Name: visualizing angiogenesis by multiphoton microscopy in vivo in genetically modified 3d-plga/nhap scaffold for calvarial critical bone defect repair
Uploaded: 2017-09-07T12:30:00.000+00:00
Duration: 9 min 34 s
Description: Watch this Scientific Journal Video about Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair at JoVE.com

This study was supported by the Shenzhen Peacock Program, China (No. 110811003586331), the Shenzhen Basic Research Program (No. JCYJ20150401150223631, No. JCYJ20150401145529020, and No. JCYJ20160331190714896), the Guangdong Public Research and Capacity Building Special Program (No. 2015A020212030), the National Natural Science Foundation of China (No. 81501893), the National Major Basic Research Program of China (2013CB945503), and the SIAT Innovation Program for Excellent Young Researchers (Y5G010).

The animal care was in compliance with the Guide for the Care and Use of Laboratory Animals of Guangdong Province. All procedures were performed under the supervision and approval of the Ethics Committee for Animal Research, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences.
1. Lentiviral (LV) Production
<ol>
	<li>Clone the pdgf-b cDNA into a lentiviral expression vector (pLenti6/5-eGFP or LV-eGFP) at a custom multiple-cloning site downstream of the cytomegalovirus promoter using Spe I and Sal I restriction sites to construct the pLenti6/5-PDGFB-eGFP plasmid (LV-pdgfb)25.</li>
	<li>Produce lentiviral particles (LV-pdgfb) from HEK-293FT cells by co-transfecting with virus packaging plasmids (pLP1, pLP2, and pVSV-G) using the standard calcium phosphate method with chloroquine (final concentration: 25 &#181;M)25.</li>
	<li>After 48 h of transfection, harvest and filter 500 mL of virus-containing supernatant with a filter (0.45 &#181;m). Subsequently, concentrate the viral particles by ultracentrifugation at 89,000 x g for 2 h. Resuspend in 200 &#181;L of phosphate-buffered saline (PBS), aliquot, and store at -80 &#176;C.</li>
	<li>To determine the titer of lentivirus, incubate HEK293T cells with serially diluted lentiviral solution for 24 h and calculate the lentiviral titer, as previously described25.</li>
</ol>
2. Fabrication of 3D-printed PLGA/nHAp Scaffolds and LV Immobilization
<ol>
	<li>Dissolve 20 g of PLGA (Poly D,L-lactide-co-glycolide) material in 20 mL of 1,4-dioxane to form a homogeneous solution. Add 2 g of nanosized HAp (nano-hydroxyapatide) powder (nHAp) to the solution; the PLGA: nHAp ratio should be 10:1 (w/w).</li>
	<li>Stir the mixed solution vigorously (stirring speed: 1,500 rpm) at room temperature for 16 h using a magnetic stirrer to form a uniform paste. Fabricate it into porous PLGA/nHAp scaffolds using a 3D low-temperature printer with a computerized nozzle that deposits the paste layer-by-layer, bottom to top, according to a predesigned model26; the pore sizes of the scaffolds range from 200 to 400 &#181;m.</li>
	<li>Vacuum freeze-dry the scaffolds for 48 h to remove solvent as completely as possible. Soak the scaffolds in 75% ethanol solution for 1 h for sterilization and lyophilize to get neutral, aseptic scaffolds. 
	NOTE: The major parameters for vacuum freeze-drying include the condensation temperature (&#176;C) and vacuum degree (Pa). Under a vacuum degree of 45 Pa, the PLGA/nHAp scaffolds were vacuum freeze-dried at -78 &#176;C for 48 h to thoroughly remove the solvent.</li>
	<li>Add 10 &#181;L of LV particles (4.5 x 105) to each PLGA/nHAp scaffold (4 mm x 4 mm x 2 mm) and incubate the scaffolds for 2 h at 37 &#176;C in a humidified incubator to allow adsorption.</li>
	<li>After immobilization, rinse the scaffolds twice with PBS to remove unbound LV particles. Snap-freeze the LV particle-coated scaffolds in liquid nitrogen, lyophilize again, and store at -80 &#176;C for future use.</li>
</ol>
3. In Vitro Kinetics of LV Particle Release from Scaffolds and LV Transduction Activity Assay
<ol>
	<li>Incubate 3D scaffolds (4 mm x 4 mm x 2 mm) carrying LV-green fluorescent protein (LV-eGFP, 4.5 x 105 LV particles) in 1 mL of complete DMEM in 2.0 mL cryogenic vials at 37 &#176;C with shaking for 5 days.</li>
	<li>Take a 1 mL sample every 12 h from 12 h to 120 h post-incubation and replace the medium. At each time point, add 1 mL of fresh medium instead of 1 mL of incubation medium.</li>
	<li>Use the collected media to transduce HEK293T cells by co-incubating for 48 h. Measure the number of bioactive LV particles by determining the number of GFP-positive HEK293T cells by flow cytometry27.
	<ol>
		<li>Before transducing the HEK293T cells, remove the culture medium and rinse the HEK293T cells twice with PBS. Add the collected media containing lentivirus released from the scaffolds to the well (1 mL/well) and culture with the HEK293T cells for 48 h at 37 &#176;C in a humidified incubator.</li>
	</ol>
	</li>
</ol>
4. In Vitro Assessment of Bone Marrow-derived MSC (BMSC) Migration
<ol>
	<li>Before the migration assay, prepare BMSCs expressing tomato fluorescent protein (BMSCs-T) and PDGF-BB protein (BMSCs-P)28.</li>
	<li>Perform the BMSC migration assay with a Boyden chamber using a 24-well plate and polycarbonate filters with a pore size of 8 &#181;m.
	<ol>
		<li>Place 0.5 mL of BMSCs (5 x 104) transfected with LV expressing tomato fluorescent protein (BMSCs-T) in the upper chambers. Place 0.5 mL of BMSCs (2 x 105) transfected with LV expressing PDGF-BB protein (BMSCs-P) in the lower chambers.</li>
	</ol>
	</li>
	<li>Include six groups in this experiment and add 500 &#181;L to the lower compartment of each well. 
	A. Blank control, serum-free medium only 
	B. FBS control, medium supplemented with 10% FBS 
	C. PDGF-BB control, 4 ng/mL PDGF-BB in serum-free medium 
	D. PDGF-BB seize group, PDGF-BB (4 ng/mL) and anti-PDGF-BB (4 ng/mL) polyclonal antibody in serum-free medium 
	E. BMSC group, 2 x 105 BMSCs in serum-free medium 
	F. BMSCs-P group, 2 x 105 BMSCs-P in serum free medium.</li>
	<li>Incubate for 48 h at 5% CO2 and 37 &#176;C in a humidified incubator. Afterwards, remove the migrated cells on the lower chamber side and collect them for quantification of the number of BMSCs-T by flow cytometry.
	<ol>
		<li>Remove migrated cells on the lower chamber side using a cell scraper and resuspend the migrated cells with 2 mL of PBS. Quantify the number of migrated BMSCs-T by flow cytometry29.</li>
	</ol>
	</li>
</ol>
5. Establishment of a Murine Calvarial Critical Bone Defect Model and Scaffold Transplantation
NOTE: Male BALB/c mice (7 weeks old) were purchased from Guangdong Medical Laboratory Animal Center (Guangdong, China).
<ol>
	<li>Enroll a total of 42 male mice for the calvarial bone defect experiment. Randomly divide the mice into three groups, with fourteen in each group that receive the following treatments: Group A, no implants; Group B, PH scaffolds implanted (PLGA/nHAp); and Group C, PHp scaffolds implanted (PLGA/nHAp/LV-pdgfb).</li>
	<li>Anesthetize the animals with the intraperitoneal administration of sodium pentobarbital (50 mg/kg). Remove fur with depilatory paste and clean the head skin with 75% alcohol solution before making the first incision. Fix the head of each mouse with a stereotactic instrument to keep it still during surgery.</li>
	<li>Make an initial incision with a scalpel and then enlarge it with scissors to create a 1-cm linear skin incision. Scrape the periosteum from the bone of the cranium to reveal the bone surface of the skull using a sterile cotton swab.</li>
