin should be trained over 6 months by positive reinforcement, as described previously4.</li>
	<li>Perform various tactile stimulations by gently pressing on the cranial area of the genital groove of the dolphin to elicit voluntary extrusion of the penis from the genital groove.</li>
	<li>After achieving a complete erection, direct the penis tip into a sterile container to obtain the ejaculate.</li>
	<li>Maintain the sperm sample&#160;at 37 &#176;C until the analysis. Repeat steps 1.3 and 1.4 for successive ejaculate collections, using a new propylene glass each time.</li>
	<li>Immediately after collection, determine the volume using a graduated glass cylinder previously warmed to 37 &#176;C. Evaluate the color, pH, and osmolarity (using a micro-osmometer) of the ejaculate.</li>
	<li>To evaluate the concentration of spermatozoa in the ejaculate, add 10 &#181;L of the sperm suspension to a eppendorf tube containing 90 &#181;L of distilled water. Determine the sperm concentration using a sperm counting chamber. 
	NOTE: During the evaluation, keep the rest of the ejaculate at 37 &#176;C.</li>
	<li>Evaluate the motility parameters.
	<ol>
		<li>Take 10 &#181;L of the sperm sample and place it in a pre-warmed sperm chamber.</li>
		<li>Evaluate the motility using a computer-assisted sperm analysis system, previously validated for the bottlenose dolphin, to objectively assess the sperm motility2. 
		NOTE: If necessary, dilute the sperm sample with FERT medium (heparin- and hypotaurine-free) for the adequate visualization of the sperm motility. During the evaluation, maintain the sample at 37 &#176;C on a heated microscope stage.</li>
	</ol>
	</li>
	<li>Take 20 &#181;L of sperm sample and evaluate the viability and sperm morphology as previously described5.</li>
	<li>Transfer the sperm sample to a centrifuge tube. Centrifuge the sperm sample at 250 x g for 5 min. After determine the sperm concentration using a counting chamber, adjust the sperm concentration to 400 x 106 spermatozoa/mL. 
	NOTE: If necessary, dilute the pellet from the concentrated ejaculates with isolated seminal plasma from an excess volume of the same ejaculate by centrifugation (250 x g, 10 min).
	<ol>
		<li>Over the course of 5 min, slowly dilute the sperm sample 1:1 (v/v) with a TRIS egg yolk-based buffer containing 1.5% glycerol. Place the tube containing the sperm suspension at 5 &#176;C for 1 h 30 min.</li>
		<li>Perform a second dilution of the sperm suspension with a TRIS egg yolk-based buffer containing glycerol to obtain a 3% final glycerol concentration and a final concentration of 200 x 106 sperm/mL. Maintain the sperm suspension at 5 &#176;C for 10 min.</li>
	</ol>
	</li>
	<li>Load the sperm suspension into 0.25 mL straws. Heat-seal the straws. Place the straws in a rack 4.5 cm above liquid nitrogen for 10 min. Plunge the straws into the liquid nitrogen and store until evaluation.</li>
</ol>
2. Heterologous In Vitro Fertilization Using Zona Intact Bovine Oocytes
<ol>
	<li>Preparation
	<ol>
		<li>Prepare the staining solution and the mounting medium.
		<ol>
			<li>Prepare Hoechst stock solution by dissolving 1 mg of Hoechst in 1 mL of distilled water. Make 30 &#181;L aliquots and keep them in the dark at -20 &#176;C until use. Prepare staining solution by adding 25 &#181;L of Hoechst stock solution to 5 mL of phosphate-buffered saline (PBS) supplemented with 1 g/L PVA. Mix well and keep in the dark at 4 &#176;C until use.</li>
			<li>Prepare mounting medium by mixing 6.25 mL of PBS with 6.25 mL of glycerol and 6.25 &#181;L of Hoechst stock solution. Mix well and keep in the dark at 4 &#176;C until use.</li>
		</ol>
		</li>
		<li>Prepare the medium for oocyte collection and in vitro fertilization.
		<ol>
			<li>Prepare saline solution by adding 0.5 mL of gentamycin to 0.9% NaCl distilled water.</li>
			<li>Prepare the stock maturation medium by adding 10 ng/mL epidermal growth factor (EGF) and 10% fetal calf serum (FCS) to 10 mL of TCM-199. Maintain both media at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity for at least 2 h before use.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Collect the ovaries at the slaughterhouse in saline solution at 33-35 &#176;C and transport them to the laboratory within 4 h from collection.</li>
	<li>Once in the laboratory, wash the ovaries three times to remove the debris and blood using saline solution previously warmed to 37 &#176;C. Maintain the ovaries in saline solution at 37 &#176;C during the process.</li>
	<li>Aspirate 2 to 8 mm follicles with an 18G needle and a 10-mL syringe. Collect the aspirated follicular fluid in 50 mL tubes.</li>
	<li>Allow the follicular fluid containing the oocytes to stand for approximately 15 min at 37 &#176;C, until the cells sediment. Remove the supernatant of the tube with a Pasteur pipette and re-suspend the pellet in PBS.</li>
	<li>Recover the cumulus-oocyte complexes (COCs) in 90 mm dishes under a stereomicroscope.</li>
	<li>Wash the COCs three times in PBS and once in maturation medium.</li>
	<li>Transfer morphologically normal COCs to 4-well dishes, each well containing 500 mL of maturation medium, in groups of 50 COCs per well. 
	NOTE: Here, three wells &#8211; one well for heterologous IVF, one control well for homologous IVF, and one well containing only matured COCs as a parthenogenetic control &#8211; were used.</li>
	<li>Incubate the COCs for 24 h at 38.5 &#176;C, under an atmosphere of 5% CO2 and in air with maximum humidity.</li>
	<li>Prepare the medium and the density gradient.
	<ol>
		<li>To prepare fertilization medium (FERT), supplement FERT-TALP medium with 25 mM bicarbonate, 22 mM sodium lactate, 1 mM sodium pyruvate, 6 mg/mL fatty acid-free BSA, and 10 mg/mL heparin. Maintain at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity for at least 2 h before use.</li>
		<li>Prepare the density gradient by adding 1 mL of density gradient medium to a 15-mL tube and 3 mL of washing solution to a 15-mL tube. Maintain them at 38.5 &#176;C for at least 1 h.</li>
	</ol>
	</li>
	<li>Wash the in vitro matured oocytes twice in FERT medium.</li>
	<li>Transfer the oocytes to 4-well dishes, each well containing 50 COCs in 250 mL of FERT. Maintain the 4-well dishes at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity while preparing the sperm for fertilization.</li>
	<li>Thaw a frozen straw containing dolphin spermatozoa in a water bath at 37 &#176;C for 50 s. 
	NOTE: Bovine semen for homologous IVF must be processed in parallel, following the standard protocol for homologous bovine IVF.</li>
