This work was supported by the S&#227;o Paulo Research Foundation (FAPESP; Grant 12/19561-0) and the Max Planck Society. Elias F. Ara&#250;jo (FAPEMIG 14/30594), Carolina C. Monte-Bello (FAPESP; Grant 14/10407-3), Val&#233;ria Mafra (FAPESP; Grant 14/07918-6), and Viviane C. H. da Silva (CAPES/CNPEM 24/2013) are grateful for the fellowships. The authors thank Christian Meyer from the Institut Jean Pierre Bourgin (INRA, Versailles, France) for generously providing antibodies against RPS6. The authors thank RTV UNICAMP and Ed Paulo Aparecido de Souza Manoel for their technical support during the audio recording.

1. Preparation of Liquid and Solid Culture Media
<ol>
	<li>Prepare a liquid medium using half-strength Murashige and Skoog (MS) medium with vitamins [0.0125 mg/L of cobalt(II) chloride pentahydrate, 0.0125 mg/L of copper(II) sulfate pentahydrate, 18.35 mg/L of ethylenediaminetetraacetate ferric sodium, 3.10 mg/L of boric acid, 0.415 mg/L of potassium iodide, 8.45 mg/L of manganese sulfate monohydrate, 0.125 mg/L of sodium molybdate dihydrate, 4.30 mg/L of zinc sulfate heptahydrate, 166.01 mg/L of calcium chloride, 85 mg/L of potassium dihydrogen phosphate, 950 mg/L of potassium nitrate, 90.27 mg/L of magnesium sulfate, 825 mg/L of ammonium nitrate, 1 mg/L of glycine, 50 mg/L of myo-inositol, 0.25 mg/L of nicotinic acid, 0.25 mg/L of pyridoxine hydrochloride, and 0.05 mg/L of thiamine hydrochloride] supplemented with 0.25 g/L of MES, and adjust the pH to 5.8 with 10 M KOH.</li>
	<li>Add 10 g/L of agar to make a half-strength MS-solid medium. Autoclave the medium at 121 &#176;C for 20 min prior to use.</li>
</ol>
2. Hydroponic System Assembling
NOTE: These steps should be followed meticulously to build the hydroponic system.
<ol>
	<li>Material sterilization
	<ol>
		<li>Pack in the autoclave bag the pipette tip racks (without covers) that will be used as minitanks. Autoclave the racks at 121 &#176;C for 20 min, 15 psi. 
		NOTE: The polypropylene pipette tip rack we used had the following dimensions: 120 mm (length) x 89 mm (width) x 55 mm (height). The pipette tip flat surface must have an area for the addition of culture medium. Other tip racks can be used (see Table of Materials). 
		NOTE: Throughout the assembly procedure of the hydroponic system, it is necessary to use a laminar flow hood, which must be cleaned and disinfected with 70% ethanol prior to use. The experimenter must wear a lab coat, wash their hands and any exposed skin, and disinfect them with 70% ethanol. Gloves are optional, except for drug application.</li>
		<li>Clean all the accessories described above (disposable plastic boxes, adhesive tape, pipettes, scissors, and tweezers) with 70% ethanol before entering the laminar flow hood. If the hood allows, turn on the UV light for 10 min prior to the assembling of the hydroponic system in order to keep the work area decontaminated.</li>
	</ol>
	</li>
	<li>Minitank assembling
	<ol>
		<li>Seal the upper surface of the pipette tip flat with adhesive tape (Figure 1B). If possible, leave it under UV light for 10 min.</li>
		<li>Add 180 &#181;L of melted solid MS culture medium (slightly warm) to each well using a multichannel pipette (Figure 1C). 
		NOTE: When preparing many tanks, use a hotplate to prevent the MS medium from solidifying.</li>
		<li>Allow the medium to solidify completely (for about 30 min). 
		NOTE: During the solidification period, the UV light can be turned on.</li>
		<li>Fill up the pipette tip rack completely with liquid MS culture medium (Figure 1D) and ensure there is close contact between the solid and the liquid media.</li>
		<li>Remove the adhesive tapes of the upper surface of the pipette tip flat and fit it on the rack carefully. The hydroponic system is now ready to receive the sterilized seeds.</li>
	</ol>
	</li>
</ol>
3. Seed Sterilization
<ol>
	<li>Place 500 Arabidopsis seeds in a 1.5 mL microtube. Use as many microtubes as necessary according to the number of plants required for the experiment.</li>
	<li>Wash the seeds with 70% ethanol for 2 min with a gentle agitation. Let the seeds settle down, then remove the ethanol carefully.</li>
	<li>Add 1 mL of a 10% sodium hypochlorite solution containing 2 &#181;L of a polysorbate 20 detergent. Agitate the solution for 5 min. Remove the solution carefully.</li>
	<li>Rinse the seeds with sterile distilled water until all the bleach residue is completely removed (approximately 5x). 
	NOTE: After the surface sterilization, the seeds were immersed in sterile distilled water and stratified at 4 &#176;C in the dark for 5 d to synchronize the germination. 