	<li>Use a trephine burr to create a 4 mm-diameter critical-size defect on the left side of the calvaria30. Transplant the scaffold into the bone defect site. 
	NOTE: Critical size defects (CSDs) were originally defined as &#34;the smallest size intraosseous wound in a particular bone and species of animal that will not heal spontaneously during the lifetime of the animal.&#34; In this experiment, the 4 mm-diameter defect is a critical size bone defect, according to the previously study31,32.</li>
	<li>Use ophthalmic forceps to move the periosteum back gently to cover the surgical site. Suture the incised skin with three stitches per cm.</li>
	<li>Perform post-operational care. Administer the analgesic buprenorphine (0.1 mg/kg) to relieve pain. Maintain the body temperature with a heating pad until the animal awakens. Subsequently, feed the animals with food and water and record their activity every day until the end of the test. Note: Analgesia can be administered prior to the procedure depending on your local animal care committee guidelines.&#160;</li>
</ol>
6. In Vivo Imaging of Angiogenesis Within the Bone Defect with MPM
NOTE: FITC-conjugated 250 kD dextran (10 mg/mL) in saline was intravenously injected into mice to obtain high-SNR (signal-to-noise ratio) images of new blood vessels according to a previous study33. &#160;Please note that this is a survival procedure.&#160;
<ol>
	<li>Assemble the multiphoton microscopy (MPM) system for two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG) imaging.</li>
	<li>Anaesthetize the animals with an intraperitoneal injection of pentobarbital sodium (50 mg/kg) and immobilize the animals on a heating plate to maintain their body temperature at 37 &#176;C throughout the experiments. Use 3.0% isoflurane gas in 100% oxygen to maintain satisfactory anesthesia and analgesia during the imaging process. Intraperitoneally inject saline (200 &#181;L/animal) to prevent dehydration before imaging.</li>
	<li>Tune the femtosecond Ti-Sapphire laser to 860 nm. Create a 512 x 512 &#181;m sampling area by scanning a pair of galvo mirrors and use NA1.0 water-immersion objective lens to focusthe excitation beam into the sample and to collect the backscattered TPEF/SHG signal. 
	NOTE: The imaging was performed on a home-build multiphoton microscopic imaging system (MPM). During imaging, a femtosecond Ti-Sapphire laser was tuned to 860 nm as the optimal excitation wavelength. The laser beam was raster scanned across a sample plane using a pair of galvanometer mirrors. After passing through a dichroic mirror of 685 nm, the beam was focused on the specimen by a 20X NA1.0 objective. The induced TPEF and SHG signals were collected by the same objective. The signals were split from the excitation laser by the dichroic mirror mentioned above and purified by a 680-nm short-pass filter. The TPEF and SHG signals were collected by a fiber bundle and conducted to a spectrograph. The detector on the spectrograph was a linear array of photomultiplier tubes (PMTs). The combination of spectrograph and linear array PMTs offered the capability to record the signal in 16 consecutive spectral bands, from 400 nm to 600 nm, at 12.5-nm intervals. Therefore, the TPEF and SHG signals were detected at the same time and separated in spectral domains. Furthermore, for 3D imaging, an axial motor was used to control the imaging depth. The area of each image was set to 512 x 512 &#181;m, and the depth interval was set to 2 &#181;m (control group, 5 &#181;m). Notably, 5 sites on each defect were imaged to collect statistically significant data, and the selected imaging sites were distributed evenly and randomly along the defect.</li>
	<li>Scan 5 sites on each defect to collect statistically significant data to measure vessel formation.
	<ol>
		<li>Use scanning sites evenly and randomly distributed along the defect. For the control group, have the field of view (FOV) cover both the original bone area and the edge of the defect, but for the PH and PHp groups, have the FOV on the implanted scaffold.</li>
		<li>Make a 1-cm linear skin incision using a scalpel and suture the open skin to the fixation to reveal the transplantation site. Use a syringe to place a drop of water between the dipping lens and transplants to form a water glass.</li>
	</ol>
	</li>
	<li>Acquire image stacks every 12 s over a 2 h imaging period. Display and analyze volumetric data using a custom MATLAB program and quantify the blood vessel areas with ImageJ software34,35.</li>
</ol>
7. Gene Expression Analysis of pdgf-b and Angiogenesis-related Genes by RT-qPCR
NOTE: PCR was performed following the usual steps: 95 &#176;C for 30 s, 40 cycles of 95 &#176;C for 5 s, and 60 &#176;C for 30 s. Post-PCR melting curves confirmed the specificity of single-target amplification, and the fold change of the gene of interest relative to &#946;-actin was determined. The reaction for each sample was tested three times.
<ol>
	<li>Harvest implanted scaffolds and tissues from the experimental mice at 2, 4, and 8 weeks post-operation36; control group samples (n = 4), taken at the same time points, should be from adjacent bone tissue. 
	NOTE: At each time point (2, 4, and 8 weeks), euthanized the mice with CO2 inhalation. Dissect the calvaria and, subsequently, remove and harvest the implanted scaffolds from the calvaria.</li>
	<li>Use a commercial reagent to extract the total RNA from each sample according to the manufacturer&#39;s protocol. Use the Reverse Transcription Kit to reverse-transcribe the RNA into cDNA following the manufacturer&#39;s protocol.</li>
	<li>Perform quantitative real-time PCR using the SYBR Green Detection System; the primers are listed in Table 1.</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="8">Primer(5&#39;&#8211;3&#39;)</td>
		</tr>
		<tr>
			<td colspan="2" rowspan="1">Gene</td>
			<td colspan="2" rowspan="1">Forward</td>
			<td colspan="4" rowspan="1">Reverse</td>
		</tr>
		<tr>
			<td>pdgfb</td>
			<td colspan="3">CATCCGCTCCTTTGATGATCTT</td>
			<td colspan="4">GTGCTCGGGTCATGTTCAAGT</td>
		</tr>
		<tr>
			<td>vWF</td>
			<td colspan="3">CTCTTTGGGGACGACTTCATC</td>
			<td colspan="4">TCCCGAGAATGGAGAAGGAAC</td>
		</tr>
		<tr>
			<td>VEGFR2</td>
			<td colspan="3">GAAATGACACTGGAGCCTACA AG</td>
			<td colspan="4">TCCATGCTGGTCACTAACAGAA G</td>
		</tr>
		<tr>
			<td>&#946;-actin</td>
			<td colspan="3">GTATCCATGAAATAAGTGGTTAC AGG</td>
			<td colspan="4">GCAGTACATAATTTACACAGAAG CAAT</td>
		</tr>
	</tbody>
</table>
Table 1: Pimer Sets.
8. MicroCT Analysis of Bone Regeneration
<ol>
	<li>Euthanize mice with CO2 inhalation at 8 weeks post-operation. In a well-ventilated environment, gently place each mouse into a clean mouse cage and pump CO2 gas into the cage to anaesthetize the mice before the euthanasia.</li>
	<li>Dissect the skull for microCT imaging of the bone defect region. User the following scanning parameters in the experiments: 9 &#181;m resolution, Al 0.5 mm filter, 50 kV voltage, and 142 &#181;A current.</li>
	<li>Reconstruct all imaging data using commercial software provided by the company. Calibrate the scans using the calibration function of a CTAn software. 
	NOTE: Place a Hounsfield unit (HU) under the mice in each scan.</li>
</ol>