	<li>Take 10 &#181;L of the sperm sample and place it in a pre-warmed sperm counting chamber. Evaluate the motility using a computer-assisted sperm analysis system, previously validated for the species, to objectively assess the sperm motility. During this time, maintain the sperm sample at 38.5 &#176;C.</li>
	<li>Add the sperm sample to the density gradient tube (step 2.10.2). Centrifuge for 10 min at 250 x g.</li>
	<li>Carefully remove the supernatant using a Pasteur pipette. Add 3 mL of the washing solution to the tube containing the pellet. Re-suspend the pellet by gently mixing.</li>
	<li>Centrifuge for 5 min at 250 x g. Remove the supernatant with a Pasteur pipette to a sperm volume of 300 &#181;L.</li>
	<li>Add 5 &#181;L of the sperm suspension to a microcentrifuge containing 95 &#181;L of distilled water. Maintain the sperm suspension at 38.5 &#176;C. Fill the cell counting chamber with 10 &#181;L of the 1:20 sperm dilution and measure the concentration. Calculate the amount of FERT medium that must be added to 100 &#181;L of the sperm to obtain 2 x 106 spermatozoa/mL.</li>
	<li>Add the calculated FERT and sperm volume to a 15-mL tube and gently mix using a Pasteur pipette.</li>
	<li>Add 250 &#181;L of the sperm-FERT suspension to each well of the 4-well dish containing the FERT medium with the matured oocytes to obtain a final concentration of 1 x 106 spermatozoa/mL.</li>
	<li>Co-incubate the gametes for 18 h at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity.</li>
	<li>Prepare the culture medium based on the synthetic oviductal fluid supplemented with 5% FCS. Prepare 25 &#181;L of synthetic oviductal fluid culture droplets in 35-mm dishes covered with 3 mL of mineral oil. Maintain at 38.5 &#176;C, under an atmosphere of 5% CO2, and in air with maximum humidity for at least 2 h before use.</li>
	<li>At 2.5 h post co-incubation, remove 20 oocytes from the dish; maintain the remaining oocytes in the incubator under the same conditions.
	<ol>
		<li>Remove the loosely attached&#160;spermatozoa by vigorously pipetting half of the oocytes through a narrow-bore Pasteur pipette 10 times.</li>
		<li>Fix the 20 oocytes in 50 &#181;L of 0.5% glutaraldehyde for 30 min. Wash the oocytes in PBS for 5 min. Transfer the oocytes to 50-&#181;L of Hoechst staining solution for 15 min and wash the oocytes in PBS for 5 min.</li>
		<li>Transfer the oocytes individually to 2 &#181;L droplets of mounting medium at a rate of 10 oocytes per slide. Gently cover with a coverslip and seal with nail polish.</li>
		<li>Count the number of spermatozoa attached to the bovine oocytes using a phase-contrast microscope equipped with epifluorescent optics and a 361 nm excitation filter at 40x magnification.</li>
	</ol>
	</li>
	<li>After 12 h of co-incubation, remove 10 presumptive zygotes from the 4-well dishes; maintain the remaining presumptive zygotes in the incubator under the same conditions.
	<ol>
		<li>Transfer the 10 presumptive zygotes to a 15-mL centrifuge tube containing 2 mL of PBS and vortex gently for 2 min to remove the cumulus cells. Wash twice in PBS, fix, and stain, as previously described (step 2.23.2.)</li>
	</ol>
	</li>
	<li>After 18, 20, 22, and 24 h of co-incubation, remove 10 presumptive zygotes from the 4-well dishes and vortex, fix, and stain them as previously described (step 2.23.2). Maintain the rest of presumptive zygotes in the incubator under the same conditions.
	<ol>
		<li>Evaluate pronuclear formation and polyspermy under a phase-contrast/epifluorescent microscope in both the homologous and heterologous IVF groups by staining with Hoechst.</li>
		<li>Evaluate pronuclear formation in 10 randomly chosen presumptive hybrid zygotes per sample. Confirm pronuclear formation under a confocal laser scanning microscope at 488-nm argon laser excitation and 515 to 530 nm detection.</li>
		<li>Optically section presumptive zygotes sequentially (2 mm) and collect images using an imaging software. Visualize using a 3D analysis software package.</li>
		<li>After 24 h of co-incubation, wash 50 presumptive zygotes four times in PBS and twice in culture medium.</li>
	</ol>
	</li>
	<li>Transfer them in groups of 25 to microdroplets of culture medium previously prepared and equilibrated.</li>
	<li>Maintain at 38.5 &#176;C under an atmosphere of 5% O2/5% CO2 and in air with maximum humidity.</li>
	<li>After 26 and 28 h of co-incubation, remove 10 presumptive zygotes from the dishes and vortex, fix, and stain them, as previously described (step 2.23.2).</li>
	<li>After 48 h of culture, observe the cleavage under a stereomicroscope.</li>
	<li>Remove the zona pellucida (ZP) by transferring the embryos to a 5 mg/mL protease solution.</li>
	<li>Individually wash each embryo three times in PBS. Snap-freeze them in liquid nitrogen in 0.2 mL microcentrifuge tubes. Store them at -80 &#176;C until analysis.</li>
</ol>
3. PCR
<ol>
	<li>Materials and Reagents 
	NOTE: The reagents, materials, and equipment used to perform the PCR protocol are detailed in the Table of Materials and include a PCR tube rack and a set of micropipettes (P2, P20, P200, P1000), 1.5 mL microcentrifuge tubes, PCR tubes and caps, a thermal cycler, a UV illuminator, agarose gel, and buffer (Tris Borate EDTA (TBE)).
	<ol>
		<li>Gently thaw all reagents on ice. Maintain them in ice throughout the experiment. Use deoxynucleotides (dNTPs; dATP, dCTP, dTTP and dGTP), target primers on the reference gene coding for the dolphin 18 S ribosomal protein (DQ404537.1); R1: TTGGACACACCCACGGTGCGG and F2: CAGAAGGACGTGAAGGATGGA), DNA polymerase, 5X buffer for the DNA polymerase, DNA template, sterile water, and magnesium chloride (MgCl2 at a final concentration of 5.0 mM).</li>
		<li>Agarose gel and sample preparation.
		<ol>
			<li>Prepare dolphin and bovine sperm DNA samples.
			<ol>
				<li>Thaw a frozen straw of each species in a water bath at 37 &#176;C for 50 s. Add 3 mL of washing solution. Centrifuge at 250 x g for 10 min. Remove the supernatant. Add 30 &#181;L of STES lysis buffer (50 mM Tris-HCl, pH 8; 20 mM NaCl; and 1 mM 0.1% SDS), 2 &#181;L of proteinase K (20 mg/mL), and 5 &#181;L of dithiothreitol (DTT); final concentration: 150 mM. Maintain overnight at 55 &#176;C. Add 200 &#181;L of ultrapure water. Centrifuge at 250 x g for 5 min. Keep the supernatant. Measure the DNA concentration using a spectrophotometer.</li>
			</ol>
			</li>
			<li>Perform serial dilutions of DNA from dolphin spermatozoa (i.e., 40, 4, and 0.4 ng/mL) with ultrapure water to check that the PCR conditions are capable of detecting a small amount of dolphin DNA.</li>