	NOTE: Seeds of Setaria viridis (accession A10.1) were preincubated in concentrated sulfuric acid for 15 min (to break the physical dormancy), washed thoroughly in sterile distilled water, and then disinfested with a 5% sodium hypochlorite solution containing 0.1% polysorbate 20 for 5 min with a gentle agitation21. The remaining sterilization steps were identical to those described for Arabidopsis seeds.</li>
</ol>
4. Seed Application
<ol>
	<li>Cut slightly the extremity of a 200 &#181;L tip with the aid of a sterile scalpel.</li>
	<li>Pipette the Arabidopsis seeds into the solid culture medium on the upper surface of the pipette tip flat. Take care that the medium does not loosen from the flat; otherwise, the seeds will be shaded and the seedlings will not grow properly (Figure 1E). 
	NOTE: Use a sterile tweezer for Setaria seeds (with the embryo positioned upward).</li>
	<li>Store as many minitanks as possible inside a disposable plastic box to maintain a high humidity and keep the environment free from microorganisms (Figure 1F).</li>
	<li>Seal the disposable plastic box thoroughly using adhesive tape to avoid contamination.</li>
	<li>Place the hydroponic systems into a growth chamber with the appropriate growth conditions for the plant of interest. 
	NOTE: In this work, the following conditions were used: 75% of humidity, and 150 &#181;mol m-2 s-1 of irradiance and equinoctial conditions of 12 h light (21 &#176;C)/12 h dark (19 &#176;C) for Arabidopsis, or 300 &#181;mol m-2 s-1 of irradiance and 12 h light (28 &#176;C)/12 h dark (25 &#176;C) for Setaria (Figure&#160;1G and 1H).</li>
</ol>
5. Validating the Use of this Hydroponic System to Inhibit the Target of Rapamycin Kinase
Note: This hydroponic system was initially developed to facilitate the administration of chemicals to plants, which, in general, are very expensive to be applied in large-scale experiments. As a proof of concept, the ATP-competitive inhibitor AZD-8055, which is known to specifically target the ATP binding site of the TOR protein kinase22, was employed to follow the repression of TOR activity in seedlings of A. thaliana Columbia-0 (The Nottingham Arabidopsis Stock Centre, NASC ID: N22681). Here, the protocol used is briefly described.
<ol>
	<li>Grow seeds hydroponically until stage 1.04 according to the BBCH scale23 (for about 11 d) under the climatic conditions described above. Replace the nutrient solution, either with fresh medium containing 0.05% DMSO (control), 2 &#181;M AZD-8055 (TOR inhibitor) diluted in DMSO, or without treatment (mock), at the end of the night (EN).</li>
	<li>Harvest some seedlings at different time points after the treatment and separate them into roots and shoots. Freeze the samples in liquid nitrogen, grind them to a fine powder in a robotic grinder (see Table of Materials), and store the powder at -80 &#176;C until use.</li>
	<li>Immunoblot against phosphorylated and non-phosphorylated forms of 40S ribosomal protein S6 (RPS6) according to Dobrenel et al.24.</li>
	<li>Bleach intact seedlings for sample depigmentation, wash them in distilled water, immerse them in an iodine solution for 5 min25, and photograph the seedlings in a stereomicroscope (0.63X objective, 20x approximation, and 7.5x magnitude) for a qualitative assessment of the starch content.</li>
	<li>Quantify the starch following the enzymatic degradation and measurement of the released glucose spectrophotometrically by coupling it to the reduction of NADP+ to NADPH26,27.</li>
	<li>Perform a total RNA extraction, a cDNA synthesis, and quantitative RT-PCR assays as described by Caldana et al.28 to evaluate the expression level of genes related to different sorts of stresses.</li>
	<li>Optionally, grow seedlings on a horticultural substrate in plastic pots with a 0.1 L capacity under similar climatic conditions [60 % of humidity, 150 &#181;mol m-2 s-1 of irradiance, and equinoctial conditions of 12 h light (21 &#176;C)/12 h dark (19 &#176;C)] in order to compare them with seedlings grown hydroponically. 
	NOTE: The target genes used for the gene expression assays were ABF3 (At4g34000), ASN1 (At3g47340), and TPS5 (At4g17770), and their expression levels were normalized employing the delta-Ct method29 using ACT2 (At3g18780) or PDF2 (At4g04890) as the internal reference genes, assuming 100% of PCR amplification efficiency across all samples. The oligonucleotide pairs used for the quantitative PCR were: ABF3 (GTTCTCAACCTGCAACACAGTGC; TCCAGGAGATACTGCTGCAACC), ASN1 (AGGTGCGGACGAGATCTTTG; GTGAAGAGCCTTGATCTTGC), TPS5 (CTGCTCTGATGCTCCTTCTTCC; AAGCTGGTTTCCAACGATGATG), ACT2 (CGTACAACCGGTATTGTGCTGG; CTCTCTCTGTAAGGATCTTCATG), and PDF2 (TAACGTGGCCAAAATGATGC; GTTCTCCACAACCGCTTGGT).</li>
</ol>