<ol>
	<li>Hu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GPNMB+enhances+bone+regeneration+by+promoting+angiogenesis+and+osteogenesis:+potential+role+for+tissue+engineering+bone.">GPNMB enhances bone regeneration by promoting angiogenesis and osteogenesis: potential role for tissue engineering bone.</a> J Cell Biochem. 114 (12), 2729-2737 (2013).</li><li>Schroeder, J. E., Mosheiff, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+engineering+approaches+for+bone+repair:+concepts+and+evidence.">Tissue engineering approaches for bone repair: concepts and evidence.</a> Injury. 42 (6), 609-613 (2011).</li><li>Chiarello, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=allograft+and+bone+substitutes+in+reconstructive+orthopedic+surgery.">allograft and bone substitutes in reconstructive orthopedic surgery.</a> Aging Clin Exp Res. 25, S101-S103 (2013).</li><li>Elangovan, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+enhancement+of+bone+regeneration+by+gene+activated+matrix+encoding+for+platelet+derived+growth+factor.">The enhancement of bone regeneration by gene activated matrix encoding for platelet derived growth factor.</a> Biomaterials. 35 (2), 737-747 (2014).</li><li>Bouyer, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+delivery+of+tunable+doses+of+BMP-2+from+an+adaptable+polymeric+scaffold+induces+volumetric+bone+regeneration.">Surface delivery of tunable doses of BMP-2 from an adaptable polymeric scaffold induces volumetric bone regeneration.</a> Biomaterials. 104, 168-181 (2016).</li><li>Rezwan, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biodegradable+and+bioactive+porous+polymer/inorganic+composite+scaffolds+for+bone+tissue+engineering.">Biodegradable and bioactive porous polymer/inorganic composite scaffolds for bone tissue engineering.</a> Biomaterials. 27 (18), 3413-3431 (2006).</li><li>Burg, K. J., Porter, S., Kellam, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomaterial+developments+for+bone+tissue+engineering.">Biomaterial developments for bone tissue engineering.</a> Biomaterials. 21 (23), 2347-2359 (2000).</li><li>Xiao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modifications+of+collagen-based+biomaterials+with+immobilized+growth+factors+or+peptides.">Modifications of collagen-based biomaterials with immobilized growth factors or peptides.</a> Methods. 84, 44-52 (2015).</li><li>Chen, G., Lv, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization+and+Application+of+Electrospun+Nanofiber+Scaffold-based+Growth+Factor+in+Bone+Tissue+Engineering.">Immobilization and Application of Electrospun Nanofiber Scaffold-based Growth Factor in Bone Tissue Engineering.</a> Curr Pharm Des. 21 (15), 1967-1978 (2015).</li><li>Kofron, M. D., Li, X., Laurencin, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein-+and+gene-based+tissue+engineering+in+bone+repair.">Protein- and gene-based tissue engineering in bone repair.</a> Curr Opin Biotechnol. 15 (5), 399-405 (2004).</li><li>Chen, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+insights+into+and+novel+applications+of+release+technology+for+periodontal+reconstructive+therapies.">New insights into and novel applications of release technology for periodontal reconstructive therapies.</a> J Control Release. 149 (2), 92-110 (2011).</li><li>Winn, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+therapy+approaches+for+modulating+bone+regeneration.">Gene therapy approaches for modulating bone regeneration.</a> Adv Drug Deliv Rev. 42 (1-2), 121-138 (2000).</li><li>Chang, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+Encoding+Human+Platelet-Derived+Growth+Factor-B+Delivered+to+Alveolar+Bone+Defects+Exhibits+Safety+and+Biodistribution+Profiles+Favorable+for+Clinical+Use.">Adenovirus Encoding Human Platelet-Derived Growth Factor-B Delivered to Alveolar Bone Defects Exhibits Safety and Biodistribution Profiles Favorable for Clinical Use.</a> Hum Gene Ther. 20 (5), 486-496 (2009).</li><li>Phipps, M. C., Xu, Y. Y., Bellis, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+Platelet-Derived+Growth+Factor+as+a+Chemotactic+Factor+for+Mesenchymal+Stem+Cells+by+Bone-Mimetic+Electrospun+Scaffolds.">Delivery of Platelet-Derived Growth Factor as a Chemotactic Factor for Mesenchymal Stem Cells by Bone-Mimetic Electrospun Scaffolds.</a> Plos One. 7 (7), (2012).</li><li>Gehmert, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiogenesis:+The+role+of+PDGF-BB+on+Adiopse-tissue+derived+Stem+Cells+(ASCs).">Angiogenesis: The role of PDGF-BB on Adiopse-tissue derived Stem Cells (ASCs).</a> Clin Hemorheol and Microcirc. 48 (1-3), 5-13 (2011).</li><li>Chang, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PDGF-B+gene+therapy+accelerates+bone+engineering+and+oral+implant+osseointegration.">PDGF-B gene therapy accelerates bone engineering and oral implant osseointegration.</a> Gene Ther. 17 (1), 95-104 (2010).</li><li>Javed, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+the+platelet-derived+growth+factor+in+periodontal+tissue+regeneration.">Significance of the platelet-derived growth factor in periodontal tissue regeneration.</a> Arch Oral Biol. 56 (12), 1476-1484 (2011).</li><li>Murali, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomimetic+hybrid+porous+scaffolds+immobilized+with+platelet+derived+growth+factor-BB+promote+cellularization+and+vascularization+in+tissue+engineering.">Biomimetic hybrid porous scaffolds immobilized with platelet derived growth factor-BB promote cellularization and vascularization in tissue engineering.</a> J Biomed Mater Res A. 104 (2), 388-396 (2016).</li><li>Andrae, J., Gallini, R., Betsholtz, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+platelet-derived+growth+factors+in+physiology+and+medicine.">Role of platelet-derived growth factors in physiology and medicine.</a> Genes Dev. 22 (10), 1276-1312 (2008).</li><li>Wosnitza, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasticity+of+human+adipose+stem+cells+to+perform+adipogenic+and+endothelial+differentiation.">Plasticity of human adipose stem cells to perform adipogenic and endothelial differentiation.</a> Differentiation. 75 (1), 12-23 (2007).</li><li>Hankenson, K. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiogenesis+in+bone+regeneration.">Angiogenesis in bone regeneration.</a> Injury. 42 (6), 556-561 (2011).</li><li>Schmidt, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+three-dimensional+quantification+of+VEGF-induced+scaffold+neovascularisation+by+microcomputed+tomography.">Rapid three-dimensional quantification of VEGF-induced scaffold neovascularisation by microcomputed tomography.</a> Biomaterials. 30 (30), 5959-5968 (2009).</li><li>Perng, C. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Angiogenesis+Effect+of+Porous+Collagen+Scaffold+with+Hyaluronic+Acid+Oligosaccharides.">In Vivo Angiogenesis Effect of Porous Collagen Scaffold with Hyaluronic Acid Oligosaccharides.</a> J Surg Res. 168 (1), 9-15 (2011).</li><li>Sun, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+tissue+engineering+scaffolds+using+multiphoton+microscopy.">Imaging tissue engineering scaffolds using multiphoton microscopy.</a> Microsc Res Tech. 71 (2), 140-145 (2008).</li><li>Fan, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noninvasive+monitoring+of+placenta-specific+transgene+expression+by+bioluminescence+imaging.">Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging.</a> PLoS One. 6 (1), e16348 (2011).</li><li>Yeo, M. G., Kim, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Characterization+of+3D+Composite+Scaffolds+Based+on+Rapid-Prototyped+PCL/&#946;-TCP+Struts+and+Electrospun+PCL+Coated+with+Collagen+and+HA+for+Bone+Regeneration.">Preparation and Characterization of 3D Composite Scaffolds Based on Rapid-Prototyped PCL/&#946;-TCP Struts and Electrospun PCL Coated with Collagen and HA for Bone Regeneration.</a> Chem Mater. 24 (5), 903-913 (2012).</li><li>Mao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+Vectors+Mediate+Long-Term+and+High+Efficiency+Transgene+Expression+in+HEK+293T+cells.">Lentiviral Vectors Mediate Long-Term and High Efficiency Transgene Expression in HEK 293T cells.</a> Int J Med Sci. 12 (5), 407-415 (2015).</li><li>Li, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigation+of+angiogenesis+in+bioactive+3-dimensional+poly+(D,L-lactide-co-glycolide)/nano-hydroxyapatite+scaffolds+by+in+vivo+multiphoton+microscopy+in+murine+calvarial+critical+bone+defect.">Investigation of angiogenesis in bioactive 3-dimensional poly (D,L-lactide-co-glycolide)/nano-hydroxyapatite scaffolds by in vivo multiphoton microscopy in murine calvarial critical bone defect.</a> Acta Biomater. 42, 389-399 (2016).</li><li>Abbasi, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vector-mediated+transduction+of+goat+undifferentiated+spermatogonia.">Lentiviral vector-mediated transduction of goat undifferentiated spermatogonia.</a> Anim Reprod Sci. 163, 10-17 (2015).</li><li>Pigossi, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+cellulose-hydroxyapatite+composites+with+osteogenic+growth+peptide+(OGP)+or+pentapeptide+OGP+on+bone+regeneration+in+critical-size+calvarial+defect+model.">Bacterial cellulose-hydroxyapatite composites with osteogenic growth peptide (OGP) or pentapeptide OGP on bone regeneration in critical-size calvarial defect model.</a> J Biomed Mater Res A. , (2015).</li><li>Bos, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+histocompatibility+matching+on+canine+frozen+bone+allografts.">The effect of histocompatibility matching on canine frozen bone allografts.</a> J Bone Joint Surg Am. 65 (1), 89-96 (1983).</li><li>Hollinger, J. O., Kleinschmidt, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+critical+size+defect+as+an+experimental+model+to+test+bone+repair+materials.">The critical size defect as an experimental model to test bone repair materials.</a> J Craniofac Surg. 1 (1), 60-68 (1990).</li><li>Hollanders, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bevacizumab+Revisited:+Its+Use+in+Different+Mouse+Models+of+Ocular+Pathologies.">Bevacizumab Revisited: Its Use in Different Mouse Models of Ocular Pathologies.</a> Curr Eye Res. 40 (6), 611-621 (2015).</li><li>Gao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QSIM:+quantitative+structured+illumination+microscopy+image+processing+in+ImageJ.">QSIM: quantitative structured illumination microscopy image processing in ImageJ.</a> Biomed Eng Online. 14, 4 (2015).</li><li>Kobat, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deep+tissue+multiphoton+microscopy+using+longer+wavelength+excitation.">Deep tissue multiphoton microscopy using longer wavelength excitation.</a> Opt Express. 17 (16), 13354-13364 (2009).</li><li>Lohmann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+regeneration+induced+by+a+3D+architectured+hydrogel+in+a+rat+critical-size+calvarial+defect.">Bone regeneration induced by a 3D architectured hydrogel in a rat critical-size calvarial defect.</a> Biomaterials. 113, 158-169 (2016).</li><li>Lv, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+angiogenesis+and+osteogenesis+in+critical+bone+defects+by+the+controlled+release+of+BMP-2+and+VEGF:+implantation+of+electron+beam+melting-fabricated+porous+Ti6Al4V+scaffolds+incorporating+growth+factor-doped+fibrin+glue.">Enhanced angiogenesis and osteogenesis in critical bone defects by the controlled release of BMP-2 and VEGF: implantation of electron beam melting-fabricated porous Ti6Al4V scaffolds incorporating growth factor-doped fibrin glue.</a> Biomed Mater. 10 (3), (2015).</li><li>Guldberg, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3D+imaging+of+tissue+integration+with+porous+biomaterials.">3D imaging of tissue integration with porous biomaterials.</a> Biomaterials. 29 (28), 3757-3761 (2008).</li><li>Boehler, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+PLG/HAp+composite+scaffold+for+lentivirus+delivery.">A PLG/HAp composite scaffold for lentivirus delivery.</a> Biomaterials. 34 (21), 5431-5438 (2013).</li><li>Heo, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fabrication+and+characterization+of+novel+nano-+and+micro-HA/PCL+composite+scaffolds+using+a+modified+rapid+prototyping+process.">Fabrication and characterization of novel nano- and micro-HA/PCL composite scaffolds using a modified rapid prototyping process.</a> J Biomed Mater Res A. 89 (1), 108-116 (2009).</li></ol>