			<li>Perform serial dilutions of bovine sperm DNA (i.e., 4,000, 400, 40, and 4 ng/mL) with ultrapure water to check that the PCR conditions are capable of detecting a small amount of bovine DNA.</li>
			<li>Prepare the dolphin and bovine embryos. Thaw the embryos on ice. Add 8 &#181;L of 100 &#181;g/mL proteinase K and maintain overnight at 55 &#176;C. To stop the reaction, place the samples at 96 &#176;C for 5 min.</li>
			<li>Prepare 2% agarose gel TBE buffer and add 20 &#181;L of nucleic acid stain using standard techniques.</li>
		</ol>
		</li>
		<li>PCR preparation.
		<ol>
			<li>Label PCR tube(s): dolphin serial dilutions (40, 4, and 0.4 ng/mL), bovine serial dilutions (4,000, 400, 40, and 4 ng/mL), homologous bovine two-cell embryo, two-cell presumptive heterologous embryos, and negative control.</li>
			<li>Prepare a master mixture in a sterile 1.5-mL microcentrifuge tube to a final volume of 25 &#181;L per reaction.
			<ol>
				<li>Add 5 &#181;L of 5X DNA polymerase flexi buffer, 0.5 &#181;L of dNTPs (10 mM) 1.5 &#181;L of MgCl2 (25 mM), 0.5 &#181;L of forward and reverse primer (10 &#181;M), 1.5 &#181;L of DNA template (sperm) or 8 &#181;L of DNA template (two-cell embryos), 0.07 &#181;L of Taq polymerase, and sterile distilled water up to a 25 &#181;L final volume. Mix well.</li>
			</ol>
			</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Amplification Protocol
	<ol>
		<li>Place the tubes in the thermal cycler. Select the following program: 94 &#176;C for 3 min; 40 cycles of 94 &#176;C for 15 s, 59 &#176;C for 25 s, 72 &#176;C for 20 s; and 72 &#176;C for 5 min. Start the program.</li>
		<li>Store the tubes at 4 &#176;C. Add 2.5 &#181;L of loading buffer to each PCR product at 4 &#176;C and load 15 &#181;L of the mixture into the wells of the 2% agarose gel. Use a DNA ladder marker for the accurate size estimation of PCR fragments.</li>
		<li>Perform electrophoresis for 15 min to allow DNA migration. Visualized bands using a UV illuminator.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Montano, G. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+motility,+membrane+status+and+DNA+integrity+of+frozen-thawed+bottlenose+dolphin+(Tursiops+truncatus)+spermatozoa+after+sex-sorting+and+recryopreservation.">Evaluation of motility, membrane status and DNA integrity of frozen-thawed bottlenose dolphin (Tursiops truncatus) spermatozoa after sex-sorting and recryopreservation.</a> Reproduction. 143 (6), 799-813 (2012).</li><li>S&#225;nchez-calabuig, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+a+field+based+chromatin+dispersion+assay+to+assess+sperm+DNA+fragmentation+in+the+bottlenose+dolphin+(Tursiops+truncatus).">Validation of a field based chromatin dispersion assay to assess sperm DNA fragmentation in the bottlenose dolphin (Tursiops truncatus).</a> Reprod Domest Anim. 49 (5), 761-768 (2014).</li><li>S&#225;nchez-calabuig, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterologous+murine+and+bovine+IVF+using+bottlenose+dolphin+(Tursiops+truncatus)+spermatozoa.">Heterologous murine and bovine IVF using bottlenose dolphin (Tursiops truncatus) spermatozoa.</a> Theriogenology. 84 (6), 983-994 (2015).</li><li>Keller, K. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Training+of+the+Atlantic+bottlenose+dolphins+(Tursiops+truncatus)+for+artificial+insemination.">Training of the Atlantic bottlenose dolphins (Tursiops truncatus) for artificial insemination.</a> IAAAM. 14 (22), 22-24 (1986).</li><li>Robeck, T. R., O'brien, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+cryopreservation+methods+and+precryopreservation+storage+on+bottlenose+dolphin+(Tursiops+truncatus)+spermatozoa.">Effect of cryopreservation methods and precryopreservation storage on bottlenose dolphin (Tursiops truncatus) spermatozoa.</a> Biol Reprod. 70 (5), 1340-1348 (2004).</li><li>Coy, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hardening+of+the+zona+pellucida+of+unfertilized+eggs+can+reduce+polyspermic+fertilization+in+the+pig+and+cow.">Hardening of the zona pellucida of unfertilized eggs can reduce polyspermic fertilization in the pig and cow.</a> Reproduction. 135 (1), 19-27 (2008).</li><li>Seager, S., W, G., Moore, L., Platz, C., Kirby, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Semen+collection+(electroejaculation),+evaluation+and+freezing+in+the+Atlantic+bottlenose+dolphin+(Tursiops+truncatus).">Semen collection (electroejaculation), evaluation and freezing in the Atlantic bottlenose dolphin (Tursiops truncatus).</a> Proceedings of the American Association of Zoo Veterinarians. 136, (1981).</li><li>Schroeder, J. P., Leatherwood, S., Reeves, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breeding+Bottlenose+Dolphins+in+captivity.">Breeding Bottlenose Dolphins in captivity.</a> The Bottlenose dolphin. , 447-460 (1990).</li><li>S&#225;nchez-Calabuig, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+cryopreservation+on+the+sperm+DNA+fragmentation+dynamics+of+the+bottlenose+dolphin+(Tursiops+truncatus).">Effect of cryopreservation on the sperm DNA fragmentation dynamics of the bottlenose dolphin (Tursiops truncatus).</a> Reprod Domest Anim. 50 (2), 227-235 (2015).</li><li>Robeck, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Estrous+cycle+characterisation+and+artificial+insemination+using+frozen-thawed+spermatozoa+in+the+bottlenose+dolphin+(Tursiops+truncatus).">Estrous cycle characterisation and artificial insemination using frozen-thawed spermatozoa in the bottlenose dolphin (Tursiops truncatus).</a> Reproduction. 129 (5), 659-674 (2005).</li><li>Robeck, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+evaluation+of+deep+intra-uterine+artificial+insemination+using+cryopreserved+sexed+spermatozoa+in+bottlenose+dolphins+(Tursiops+truncatus).">Development and evaluation of deep intra-uterine artificial insemination using cryopreserved sexed spermatozoa in bottlenose dolphins (Tursiops truncatus).</a> Anim Reprod Sci. 139 (1-4), 168-181 (2013).</li><li>Schroeder, J. P., Leatherwood, S., Reeves, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breeding+Bottlenose+Dolphins+in+captivity.">Breeding Bottlenose Dolphins in captivity.</a> The Bottlenose dolphin. , 447-460 (1990).</li><li>Madeddu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+cooling+rate+on+the+survival+of+cryopreserved+rooster+sperm:+Comparison+of+different+distances+in+the+vapor+above+the+surface+of+the+liquid+nitrogen.">Effect of cooling rate on the survival of cryopreserved rooster sperm: Comparison of different distances in the vapor above the surface of the liquid nitrogen.</a> Anim Reprod Sci. , (2016).</li></ol>