The authors have nothing to disclose.

This optimized hydroponic structure enables the successful in vitro culture of plants. Seeds germinate well on the solid medium at the pipette tip flat surface, a considerable gain in comparison to systems where seeds are soaked with the nutrient solution. A great advantage of this system is that during the seedling development, roots get directly in contact with the liquid medium without the need of transference. Moreover, chemical treatment can be easily applied in the liquid medium in a reduced volume. Humidi...

The advantages of growing plants using hydroponics have been widely recognized in the production of large and uniform plants, enabling reproducible experiments1,2,3. In this system, the composition of the nutritive solution can be properly controlled and recycled along all stages of plant growth and development. Furthermore, roots are not subjected to abiotic stresses, as can happen in soil-grown plants, such as nutrient starvation and water deficiency4. As plants grown hydroponically present morphological and physiological traits fairly similar to the ones cultured in soil, this system has been broadly employed in research because it allows the monitoring of root/shoot growth and their harvesting without injuries2,5.
Due to the possibility of changing the composition and concentration of the nutritive solution, most of the research using hydroponic conditions has been performed to characterize the functions of micro- and macronutrients1,3,6,7,8. However, this system has proved to be very useful to a broad range of applications in plant biology, such as to elucidate the functions of hormones and chemicals in plants. For instance, the discovery of strigolactones as a new class of hormones9 and the accelerated growth phenotype triggered by brassinosteroid application10 were performed under hydroponic conditions. Moreover, this system enables experiments with labeled isotopes (e.g., 14N/15N and 13CO2)11,12 to evaluate their incorporation into proteins and metabolites by mass spectrometry.
Considering the importance of this system in plant research, a high number of hydroponic cultures has been designed in the last few years, including systems that use (i) the transference of seedlings from plates to hydroponic containers3,13; (ii) rockwool that limits access to the early stages of root development2,14,15; (iii) polyethylene granulate as the floating body, which makes the homogeneous application of small molecules/treatments difficult16; or (iv) a reduced number of plants9,17. The volume of hydroponic tanks described in many of those protocols are usually large (small volumes ranging from 1 - 5 L, up to 32 L)18, which makes the application of chemicals extremely expensive. Although few studies do describe a hydroponic cultivation under aseptic conditions8,19, the assembly of the system is usually quite laborious, consisting of the perfect adjustment of nylon meshes into plastic or glass containers5,8,17,20.
Due to the importance of Arabidopsis thaliana as a model plant, the majority of hydroponics systems were designed for this species1,2,8,14,18,19,20. Nevertheless, there are a few studies reporting the hydroponic growth features of other plant species with a pretreatment of seeds to improve their germination and synchronization rates in vitro8,16. In order to work on a large scale, we developed a protocol for setting up a simple and low-cost maintenance hydroponic system that enables sterile conditions for growing plants, including A. thaliana and other species, such as the grass Setaria viridis. The method described here is suitable for different experiments, as the seedling growth can be maximized, synchronized, and easily monitored. Furthermore, this system has many advantages as: (i) its assembly is straightforward and its components can be reused; (ii) it allows the easy application of different chemicals into the liquid medium; (iii) the seedlings germinate and grow directly in the culture medium without the need of transference to the hydroponics system; (iv) the shoot and root development/growth can be closely supervised and the seedlings are harvested without damages; and (v) it makes it possible to work on a large scale, maintaining physiological conditions.