The authors declare that they have no competing financial interests.

Bone is a highly vascularized tissue with a unique capacity to continuously heal and remodel throughout the lifetime of an individual1. The level of vascularization is important for osteogenesis and defect repair. Low vascularization limits the wide clinical application of tissue-engineered bone. Constructing a highly vascularized tissue-engineered bone according to the theory of biomimetics has become a tool for repairing large segment bone defects. Various kinds of scaffolds have been successful...

Bone is a highly vascularized tissue that continues to remodel during the lifetime of an individual1. The rapid and effective bone regeneration of large bone defects resulting from trauma, nonunion, tumor resections, or craniofacial malformations is a complex physiological process. Traditional therapeutic approaches used for bone defect repair include autograft and allograft implantation, but their use involves several problems and limitations, such as limited availability, significant donor site morbidity, a high risk of infection, and host immune rejection2,3. However, artificial bone grafts offer an efficient alternative to alleviate these limitations. They can be made from biodegradable materials, are easy to be fabricate with a suitable pore size, and can be genetically modified4,5.
Currently, various tissue engineering scaffolds have been employed in the development of tissue-engineered bone6,7. To induce bone repair and regeneration more effectively, engineered biomaterials combined with growth factors have emerged and achieved good results8,9. Unfortunately, the short half-life, easy-to-lose activity, and supraphysiological dosage of growth factors for therapeutic efficacy limit their clinical application10. To overcome these problems, the delivery of growth factor genes instead of growth factors has been demonstrated as an effective approach to sustain bioactivity for the treatment of osseous defects and diseases11,12. Viral vectors are promising delivery tools for tissue regeneration due to their high expressing efficiency13.
Among growth factors, platelet-derived growth factor (PDGF-BB) was selected in this study because it is not only a mitogen and chemoattractant for mesenchymal and osteogenic cells, but also a stimulant for angiogenesis14,15. Previous preclinical and clinical studies showed that PDGF-BB could safely and effectively promote bone repair in periodontal osseous defects16,17. Recent studies revealed that PDGF-BB stimulates angiogenesis by motivating endothelial cell migration and proliferation in vivo18,19. Furthermore, PDGF-BB can also render mesenchymal stem cells (MSCs) capable of differentiating into endothelial cells20, and this further highlights the potential role of MSCs in neovascularization. Therefore, inducing the de novo formation of vasculature in scaffolds with PDGF-BB is an important step for the repair of tissue grown into scaffolds in bone tissue engineering.
Bone defect healing is a dynamic tissue morphogenetic process that requires coordinated osteogenesis and angiogenesis at the repairing positions21. Neoangiogenesis into implanted tissue-engineered scaffolds is an essential pre-requisite for supplying cells with nutrients and oxygen for growth and survival and for removing metabolic waste. Commonly used imaging methods, including X-ray micro-computed tomography (microCT), magnetic resonance imaging (MRI), scanning electron microscopy (SEM), optical coherence tomography (OCT), and confocal laser scanning microscopy, are applied instead of histological examination to obtain angiogenesis information22,23. However, these methods face various obstacles in visualizing and measuring neovasculature in 3D scaffolds in bone tissue engineering. Multiphoton microscopy (MPM) is a comparatively novel bio-imaging technique that has the distinct advantage of simultaneously visualizing cells, extracellular matrix, and surrounding vascular networks in vivo. It possesses an inherent three-dimensional imaging capability for deep tissue penetration and causes low photodamage. Hence, in the last decade, MPM has gained much attention in biomedical studies24, including in neuroscience, immunology, and stem cell dynamics. However, it is barely used in orthopedic research.

<table><tbody><tr><td>Poly(D,L-lactide-co-glycolide) (PLGA)</td><td>Sigma</td><td>P1941</td><td>L/G ratio 75:25, MW 66000-107000</td></tr><tr><td>Hydroxyapatite nanoparticles</td><td>Sigma</td><td>702153</td><td>Average diameter &amp;lt; 200 nm</td></tr><tr><td>Chloroquine diphosphate salt</td><td>Sigma</td><td>C6628</td><td></td></tr><tr><td>FITC-conjugated 250-kD dextran</td><td>Sigma</td><td>FD250S</td><td></td></tr><tr><td>1,4-dioxane</td><td>lingfeng,Shanghai</td><td></td><td>0.45 micron</td></tr><tr><td>Stericup filters</td><td>Merck Millipore Corporation</td><td>SLHV033RB</td><td></td></tr><tr><td>PDGF-BB Cdna</td><td>Sino Biological, Inc</td><td>MZ50801-G</td><td></td></tr><tr><td>Anti-PDGF-BB mouse polyclonal antibody</td><td>&amp;nbsp;BioVision, Inc</td><td>5489-30T</td><td></td></tr><tr><td>PDGF-BB recombinant protein</td><td></td><td>4489-50</td><td></td></tr><tr><td>Calcium-phosphate transfection solution</td><td>Promega Corporation</td><td>E1200</td><td></td></tr><tr><td>L-DMEM</td><td>Hyclone</td><td>SH30021.01</td><td></td></tr><tr><td>DPBS</td><td>Hyclone</td><td>SH30028.01</td><td></td></tr><tr><td>Penicillin-Streptomycin, Liquid</td><td>Thermo Fisher Scientific</td><td>15140122</td><td></td></tr><tr><td>FBS</td><td>Thermo Fisher Scientific</td><td>10099-141</td><td></td></tr><tr><td>Transwell&amp;nbsp;</td><td>Corning</td><td>3422</td><td></td></tr><tr><td>Male BALB/c mice</td><td>Guangdong Medical Laboratory Animal Center&amp;nbsp;</td><td></td><td></td></tr><tr><td>sodium pentobarbital&amp;nbsp;</td><td>Merck</td><td>1063180500</td><td></td></tr><tr><td>multiphoton microscopy</td><td></td><td></td><td>A homemade in Shenzhen Institutes of Advanced Technology to detect two-photon excited fluorescence (TPEF) and second harmonic generation signal (SHG).</td></tr><tr><td>isoflurane</td><td>Keyuan, Shandong</td><td>401750169</td><td></td></tr><tr><td>TRIzol reagent</td><td>Invitrogen</td><td>15596018</td><td></td></tr><tr><td>PrimeScript RT Master Mix (Perfect Real Time)</td><td>Takara</td><td>RR420B</td><td></td></tr><tr><td>SYBR Premix Ex Taq (Tli RNaseH Plus)</td><td>Takara</td><td>RR036B</td><td></td></tr><tr><td>Hematoxylin and eosin</td><td>Beyotime</td><td>C0105</td><td></td></tr><tr><td>Paraffin</td><td>Leica&amp;nbsp;</td><td>RM2235</td><td></td></tr><tr><td>Ultracentrifuge OPtima L-100XP</td><td>Beckman Coulter</td><td>L-100XP</td><td></td></tr><tr><td>Low-temperature printer&amp;nbsp;</td><td>Tsinghua university</td><td></td><td>A homemade in Tsinghua university</td></tr><tr><td>LightCycler 480 instrument&amp;nbsp;</td><td>Roche</td><td>5815916001</td><td></td></tr><tr><td>microCT</td><td>Bruker</td><td>1176</td><td></td></tr><tr><td>commercial software</td><td>Bruker</td><td></td><td></td></tr><tr><td>Buprenorphine</td><td></td><td></td><td></td></tr></tbody></table>

visualizing angiogenesis by multiphoton microscopy in vivo in genetically modified 3d-plga/nhap scaffold for calvarial critical bone defect repair