The authors have nothing to disclose.

For many different mammalian species, there are diverse advantages to using frozen-thawed sperm. These include the ability to transfer valuable genetic material, the potential for worldwide distribution, the low risk of contamination, and the capability to preserve male gametes for decades. The use of cryopreserved sperm is essential for the bottlenose dolphin, because this species is protected under Appendix II of CITES, which limits the transport and exchange of animals between different aquatic parks. Dolphins transpo...

Assisted reproductive technologies are poorly developed in wild animals, including marine mammals. The lack of sensitive methods to assess sperm fertilizing success contributes to the slow development of reproductive technologies in species such as dolphin. It was not until recently that the basic seminal parameters of the bottlenose dolphin (Tursiops truncatus) were reported1,2. However, variables such as motility and morphology, although widely used, give limited information on reproductive efficiency. The best indicator of sperm quality is the evaluation of the fertilizing potential.
Recently, our group used a method to assess dolphin sperm fertilizing potential by assessing male pronuclear formation and/or hybrid embryo formation after heterologous IVF using zona intact bovine oocytes3. The use of dolphin-bovine heterologous IVF has important advantages over homologous IVF, as it overcomes the difficulty of obtaining dolphin oocytes and facilitates the use of well-tested in vitro bovine oocyte maturation systems. In order to avoid species specificity, heterologous fertilization is generally performed in the absence of ZP. Although it allows for the evaluation of the ability of the acrosome-reacted spermatozoa to fuse with the vitelline membrane, it impairs the evaluation of other features related to fertilization. The procedure described uses zona intact oocytes and permits the evaluation of the following parameters: sperm zona binding and attachment, penetration, polyspermy, pronuclear formation, and hybrid embryo cleavage.
Here, we present several protocols for sperm collection, basic sperm analysis, spermatozoa freezing as well as the&#160; evaluation of&#160;the &#160;dolphin sperm functionality by assessing male pronuclear and/or hybrid embryo formation after heterologous IVF using zona intact bovine oocytes.