<table><tbody><tr><td>Ethanol</td><td>Merck</td><td>100983</td><td></td></tr><tr><td>Sodium hypochlorite solution</td><td>Sigma-Aldrich</td><td>425044</td><td></td></tr><tr><td>Polysorbate 20&amp;nbsp;&amp;nbsp;</td><td>Sigma-Aldrich</td><td>P2287</td><td></td></tr><tr><td>Murashige and Skoog (MS) medium including vitamins&amp;nbsp;</td><td>Duchefa Biochemie</td><td>M0222</td><td></td></tr><tr><td>2-(&lt;em&gt;N&lt;/em&gt;-morpholino)ethanesulfonic acid (MES) monohydrate</td><td>Duchefa Biochemie</td><td>M1503</td><td></td></tr><tr><td>Agar&amp;nbsp;</td><td>Sigma-Aldrich</td><td>A7921</td><td></td></tr><tr><td>Potassium hydroxide</td><td>Sigma-Aldrich</td><td>484016</td><td></td></tr><tr><td>Laminar flow hood</td><td>Telstar</td><td>BH-100</td><td></td></tr><tr><td>Hotplate</td><td>AREC</td><td>F20510011</td><td></td></tr><tr><td>Growth chamber</td><td>Weiss Technik</td><td>HGC 1514</td><td></td></tr><tr><td>Glass Petri dish (150 mm x 25 mm)</td><td>Uniglass</td><td>189.006</td><td></td></tr><tr><td>200 &amp;mu;L pipette tip racks&amp;nbsp;</td><td>Kasvi</td><td>K8-200-5 *</td><td></td></tr><tr><td>300 &amp;mu;L multichannel pipette</td><td>Eppendorf</td><td>3122000060</td><td></td></tr><tr><td>300 &amp;mu;L pipette tips</td><td>Eppendorf</td><td>30073088</td><td></td></tr><tr><td>200 &amp;mu;L pipette&amp;nbsp;</td><td>Eppendorf</td><td>3120000054</td><td></td></tr><tr><td>200 &amp;mu;L pipette tips</td><td>Eppendorf</td><td>30000870</td><td></td></tr><tr><td>Scissors</td><td>Tramontina</td><td>25912/108</td><td></td></tr><tr><td>Tweezer</td><td>ABC Instrumentos</td><td>702915</td><td></td></tr><tr><td>Scalpel blade</td><td>Sigma-Aldrich</td><td>S2771</td><td></td></tr><tr><td>Adhesive transparent tape (45mm x 50m)</td><td>Scotch 3M</td><td>5803</td><td></td></tr><tr><td>Disposable plastic boxes, external dimensions: 353 mm (L)x 178 mm (W) x 121mm (H)</td><td>Maxipac</td><td>32771</td><td></td></tr></tbody></table>

a flexible low cost hydroponic system for assessing plant responses to small molecules in sterile conditions

A wide range of studies in plant biology are performed using hydroponic cultures. In this work, an in vitro hydroponic growth system designed for assessing plant responses to chemicals and other substances of interest is presented. This system is highly efficient in obtaining homogeneous and healthy seedlings of the C3 and C4 model species Arabidopsis thaliana and Setaria viridis, respectively. The sterile cultivation avoids algae and microorganism contamination, which are known limiting factors for plant normal growth and development in hydroponics. In addition, this system is scalable, enabling the harvest of plant material on a large scale with minor mechanical damage, as well as the harvest of individual parts of a plant if desired. A detailed protocol demonstrating that this system has an easy and low-cost assembly, as it uses pipette racks as the main platform for growing plants, is provided. The feasibility of this system was validated using Arabidopsis seedlings to assess the effect of the drug AZD-8055, a chemical inhibitor of the target of rapamycin (TOR) kinase. TOR inhibition was efficiently detected as early as 30 min after an AZD-8055 treatment in roots and shoots. Furthermore, AZD-8055-treated plants displayed the expected starch-excess phenotype. We proposed this hydroponic system as an ideal method for plant researchers aiming to monitor the action of plant inducers or inhibitors, as well as to assess metabolic fluxes using isotope-labeling compounds which, in general, requires the use of expensive reagents.