The reconstruction of critically sized bone defects remains a serious clinical problem because of poor angiogenesis within tissue-engineered scaffolds during repair, which gives rise to a lack of sufficient blood supply and causes necrosis of the new tissues. Rapid vascularization is a vital prerequisite for new tissue survival and integration with existing host tissue. The de novo generation of vasculature in scaffolds is one of the most important steps in making bone regeneration more efficient, allowing repairing tissue to grow into a scaffold. To tackle this problem, the genetic modification of a biomaterial scaffold is used to accelerate angiogenesis and osteogenesis. However, visualizing and tracking in vivo blood vessel formation in real-time and in three-dimensional (3D) scaffolds or new bone tissue is still an obstacle for bone tissue engineering. Multiphoton microscopy (MPM) is a novel bio-imaging modality that can acquire volumetric data from biological structures in a high-resolution and minimally-invasive manner. The objective of this study was to visualize angiogenesis with multiphoton microscopy in vivo in a genetically modified 3D-PLGA/nHAp scaffold for calvarial critical bone defect repair. PLGA/nHAp scaffolds were functionalized for the sustained delivery of a growth factor pdgf-b gene carrying lentiviral vectors (LV-pdgfb) in order to facilitate angiogenesis and to enhance bone regeneration. In a scaffold-implanted calvarial critical bone defect mouse model, the blood vessel areas (BVAs) in PHp scaffolds were significantly higher than in PH scaffolds. Additionally, the expression of pdgf-b and angiogenesis-related genes, vWF and VEGFR2, increased correspondingly. MicroCT analysis indicated that the new bone formation in the PHp group dramatically improved compared to the other groups. To our knowledge, this is the first time multiphoton microscopy was used in bone tissue-engineering to investigate angiogenesis in a 3D bio-degradable scaffold in vivo and in real-time.

Cylindrical Porous PLGA/nHAp scaffolds 0.6 mm in height and 4 mm in diameter were fabricated with a 3D printer. The morphologies of the scaffolds were analyzed via scanning electron microscopy and microCT. Figure 1A shows the photograph of the implanted scaffold. MicroCT scanning revealed that more than 85% of the pores had sizes ranging from 200 to 400 &#181;m (Figure 1B). SEM imaging demonstrated that the surface of the scaffold had a rough microtopogra...

Watch this Scientific Journal Video about Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair at JoVE.com

Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair

Here, we present a protocol to visualize blood vessel formation in vivo and in real-time in 3D scaffolds by multiphoton microscopy. Angiogenesis in genetically modified scaffolds was studied in a murine calvarial critical bone defect model. More new blood vessels were detected in the treatment group than in controls.

Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair

The reconstruction of critically sized bone defects remains a serious clinical problem because of poor angiogenesis within tissue-engineered scaffolds ...

visualizing-angiogenesis-multiphoton-microscopy-vivo-genetically

Research

JoVE Journal

Bioengineering

9.2K Views.  Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences. Hier presenteren we een protocol om te visualiseren bloedvat vorming in vivo en in real-time in 3D steigers door multiphoton microscopie. Angiogenese in genetisch gemodificeerde steigers werd bestudeerd in een lymfkliertest calvarial kritische bot defect model. Meer nieuwe bloedvaten werden ontdekt in de behandelde groep dan in besturingselementen.

Video: Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair

Use of Human Perivascular Stem Cells for Bone Regeneration

Human perivascular stem cells (PSCs) can be isolated in sufficient numbers from multiple tissues for purposes of skeletal tissue engineering1-3. PSCs are a FACS-sorted population of 'pericytes' (CD146+CD34-CD45-) and 'adventitial cells' (CD146-CD34+CD45-), each of which we have previously reported to have properties of mesenchymal stem cells. PSCs, like MSCs, are able to undergo osteogenic differentiation, as well as secrete pro-osteogenic cytokines1,2. In the present protocol, we demonstrate the osteogenicity of PSCs in several animal models including a muscle pouch implantation in SCID (severe combined immunodeficient) mice, a SCID mouse calvarial defect and a femoral segmental defect (FSD) in athymic rats. The thigh muscle pouch model is used to assess ectopic bone formation. Calvarial defects are centered on the parietal bone and are standardly 4 mm in diameter (critically sized)8. FSDs are bicortical and are stabilized with a polyethylene bar and K-wires4. The FSD described is also a critical size defect, which does not significantly heal on its own4. In contrast, if stem cells or growth factors are added to the defect site, significant bone regeneration can be appreciated. The overall goal of PSC xenografting is to demonstrate the osteogenic capability of this cell type in both ectopic and orthotopic bone regeneration models.

Human perivascular stem cells (PSCs) are a novel stem cell class for skeletal tissue regeneration similar to mesenchymal stem cells (MSCs). PSCs can be isolated by FACS (fluorescence activated cell sorting) from adipose tissue procured during standard liposuction procedures, then combined with an osteoinductive scaffold to achieve bone formation in vivo.

Human perivascular stem cells (PSCs) can be isolated in sufficient numbers from multiple tissues for purposes of skeletal tissue engineering1-3. PSCs are ...

Repair of a Critical-sized Calvarial Defect Model Using Adipose-derived Stromal Cells Harvested from Lipoaspirate

Craniofacial skeletal repair and regeneration offers the promise of de novo tissue formation through a cell-based approach utilizing stem cells. Adipose-derived stromal cells (ASCs) have proven to be an abundant source of multipotent stem cells capable of undergoing osteogenic, chondrogenic, adipogenic, and myogenic differentiation. Many studies have explored the osteogenic potential of these cells in vivo with the use of various scaffolding biomaterials for cellular delivery. It has been demonstrated that by utilizing an osteoconductive, hydroxyapatite-coated poly(lactic-co-glycolic acid) (HA-PLGA) scaffold seeded with ASCs, a critical-sized calvarial defect, a defect that is defined by its inability to undergo spontaneous healing over the lifetime of the animal, can be effectively show robust osseous regeneration. This in vivo model demonstrates the basis of translational approaches aimed to regenerate the bone tissue - the cellular component and biological matrix. This method serves as a model for the ultimate clinical application of a progenitor cell towards the repair of a specific tissue defect.

This protocol describes the isolation of adipose-derived stromal cells from lipoaspirate and the creation of a 4 mm critical-sized calvarial defect to evaluate skeletal regeneration.

Craniofacial skeletal repair and regeneration offers the promise of de novo tissue formation through a cell-based approach utilizing stem cells. ...

Medicine

Bioengineering of Humanized Bone Marrow Microenvironments in Mouse and Their Visualization by Live Imaging

Human hematopoietic stem cells (HSCs) reside in the bone marrow (BM) niche, an intricate, multifactorial network of components producing cytokines, growth factors, and extracellular matrix. The ability of HSCs to remain quiescent, self-renew or differentiate, and acquire mutations and become malignant depends upon the complex interactions they establish with different stromal components. To observe the crosstalk between human HSCs and the human BM niche in physiological and pathological conditions, we designed a protocol to ectopically model and image a humanized BM niche in immunodeficient mice. We show that the use of different cellular components allows for the formation of humanized structures and the opportunity to sustain long-term human hematopoietic engraftment. Using two-photon microscopy, we can live-image these structures in situ at the single-cell resolution, providing a powerful new tool for the functional characterization of the human BM microenvironment and its role in regulating normal and malignant hematopoiesis.