<table><tbody><tr><td>FERT-TALP medium</td><td>Merck</td><td></td><td></td></tr><tr><td>TCM-199</td><td>Sigma</td><td>M-4530</td><td></td></tr><tr><td>Hoechst 33342</td><td>Sigma</td><td>B-2261</td><td></td></tr><tr><td>4-well dishes</td><td>Nunc</td><td>176740</td><td></td></tr><tr><td>Density gradient BoviPure</td><td>Nidacon International</td><td>BP-100</td><td></td></tr><tr><td>Washing solution Boviwash</td><td>Nidacon International</td><td>BW-100</td><td></td></tr><tr><td>Magnesium chloride</td><td>Promega</td><td>A35 1H</td><td></td></tr><tr><td>Sterile water</td><td>Mili Q sintesis A10 Millipore</td><td>A35 1H</td><td></td></tr><tr><td>Buffer Tris Borate EDTA</td><td>Sigma</td><td>T4415</td><td></td></tr><tr><td>MB agarose</td><td>Biotools</td><td>20.012</td><td></td></tr><tr><td>5X GoTaq flexi buffer</td><td>Mili Q sintesis A10 Millipore</td><td>M 890 A</td><td></td></tr><tr><td>MB agarose</td><td>Biotools</td><td>20.012</td><td></td></tr><tr><td>Taq polymerase</td><td>Promega</td><td></td><td></td></tr><tr><td>SafeView</td><td>NBS Biologicals Ltd.</td><td>M 890 A</td><td></td></tr><tr><td>Makler counting chamber</td><td>Sefi Medical</td><td></td><td></td></tr><tr><td>Thoma chamber</td><td>Hecht-Assistant</td><td></td><td></td></tr><tr><td>pHmeter MicropH 2000</td><td>Crison Instruments</td><td></td><td></td></tr><tr><td>Osmometer Advanced micro osmometer 3300</td><td>Norwood</td><td></td><td></td></tr><tr><td>Computer assisted sperm analysis system</td><td>Projectes y Serveis R+D</td><td></td><td></td></tr><tr><td>Stereomicroscope MZ 95</td><td>Leica</td><td></td><td></td></tr><tr><td>Epifluorescent optics Eclipse Te300</td><td>Nikon</td><td></td><td></td></tr><tr><td>Confocal assistant 4.02 software</td><td>Bio-Rad</td><td>3D analysis software</td><td></td></tr><tr><td>Confocal laser scanning microscopy</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>Micropippetes (P2. P20, P200, P1000)</td><td>Gilson</td><td></td><td></td></tr><tr><td>Microcentrifuge tubes</td><td>VWR</td><td></td><td></td></tr><tr><td>UV iluminator</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>PCR Thermal cycler Primus 96 Plus</td><td>MWG AG Biotech</td><td></td><td></td></tr></tbody></table>

bottlenose dolphin (tursiops truncatus) spermatozoa: collection, cryopreservation, and heterologous in vitro fertilization

The use of cryopreserved dolphin spermatozoa facilitates the exchange of genetic material between aquatic parks and makes spermatozoa accessible to laboratories for studies to further our understanding of marine mammal reproduction. Heterologous IVF, a replacement for homologous IVF, could provide a means to test the sperm fertility potential; to study gamete physiology and early embryo development; and to avoid the use of valuable dolphin oocytes, which are difficult to obtain. Here, we present protocols that have been successfully used to collect and cryopreserve dolphin spermatozoa. The collection of semen is performed by manual stimulation on trained dolphins. Cryopreservation is accomplished using a TRIS egg-yolk based extender with glycerol. In addition, we present a protocol that describes heterologous IVF using dolphin spermatozoa and bovine oocytes and that verifies the hybrid nature of the resulting embryo using PCR. Heterologous fertilization raises questions on fertilization and can be used as a tool to study gamete physiology and early embryo development. In addition, the success of heterologous IVF demonstrates the potential of this technique to test dolphin sperm fertilizing capacity, which is worth further examination.

All the results, tables, and figures (1 and 2) presented here were reproduced with permission3.
Dolphin spermatozoa have high motility after freezing and thawing
The frozen-thawed dolphin ejaculates showed percentages (% &#177; SD) of 84.5 &#177; 5.3 total motile and 69.1 &#177; 5.1 progressive motile spermatozoa. In motility terms, these numbers a...

Watch this Scientific Journal Video about Bottlenose Dolphin Tursiops truncatus Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization at JoVE.com

Bottlenose Dolphin Tursiops truncatus Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization

Here, we present protocols that have been successfully used for dolphin spermatozoa collection, cryopreservation, and heterologous IVF performance using bovine oocytes.

Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization

The use of cryopreserved dolphin spermatozoa facilitates the exchange of genetic material between aquatic parks and makes spermatozoa accessible to ...

bottlenose-dolphin-tursiops-truncatus-spermatozoa-collection

Research

JoVE Journal

Developmental Biology

13.2K Views.  Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA). Hier presenteren we protocollen die met succes zijn gebruikt voor dolphin spermacellen collectie, cryopreservatie en heterologe IVF-prestaties met boviene eicellen.