The TOR kinase is a major regulator that integrates nutrient and energy signaling to promote cell proliferation and growth in all eukaryotes. Efforts to elucidate TOR functions in plants include the generation of Arabidopsis transgenic lines containing TOR conditional repression through RNA interference or artificial microRNA28,30,31, given the embryo lethal phenotype of TOR knockout pla...

Watch this Scientific Journal Video about A Flexible Low Cost Hydroponic System for Assessing Plant Responses to Small Molecules in Sterile Conditions at JoVE.com

A Flexible Low Cost Hydroponic System for Assessing Plant Responses to Small Molecules in Sterile Conditions

A simple, versatile, and low-cost in vitro hydroponic system was successfully optimized, enabling large-scale experiments under sterile conditions. This system facilitates the application of chemicals in a solution and their efficient absorption by roots for molecular, biochemical, and physiological studies.

A wide range of studies in plant biology are performed using hydroponic cultures. In this work, an in vitro hydroponic growth system designed for ...

a-flexible-low-cost-hydroponic-system-for-assessing-plant-responses

Research

JoVE Journal

Environment

10.5K Views.  Brazilian Center for Research in energy and materials (CNPEM). Een eenvoudige, veelzijdige en goedkope in vitro hydrocultuur systeem werd met succes geoptimaliseerd, inschakelen van grootschalige experimenten onder steriele omstandigheden. Dit systeem vergemakkelijkt de toepassing van chemische stoffen in een oplossing en hun efficiënte absorptie door wortels voor moleculaire, biochemische en fysiologische studies.

Video: A Flexible Low Cost Hydroponic System for Assessing Plant Responses to Small Molecules in Sterile Conditions

Methods for Performing Crosses in Setaria viridis, a New Model System for the Grasses

Setaria viridis is an emerging model system for C4 grasses. It is closely related to the bioenergy feed stock switchgrass and the grain crop foxtail millet. Recently, the 510 Mb genome of foxtail millet, S. italica, has been sequenced 1,2 and a 25x coverage genome sequence of the weedy relative S. viridis is in progress. S. viridis has a number of characteristics that make it a potentially excellent model genetic system including a rapid generation time, small stature, simple growth requirements, prolific seed production 3 and developed systems for both transient and stable transformation 4. However, the genetics of S. viridis is largely unexplored, in part, due to the lack of detailed methods for performing crosses. To date, no standard protocol has been adopted that will permit rapid production of seeds from controlled crosses.
The protocol presented here is optimized for performing genetic crosses in S. viridis, accession A10.1. We have employed a simple heat treatment with warm water for emasculation after pruning the panicle to retain 20-30 florets and labeling of flowers to eliminate seeds resulting from newly developed flowers after emasculation. After testing a series of heat treatments at permissive temperatures and varying the duration of dipping, we have established an optimum temperature and time range of 48 &deg;C for 3-6 min. By using this method, a minimum of 15 crosses can be performed by a single worker per day and an average of 3-5 outcross progeny per panicle can be recovered. Therefore, an average of 45-75 outcross progeny can be produced by one person in a single day. Broad implementation of this technique will facilitate the development of recombinant inbred line populations of S. viridis X S. viridis or S. viridis X S. italica, mapping mutations through bulk segregant analysis and creating higher order mutants for genetic analysis.

Methods for Performing Crosses in Setaria viridis, a New Model System for the Grasses

We have developed a methodology for performing crosses in Setaria viridis (S. viridis). The method involves pruning the panicle prior to a hot water treatment to kill viable pollen. Crosses are performed following a well-controlled growth regime and typically result in the recovery of 1 to 7 cross-pollinated seed/s per panicle.

Setaria viridis is an emerging model system for C4 grasses. It is closely related to the bioenergy feed stock switchgrass and the grain crop foxtail ...