A method to create and live-image different humanized bone-marrow niches in mice is presented. Based on the supportive niche created by human mesenchymal cells, the addition of human endothelial cells induces the formation of human vessels, while the addition of rhBMP-2 induces the formation of human-mouse chimeric mature bone tissue.

Human hematopoietic stem cells (HSCs) reside in the bone marrow (BM) niche, an intricate, multifactorial network of components producing cytokines, growth ...

Developmental Biology

A Full Skin Defect Model to Evaluate Vascularization of Biomaterials In Vivo

Insufficient vascularization is considered to be one of the main factors limiting the clinical success of tissue-engineered constructs. In order to evaluate new strategies that aim at improving vascularization, reliable methods are required to make the in-growth of new blood vessels into bio-artificial scaffolds visible and quantify the results. Over the past couple of years, our group has introduced a full skin defect model that enables the direct visualization of blood vessels by transillumination and provides the possibility of quantification through digital segmentation. In this model, one surgically creates full skin defects in the back of mice and replaces them with the material tested. Molecules or cells of interest can also be incorporated in such materials to study their potential effect. After an observation time of one&#8217;s own choice, materials are explanted for evaluation. Bilateral wounds provide the possibility of making internal comparisons that minimize artifacts among individuals as well as of decreasing the number of animals needed for the study. In comparison to other approaches, our method offers a simple, reliable and cost effective analysis. We have implemented this model as a routine tool to perform high-resolution screening when testing vascularization of different biomaterials and bio-activation approaches.

A Full Skin Defect Model to Evaluate Vascularization of Biomaterials In Vivo

Vascularization is key to approaches in successful tissue engineering. Therefore, reliable technologies are required to evaluate the development of vascular networks in tissue-constructs. Here we present a simple and cost-effective method to visualize and quantify vascularization in vivo.

Insufficient vascularization is considered to be one of the main factors limiting the clinical success of tissue-engineered constructs. In order to ...

Computed Tomography and Optical Imaging of Osteogenesis-angiogenesis Coupling to Assess Integration of Cranial Bone Autografts and Allografts

A major parameter determining the success of a bone-grafting procedure is vascularization of the area surrounding the graft. We hypothesized that implantation of a bone autograft would induce greater bone regeneration by abundant blood vessel formation. To investigate the effect of the graft on neovascularization at the defect site, we developed a micro&#8211;computed tomography (&#181;CT) approach to characterize newly forming blood vessels, which involves systemic perfusion of the animal with a polymerizing contrast agent. This method enables detailed vascular analysis of an organ in its entirety. Additionally, blood perfusion was assessed using fluorescence imaging (FLI) of a blood-borne fluorescent agent. Bone formation was quantified by FLI using a hydroxyapatite-targeted probe and &#181;CT analysis. Stem cell recruitment was monitored by bioluminescence imaging (BLI) of transgenic mice that express luciferase under the control of the osteocalcin promoter. Here we describe and demonstrate preparation of the allograft, calvarial defect surgery, &#181;CT scanning protocols for the neovascularization study and bone formation analysis (including the in vivo perfusion of contrast agent), and the protocol for data analysis.
The 3D high-resolution analysis of vasculature demonstrated significantly greater angiogenesis in animals with implanted autografts, especially with respect to arteriole formation. Accordingly, blood perfusion was significantly higher in the autograft group by the 7th day after surgery. We observed superior bone mineralization and measured greater bone formation in animals that received autografts. Autograft implantation induced resident stem cell recruitment to the graft-host bone suture, where the cells differentiated into bone-forming cells between the 7th and 10th postoperative day. This finding means that enhanced bone formation may be attributed to the augmented vascular feeding that characterizes autograft implantation. The methods depicted may serve as an optimal tool to study bone regeneration in terms of tightly bounded bone formation and neovascularization.

Implantation of autologous and allogeneic bone grafts constitute accepted approaches to treat major craniofacial bone loss. Yet the effect of graft composition on the interplay among neovascularization, cell differentiation and bone formation is unclear. We present a multimodal imaging protocol aimed to elucidate the angiogenesis-osteogenesis interdependence at the graft proximity.

A major parameter determining the success of a bone-grafting procedure is vascularization of the area surrounding the graft. We hypothesized that ...

The Arteriovenous (AV) Loop in a Small Animal Model to Study Angiogenesis and Vascularized Tissue Engineering

A functional blood vessel network is a prerequisite for the survival and growth of almost all tissues and organs in the human body. Moreover, in pathological situations such as cancer, vascularization plays a leading role in disease progression. Consequently, there is a strong need for a standardized and well-characterized in vivo model in order to elucidate the mechanisms of neovascularization and develop different vascularization approaches for tissue engineering and regenerative medicine.
We describe a microsurgical approach for a small animal model for induction of a vascular axis consisting of a vein and artery that are anastomosed to an arteriovenous (AV) loop. The AV loop is transferred to an enclosed implantation chamber to create an isolated microenvironment in vivo, which is connected to the living organism only by means of the vascular axis. Using 3D imaging (MRI, micro-CT) and immunohistology, the growing vasculature can be visualized over time. By implanting different cells, growth factors and matrices, their function in blood vessel network formation can be analyzed without any disturbing influences from the surroundings in a well controllable environment. 
In addition to angiogenesis and antiangiogenesis studies, the AV loop model is also perfectly suited for engineering vascularized tissues. After a certain prevascularization time, the generated tissues can be transplanted into the defect site and microsurgically connected to the local vessels, thereby ensuring immediate blood supply and integration of the engineered tissue. By varying the matrices, cells, growth factors and chamber architecture, it is possible to generate various tissues, which can then be tailored to the individual patient's needs.

The Arteriovenous AV Loop in a Small Animal Model to Study Angiogenesis and Vascularized Tissue Engineering

We describe a microsurgical approach for the generation of an arteriovenous (AV) loop as a model for analyzing vascularization in vivo in an isolated and well-characterized environment. This model is not only useful for the investigation of angiogenesis, but is also optimally suited for engineering axially vascularized and transplantable tissues.

A functional blood vessel network is a prerequisite for the survival and growth of almost all tissues and organs in the human body. Moreover, in ...