Video: Bottlenose Dolphin Tursiops truncatus Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization

Isolation and Cryopreservation of Neonatal Rat Cardiomyocytes

Cell culture has become increasingly important in cardiac research, but due to the limited proliferation of cardiomyocytes, culturing cardiomyocytes is difficult and time consuming. The most commonly used cells are neonatal rat cardiomyocytes (NRCMs), which require isolation every time cells are needed. The birth of the rats can be unpredictable. Cryopreservation is proposed to allow for cells to be stored until needed, yet freezing/thawing methods for primary cardiomyocytes are challenging due to the sensitivity of the cells. Using the proper cryoprotectant, dimethyl sulfoxide (DMSO), cryopreservation was achieved. By slowly extracting the DMSO while thawing the cells, cultures were obtained with viable NRCMs. NRCM phenotype was verified using immunocytochemistry staining for &#945;-sarcomeric actinin. In addition, cells also showed spontaneous contraction after several days in culture. Cell viability after thawing was acceptable at 40-60%. In spite of this, the methods outlined allow one to easily cryopreserve and thaw NRCMs. This gives researchers a greater amount of flexibility in planning experiments as well as reducing the use of animals.

The isolation of neonatal rat cardiomyocytes is a time consuming and unpredictable procedure. This study describes methods for cryopreservation and thawing of neonatal rat cardiomyocytes that allows for more efficient use of cells. The thawed NRCMs can be used for various experiments without the need for performing isolations each time.

Cell culture has become increasingly important in cardiac research, but due to the limited proliferation of cardiomyocytes, culturing cardiomyocytes is ...

In Vitro and In Vivo Models to Study Corneal Endothelial-mesenchymal Transition

Corneal endothelial cells (CECs) play a crucial role in maintaining corneal clarity through active pumping. A reduced CEC count may lead to corneal edema and diminished visual acuity. However, human CECs are prone to compromised proliferative potential. Furthermore, stimulation of cell growth is often complicated by gradual endothelial-mesenchymal transition (EnMT). Therefore, understanding the mechanism of EnMT is necessary for facilitating the regeneration of CECs with competent function. In this study, we prepared a primary culture of bovine CECs by peeling the CECs with Descemet's membrane from the corneal button and demonstrated that bovine CECs exhibited the EnMT process, including phenotypic change, nuclear translocation of &#946;-catenin, and EMT regulators snail and slug, in the in vitro culture. Furthermore, we used a rat corneal endothelium cryoinjury model to demonstrate the EnMT process in vivo. Collectively, the in vitro primary culture of bovine CECs and in vivo rat corneal endothelium cryoinjury models offers useful platforms for investigating the mechanism of EnMT.

In Vitro and In Vivo Models to Study Corneal Endothelial-mesenchymal Transition

A primary culture of bovine corneal endothelial cells was used to investigate the mechanism of corneal endothelial-mesenchymal transition. Furthermore, a rat corneal endothelium cryoinjury model was used to demonstrate corneal endothelial-mesenchymal transition in vivo.

Corneal endothelial cells (CECs) play a crucial role in maintaining corneal clarity through active pumping. A reduced CEC count may lead to corneal edema ...

Modified MicroSecure Vitrification: A Safe, Simple and Highly Effective Cryopreservation Procedure for Human Blastocysts

Clinical embryo vitrification evolved with the development of unique vitrification devices in the 21st century and with the misconception that ultra-rapid cooling in an &#34;open&#34; system (i.e., direct LN2 contact) was a necessity to optimize vitrification success. The dogma surrounding the importance of cooling rates led to unsafe practices subject to technical variation and to the creation of vitrification devices that disregarded important quality-control factors (e.g., ease of use, repeatability, reliability, labeling security, and storage safety). Understanding the quality-control flaws of other devices allowed for the development of a safe, secure, repeatable, and reliable &#181;S-VTF method aimed to minimize intra- and inter-technician variation. Equally important, it combined the availability of two existing FDA-compliant devices: 1) a 0.3-mL ionomeric resin embryo straw with internalized, dual-colored, tamper-proof labeling with repeatable weld seal potential; and 2) shortened, commonly-used, 300-&#181;m ID sterile flexipettes to directly load the embryo(s) in order to create a highly-effective global vitrification device. Like other aseptic, closed vitrification systems (e.g., High Security Vitrification (HSV), Rapid-i, and VitriSafe) effectively used in reproductive medicine, microSecure Vitrification (&#181;S-VTF) has proven that it can achieve high post-warming survival and pregnancy outcomes with its attention to simplicity, and reduced technical variation. Although the 0.3-mL embryo straw containing an internal hydrophobic plug was commercially replaced with a standard semen straw possessing cotton-polyvinyl pyrrolidone (PVP) plugs, it maintained its ionomeric resin composition to ensure weld sealing. However, the cotton plugs can wick out the fluid-embryo contents of the flexipettes upon contact. A modified &#181;S-VTF method was adapted to include an additional internal weld seal before the plug on the device loading side. The added technical step to the &#181;S-VTF procedure has not affected its successful application, as high survival rates (&#62; 95%) and pregnancy rates continue today.

MicroSecure Vitrification was developed as a non-commercial, aseptic closed vitrification device system that is compliant with FDA good manufacturing and tissue-handling practices. Due to the withdrawal of hydrophobic plugged embryo straws from the industry, the vitrification procedure was modified to include an inner seal before the standard internal cotton plug.

Clinical embryo vitrification evolved with the development of unique vitrification devices in the 21st century and with the misconception that ultra-rapid ...