A Simple Chamber for Long-term Confocal Imaging of Root and Hypocotyl Development

Several aspects of plant development, such as lateral root morphogenesis, occur on time spans of several days. To study underlying cellular and subcellular processes, high resolution time-lapse microscopy strategies that preserve physiological conditions are required. Plant tissues must have adequate nutrient and water supply with sustained gaseous exchange but, when submerged and immobilized under a coverslip, they are particularly susceptible to anoxia. One strategy that has been successfully employed is the use of a perfusion system to maintain a constant supply of oxygen and nutrients. However, such arrangements can be complicated, cumbersome, and require specialized equipment. Presented here is an alternative strategy for a simple imaging system using perfluorodecalin as an immersion medium. This system is easy to set up, requires minimal equipment, and is easily mounted on a microscope stage, allowing several imaging chambers to be set up and imaged in parallel. In this system, lateral root growth rates are indistinguishable from growth rates under standard conditions on agar plates for the first two days, and lateral root growth continues at reduced rates for at least another day. Plant tissues are supplied with nutrients via an agar slab that can be used also to administer a range of pharmacological compounds. The system was established to monitor lateral root development but is readily adaptable to image other plant organs such as hypocotyls and primary roots.

Presented here is a simple technique for high-resolution confocal time-lapse imaging of root and hypocotyl development for up to 3 days using high numerical-aperture objectives and perfluorodecalin as an immersion medium.

Several aspects of plant development, such as lateral root morphogenesis, occur on time spans of several days. To study underlying cellular and ...

Developmental Biology

Monitoring Plant Hormones During Stress Responses

Plant hormones and related signaling compounds play an important role in the regulation of plant responses to various environmental stimuli and stresses. Among the most severe stresses are insect herbivory, pathogen infection, and drought stress. For each of these stresses a specific set of hormones and/or combinations thereof are known to fine-tune the responses, thereby ensuring the plant's survival. The major hormones involved in the regulation of these responses are jasmonic acid (JA), salicylic acid (SA), and abscisic acid (ABA). To better understand the role of individual hormones as well as their potential interaction during these responses it is necessary to monitor changes in their abundance in a temporal as well as in a spatial fashion. For the easy, sensitive, and reproducible quantification of these and other signaling compounds we developed a method based on vapor phase extraction and gas chromatography/mass spectrometry (GC/MS) analysis (1, 2, 3, 4). After extracting these compounds from the plant tissue by acidic aqueous 1-propanol mixed with dichloromethane the carboxylic acid-containing compounds are methylated, volatilized under heat, and collected on a polymeric absorbent. After elution into a sample vial the analytes are separated by gas chromatography and detected by chemical ionization mass spectrometry. The use of appropriate internal standards then allows for the simple quantification by relating the peak areas of analyte and internal standard.

A simple method is provided that allows for the rapid extraction and analysis of multiple plant hormones from small tissue samples. The procedure uses vapor phase extraction as the solemn purification step. Samples are analyzed by GC/MS with chemical ionization that produces mainly (M+1)+ ions.

Plant hormones and related signaling compounds play an important role in the regulation of plant responses to various environmental stimuli and stresses. ...

Biology

A Telemetric, Gravimetric Platform for Real-Time Physiological Phenotyping of Plant&ndash;Environment Interactions

Food security for the growing global population is a major concern. The data provided by genomic tools far exceeds the supply of phenotypic data, creating a knowledge gap. To meet the challenge of improving crops to feed the growing global population, this gap must be bridged.
Physiological traits are considered key functional traits in the context of responsiveness or sensitivity to environmental conditions. Many recently introduced high-throughput (HTP) phenotyping techniques are based on remote sensing or imaging and are capable of directly measuring morphological traits, but measure physiological parameters mainly indirectly.
This paper describes a method for direct physiological phenotyping that has several advantages for the functional phenotyping of plant&#8211;environment interactions. It helps users overcome the many challenges encountered in the use of load-cell gravimetric systems and pot experiments. The suggested techniques will enable users to distinguish between soil weight, plant weight and soil water content, providing a method for the continuous and simultaneous measurement of dynamic soil, plant and atmosphere conditions, alongside the measurement of key physiological traits. This method allows researchers to closely mimic field stress scenarios while taking into consideration the environment&#8217;s effects on the plants&#8217; physiology. This method also minimizes pot effects, which are one of the major problems in pre-field phenotyping. It includes a feed-back fertigation system that enables a truly randomized experimental design at a field-like plant density. This system detects the soil-water-content limiting threshold (&#952;) and allows for the translation of data into knowledge through the use of a real-time analytic tool and an online statistical resource. This method for the rapid and direct measurement of the physiological responses of multiple plants to a dynamic environment has great potential for use in screening for beneficial traits associated with responses to abiotic stress, in the context of pre-field breeding and crop improvement.