3D Co-Culture Assay: Vascularized Osteogenic Niches for Cancer Drug Screening

Simple Establishment of a Vascularized Osteogenic Bone Marrow Niche Using Pre-Cast Poly(ethylene Glycol) (PEG) Hydrogels in an Imaging Microplate

The bone and bone marrow are highly vascularized and structurally complex organs, and are sites for cancer and metastasis formation. In vitro models recapitulating bone- and bone marrow-specific functions, including vascularization, that are compatible with drug screening are highly desirable. Such models can bridge the gap between simplistic, structurally irrelevant two-dimensional (2D) in vitro models and the more expensive, ethically challenging in vivo models. This article describes a controllable three-dimensional (3D) co-culture assay based on engineered poly(ethylene glycol) (PEG) matrices for the generation of vascularized, osteogenic bone-marrow niches. The PEG matrix design allows the development of 3D cell cultures through a simple cell seeding step requiring no encapsulation, thus enabling the development of complex co-culture systems. Furthermore, the matrices are transparent and pre-cast onto glass-bottom 96-well imaging plates, rendering the system suitable for microscopy. For the assay described here, human bone marrow-derived mesenchymal stromal cells (hBM-MSCs) are cultured first until a sufficiently developed 3D cell network is formed. Subsequently, GFP-expressing human umbilical vein endothelial cells (HUVECs) are added. The culture development is followed by bright-field and fluorescence microscopy. The presence of the hBM-MSC network supports the formation of vascular-like structures that otherwise&#160;would not form and that remain stable for at least 7 days. The extent of vascular-like network formation can easily be quantified. This model can be tuned toward an osteogenic bone-marrow niche by supplementing the culture medium with bone morphogenetic protein 2 (BMP-2), which promotes the osteogenic differentiation of the hBM-MSCs, as assessed by increased alkaline phosphatase (ALP) activity at day 4 and day 7 of co-culture. This cellular model can be used as a platform for culturing various cancer cells and studying how they interact with bone- and bone marrow-specific vascular niches. Moreover, it is suitable for automation and high-content analyses, meaning it would enable cancer drug screening under highly reproducible culture conditions.

Author Spotlight: Simple Establishment of a Vascularized Osteogenic Bone Marrow Niche Using Pre-Cast Poly(Ethylene Glycol) (PEG) Hydrogels in an Imaging Microplate  

An in vitro model of the bone marrow vascular niche is established by seeding mesenchymal and endothelial cells onto pre-cast 3D PEG hydrogels. The endothelial networks, ECM components, and ALP activity of the niches vary depending on the growth factor used. The platform can be used for advanced cancer models.

The bone and bone marrow are highly vascularized and structurally complex organs, and are sites for cancer and metastasis formation. In vitro models ...

Study of Angiogenesis Using Scratch Wound Migration and Spheroid Sprouting Assays

Investigating Angiogenesis on a Functional and Molecular Level by Leveraging the Scratch Wound Migration Assay and the Spheroid Sprouting Assay

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A detailed understanding of the underlying molecular mechanisms and reliable screening models are essential for targeting diseases effectively and developing new therapeutic options. Several in vitro assays have been developed to model angiogenesis, capitalizing on the opportunities a controlled environment provides to elucidate angiogenic drivers at a molecular level and screen for therapeutic targets.
This study presents workflows for investigating angiogenesis in vitro using human umbilical vein endothelial cells (HUVECs). We detail a scratch wound migration assay utilizing a live cell imaging system measuring endothelial cell migration in a 2D setting and the spheroid sprouting assay assessing endothelial cell sprouting in a 3D setting provided by a collagen matrix. Additionally, we outline strategies for sample preparation to enable further molecular analyses such as transcriptomics, particularly in the 3D setting, including RNA extraction as well as immunocytochemistry. Altogether, this framework offers scientists a reliable and versatile toolset to pursue their scientific inquiries in in vitro angiogenesis assays.

Author Spotlight: Investigating Angiogenesis Through Challenges and Innovations in Assay Development

This study presents the two-dimensional (2D) scratch wound migration assay and the three-dimensional (3D) spheroid sprouting assay, along with their respective downstream analysis methods, including RNA extraction and immunocytochemistry, as suitable assays to study angiogenesis in vitro.

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A ...

Simplifying Angiogenesis Studies with a Modified Matrix Gel Plug Assay

Modified In Vivo Matrix Gel Plug Assay for Angiogenesis Studies

Several models have been developed to investigate angiogenesis in vivo. However, most of these models are complex and expensive, require specialized equipment, or are hard to perform for subsequent quantitative analysis. Here we present a modified matrix gel plug assay to evaluate angiogenesis in vivo. In this protocol, vascular cells were mixed with matrix gel in the presence or absence of pro-angiogenic or anti-angiogenic reagents, and then subcutaneously injected into the back of recipient mice. After 7 days, phosphate buffer saline containing dextran-FITC is injected via the tail vein and circulated in vessels for 30 min. Matrix gel plugs are collected and embedded with tissue embedding gel, then 12 &#181;m sections are cut for fluorescence detection without staining. In this assay, dextran-FITC with high molecular weight (~150,000 Da) can be used to indicate functional vessels for detecting their length, while dextran-FITC with low molecular weight (~4,400 Da) can be used to indicate the permeability of neo-vessels. In conclusion, this protocol can provide a reliable and convenient method for the quantitative study of angiogenesis in vivo.

Author Spotlight: Investigating Angiogenesis and Vessel Permeability Through a Modified Matrix Gel Plug Assay

The method presented here can evaluate the effect of reagents on angiogenesis or vascular permeability in vivo without staining. The method uses dextran-FITC injection via the tail vein to visualize neo-vessels or vascular leakage.

Several models have been developed to investigate angiogenesis in vivo. However, most of these models are complex and expensive, require specialized ...

Biology

Versatile 2.5D Model for Analyzing Cellular Sprouting in Porcine Arteries

2.5D Model for Ex Vivo Mechanical Characterization of Sprouting Angiogenesis in Living Tissue

Sprouting angiogenesis is the formation of new blood vessels from pre-existing vasculature and is of great importance for physiological such as tissue growth and repair and pathological processes, including cancer and metastasis. The multistep process of sprouting angiogenesis is a molecularly and mechanically driven process. It consists of induction of cellular sprout by vascular endothelial growth factor, leader/follower cell selection through Notch signaling, directed migration of endothelial cells, and vessel fusion and stabilization. A variety of sprouting angiogenesis models have been developed over the years to better understand the underlying mechanisms of cellular sprouting. Despite advancements in understanding the molecular drivers of sprouting angiogenesis, the role of mechanical cues and the mechanical driver of sprouting angiogenesis remains underexplored due to limitations in existing models. In this study, we designed a 2.5D ex vivo model that enables us to mechanically characterize cellular sprouting from a porcine carotid artery using traction force microscopy. The model identifies distinct force patterns within the sprout, where leader cells exert pulling forces and follower cells exert pushing forces on the matrix. The model's versatility allows for the manipulation of both chemical and mechanical cues, such as matrix stiffness, enhancing its relevance to various microenvironments. Here, we demonstrate that the onset of sprouting angiogenesis is stiffness-dependent. The presented 2.5D model for quantifying cellular traction forces in sprouting angiogenesis offers a simplified yet physiologically relevant method, enhancing our understanding of cellular responses to mechanical cues, which could advance tissue engineering and therapeutic strategies against tumor angiogenesis.

Sprouting angiogenesis, fundamental for development and disease, involves complex molecular and mechanical processes. We present a versatile 2.5D ex vivo model that analyzes cellular sprouting from porcine carotid arteries, revealing stiffness-dependent angiogenesis and distinct leader-follower cell mechanics. This model aids in advancing tissue engineering strategies and cancer therapy approaches.

Sprouting angiogenesis is the formation of new blood vessels from pre-existing vasculature and is of great importance for physiological such as tissue ...

Visualizing Angiogenesis by Multiphoton Microscopy In Vivo in Genetically Modified 3D-PLGA/nHAp Scaffold for Calvarial Critical Bone Defect Repair

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video