Collection of Serum- and Feeder-free Mouse Embryonic Stem Cell-conditioned Medium for a Cell-free Approach

The capacity of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) to generate various cell types has opened new avenues in the field of regenerative medicine. However, despite their benefits, the tumorigenic potential of ESCs and iPSCs has long been a barrier for clinical applications. Interestingly, it has been shown that ESCs produce several soluble factors that can promote tissue regeneration and delay cellular aging, suggesting that ESCs and iPSCs can also be utilized as a cell-free intervention method. Therefore, the method for harvesting mouse embryonic stem cell (mESC)-conditioned medium (mESC-CM) with minimal contamination of serum components (fetal bovine serum, FBS) and feeder cells (mouse embryonic fibroblasts, MEFs) has been highly demanded. Here, the present study demonstrates an optimized method for the collection of mESC-CM under serum- and feeder-free conditions and for the characterization of mESC-CM using senescence-associated multiple readouts. This protocol will provide a method to collect pure mESC-specific secretory factors without serum and feeder contamination.

This protocol provides a method for the collection of mouse embryonic stem cell (mESC)-conditioned medium (mESC-CM) derived from serum (fetal bovine serum, FBS)- and feeder (mouse embryonic fibroblasts, MEFs)-free conditions for a cell-free approach. It may be applicable for the treatment of aging and aging-associated diseases.

The capacity of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) to generate various cell types has opened new avenues in the field ...

Evaluation of Intracellular Location of Reactive Oxygen Species in Solea Senegalensis Spermatozoa

Oxidative stress is one of the important factors in decreasing sperm quality. Developing efficient protocols for detecting reactive oxygen species (ROS) in spermatozoa is of high importance in any species, but these methods are rarely used and even less in teleost. Cryopreservation is a useful technique in aquaculture for different purposes, including gene banking and guaranteed sperm availability throughout the year. Freezing/thawing procedures could cause ROS production and damage the sperm cells. Considering the prospective damage that an excess of ROS production could cause in spermatozoa depending on their localization, here a detailed methodology to detect H2O2 and to evaluate its intracellular localization by confocal microscopy is provided. For this purpose, a combination of 3 fluorochromes (2&#8242;,7&#8242;-Dichlorodihydrofluorescein diacetate (DCFH-DA), a live mitochondria stain and 4&#8242;,6-Diamidino-2-phenylindole dihydrochloride (DAPI)) are used to evaluate the co-localization of H2O2 with spermatozoa nuclei or mitochondria in Solea senegalesis sperm samples.

Evaluation of Intracellular Location of Reactive Oxygen Species in Solea Senegalensis Spermatozoa

This protocol describes a detailed methodology for detecting H2O2 localization within Solea senegalensis spermatozoa using a sensitive fluorochrome DCFH-DA for ROS, a live mitochondria stain for mitochondria, and DAPI for nuclei visualization, respectively. The protocol is designed to be performed within 2 h with either fresh or thawed spermatozoa.

Oxidative stress is one of the important factors in decreasing sperm quality. Developing efficient protocols for detecting reactive oxygen species (ROS) ...

A High-Throughput Method For Zebrafish Sperm Cryopreservation and In Vitro Fertilization

This is a method for zebrafish sperm cryopreservation that is an adaptation of the Harvey method (Harvey et al., 1982).  We have introduced two changes to the original protocol that both streamline the procedure and increase sample uniformity.  First, we normalize all sperm volumes using freezing media that does not contain the cryoprotectant. Second, cryopreserved sperm are stored in cryovials instead of capillary tubes.  The rates of sperm freezing and thawing (&delta;&deg;C/time) are probably the two most critical variables to control in this procedure.  For this reason, do not substitute different tubes for those specified.  Working in teams of 2 it is possible to freeze the sperm of 100 males per team in ~2 hrs.  Sperm cryopreserved using this protocol has an average of 25% fertility (measured as the number of viable embryos generated in an in vitro fertilization divided by the total number of eggs fertilized) and this percent fertility is stable over many years.

A High-Throughput Method For Zebrafish Sperm Cryopreservation and In Vitro Fertilization

This is a high-throughput sperm cryopreservation protocol for zebrafish. Sperm cryopreserved using this protocol has an average of 25% fertility in subsequent vitro fertilization and is stable over many years.

This is a method for zebrafish sperm cryopreservation that is an adaptation of the Harvey method (Harvey et al., 1982).  We have introduced two changes to ...

Biology

Mouse Sperm Cryopreservation and Recovery using the I&middot;Cryo Kit

Thousands of new genetically modified (GM) strains of mice have been created since the advent of transgenesis and knockout technologies. Many of these valuable animals exist only as live animals, with no backup plan in case of emergency. Cryopreservation of embryos can provide this backup, but is costly, can be a lengthy procedure, and generally requires a large number of animals for success. Since the discovery that mouse sperm can be successfully cryopreserved with a basic cryoprotective agent (CPA) consisting of 18&#37; raffinose and 3&#37; skim milk, sperm cryopreservation has become an acceptable and cost-effective procedure for archiving, distributing and recovery of these valuable strains.
 Here we demonstrate a newly developed I&bull;Cryo kit for mouse sperm cryopreservation. Sperm from five commonly-used strains of inbred mice were frozen using this kit and then recovered. Higher protection ratios of sperm motility (&gt; 60&#37;) and rapid progressive motility (&gt; 45&#37;) compared to the control (basic CPA) were seen for sperm frozen with this kit in 5 inbred mouse strains. Two cell stage embryo development after IVF with the recovered sperm was improved consistently in all 5 mouse strains examined. Over a 1.5 year period, 49 GM mouse lines were archived by sperm cryopreservation with the I&bull;Cryo kit and later recovered by IVF.

Here we demonstrate the newly developed I&#x2022;Cryo kit for mouse sperm cryopreservation. Two-cell stage embryo development with frozen-thawed sperm was improved consistently in 5 mouse strains with the use of this kit. Over a 1.5 year period, 49 genetically modified mouse lines were archived by sperm cryopreservation with the I&#x2022;Cryo kit and later successfully recovered by IVF.

Thousands of new genetically modified (GM) strains of mice have been created since the advent of transgenesis and knockout technologies.  Many of these ...

Cryopreservation of Zebrafish Spermatogonia by Whole Testes Needle Immersed Ultra-Rapid Cooling

Current trends in science and biotechnology lead to creation of thousands of new lines in model organisms thereby leading to the necessity for new methods for safe storage of genetic resources beyond the common practices of keeping breeding colonies. The main purpose of this study was to adapt the needle immersed vitrification (NIV) procedure to cryopreserve whole zebrafish testes. Cryopreservation of early-stage germ cells by whole testes NIV offers possibilities for the storage of zebrafish genetic resources, especially since after transplantation they can mature into both male and female gametes. Testes were excised, pinned on an acupuncture needle, equilibrated in two cryoprotective media (equilibration solution containing 1.5 M methanol and 1.5 M propylene glycol; and vitrification solution containing 3 M dimethyl sulfoxide and 3 M propylene glycol) and plunged into liquid nitrogen. Samples were warmed in a series of three consequent warming solutions. The main advantages of this technique are (1) the lack of spermatozoa after digestion of warmed testes thus facilitating downstream manipulations; (2) ultra-rapid cooling enabling the optimal exposure of tissues to liquid nitrogen therefore maximizing the cooling and reducing the required concentration of cryoprotectants, thereby reducing their toxicity; (3) synchronous exposure of several testes to cryoprotectants and liquid nitrogen; and (4) repeatability demonstrated by obtaining viability of above 50% in five different zebrafish strains.

The main purpose of this study was to adapt the needle immersed vitrification (NIV) procedure to cryopreserve whole zebrafish testes. Additionally, the repeatability of the method in five different zebrafish strains was tested.

Current trends in science and biotechnology lead to creation of thousands of new lines in model organisms thereby leading to the necessity for new methods ...

Fish Sperm Assessment Using Software and Cooling Devices

For gamete quality evaluation, there are innovative, rapid, and quantitative techniques that can provide useful data for aquaculture. Computerized systems for sperm analysis were developed to measure several parameters and one of the most commonly measured is the sperm motility.
Initially, this computer technology was designed for mammalian species, although it can also be used for fish sperm analysis. Fish have specific features that can affect sperm assessment such as a short motility time after activation and, in some cases, adaptation to lower temperatures. Thus, it is necessary to modify both software and hardware components to make motility analysis more efficient for fish sperm analysis. For mammalian sperm, the heating plate is used to maintain optimal temperatures of spermatozoa. However, for some fish species, it is advantageous to use a lower temperature to prolong the duration of motility, since the sperm remain active for less than 2 min. Therefore, cooling devices are necessary to refrigerate samples at constant temperature over the time of analysis, including on the optical microscope. This protocol describes the analysis of fish sperm motility using software for sperm analysis and new cooling devices to optimize the results.

The present protocol describes a procedure of fish sperm assessment using computer-assisted sperm analysis and cooling devices. The software gives a rapid, accurate and quantitative analysis of fish sperm quality based on spermatozoa motility, which can be a useful tool in aquaculture to improve reproduction success.

For gamete quality evaluation, there are innovative, rapid, and quantitative techniques that can provide useful data for aquaculture. Computerized systems ...

Optimizing Coral Sperm Cryopreservation from Threatened Coral Species

A Semi-Automated Workflow for the Cryopreservation of Coral Sperm to Support Biobanking and Aquaculture

Coral reefs are facing a crisis as the frequency of bleaching events caused by ocean warming increases, resulting in the death of corals on reefs around the world. The subsequent loss of genetic diversity and biodiversity can diminish the ability of coral to adapt to the changing climate, so efforts to preserve existing diversity are essential to maximize the resources available for reef restoration now and in the future. The most effective approach to secure genetics long-term is cryopreservation and biobanking, which permits the frozen storage of living samples at cryogenic temperatures in liquid nitrogen indefinitely. Cryopreservation of coral sperm has been possible since 2012, but the seasonal nature of coral reproduction means that biobanking activities are restricted to just a few nights per year when spawning occurs. Improving the efficiency of coral sperm processing and cryopreservation workflows is therefore essential to maximizing these limited biobanking opportunities. To this end, we set out to optimize cryopreservation processing pathways for coral sperm by building on existing technologies and creating a semi-automated approach to streamline the assessment, handling, and cryopreservation of coral sperm. The process, which combines computer-assisted sperm analysis, barcoded cryovials, and a series of linked auto-datasheets for simultaneous editing by multiple users, improves the efficiency of both sample processing and metadata management in the field. Through integration with cross-cutting research programs such as the Reef Restoration and Adaptation Program in Australia, cryopreservation can play a crucial role in large-scale reef restoration programs by facilitating the genetic management of aquaculture populations, supporting research to enhance thermal tolerance, and preventing the extinction of coral species. The described procedures will be utilized for coral cryopreservation and biobanking practitioners on reefs worldwide and will provide a model for the transition of cryopreservation technologies from research laboratories to large-scale applications.

Author Spotlight: Developing Efficient Cryopreservation and Biobanking Technologies for Global Reef Restoration

This protocol describes a semi-automated pathway to improve the efficiency and capacity of processing and cryopreservation of sperm from threatened coral species, aiming to secure genetic diversity and support reef restoration efforts.

Coral reefs are facing a crisis as the frequency of bleaching events caused by ocean warming increases, resulting in the death of corals on reefs around ...

Bottlenose Dolphin (Tursiops truncatus) Spermatozoa: Collection, Cryopreservation, and Heterologous In Vitro Fertilization

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video