A Telemetric, Gravimetric Platform for Real-Time Physiological Phenotyping of Plant&#8211;Environment Interactions

This high-throughput, telemetric, whole-plant water relations gravimetric phenotyping method enables direct and simultaneous real-time measurements, as well as the analysis of multiple yield-related physiological traits involved in dynamic plant&#8211;environment interactions.

Food security for the growing global population is a major concern. The data provided by genomic tools far exceeds the supply of phenotypic data, creating ...

Rhizobacterial Colonization Detection on Arabidopsis thaliana

Measuring Bacterial Colonization on Arabidopsis thaliana Roots in Hydroponic Condition

Measuring bacterial colonization on Arabidopsis thaliana root is one of the most frequent experiments in plant-microbe interaction studies. A standardized method for measuring bacterial colonization in the rhizosphere is necessary to improve reproducibility. We first cultured sterile A.thaliana in hydroponic conditions and then inoculated the bacterial cells in the rhizosphere at a final concentration of OD600 of 0.01. At 2 days post-inoculation, the root tissue was harvested and washed three times in sterile water to remove the uncolonized bacterial cells. The roots were then weighed, and the bacterial cells colonized on the root were collected by vortex. The cell suspension was diluted in a gradient with a phosphate-buffered saline (PBS) buffer, followed by plating onto a Luria-Bertani (LB) agar medium. The plates were incubated at 37 &#176;C for 10 h, and then, the single colonies on LB plates were counted and normalized to indicate the bacterial cells colonized on roots. This method is used to detect bacterial colonization in the rhizosphere in mono-interaction conditions, with good reproducibility.

Author Spotlight: Enhancing Rhizobacteria Colonization on Plant Roots for Improved Microbial Fertilizer Efficiency

Colonization of plant growth-promoting rhizobacteria (PGPR) in the rhizosphere is essential for its growth-promoting effect. It is necessary to standardize the method of detection of bacterial rhizosphere colonization. Here, we describe a reproducible method for quantifying bacterial colonization on the root surface.

Measuring bacterial colonization on Arabidopsis thaliana root is one of the most frequent experiments in plant-microbe interaction studies. A standardized ...

Monitoring Bacterial Colonization and Maintenance on Arabidopsis thaliana Roots in a Floating Hydroponic System

Bacteria form complex rhizosphere microbiomes shaped by interacting microbes, larger organisms, and the abiotic environment. Under laboratory conditions, rhizosphere colonization by plant growth-promoting bacteria (PGPB) can increase the health or the development of host plants relative to uncolonized plants. However, in field settings, bacterial treatments with PGPB often do not provide substantial benefits to crops. One explanation is that this may be due to loss of the PGPB during interactions with endogenous soil microbes over the lifespan of the plant. This possibility has been difficult to confirm, since most studies focus on the initial colonization rather than maintenance of PGPB within rhizosphere communities. It is hypothesized here that the assembly, coexistence, and maintenance of bacterial communities are shaped by deterministic features of the rhizosphere microenvironment, and that these interactions may impact PGPB survival in native settings. To study these behaviors, a hydroponic plant-growth assay is optimized using Arabidopsis thaliana to quantify and visualize the spatial distribution of bacteria during initial colonization of plant roots and after transfer to different growth environments. This system&#8217;s reproducibility and utility are then validated with the well-studied PGPB Pseudomonas simiae. To investigate how the presence of multiple bacterial species may affect colonization and maintenance dynamics on the plant root, a model community from three bacterial strains (an Arthrobacter, Curtobacterium, and Microbacterium species) originally isolated from the A. thaliana rhizosphere is constructed. It is shown that the presence of these diverse bacterial species can be measured using this hydroponic plant-maintanence assay, which provides an alternative to sequencing-based bacterial community studies. Future studies using this system may improve the understanding of bacterial behavior in multispecies plant microbiomes over time and in changing environmental conditions.

Monitoring Bacterial Colonization and Maintenance on Arabidopsis thaliana Roots in a Floating Hydroponic System

Here we describe a hydroponic plant growth assay to quantify species presence and visualize the spatial distribution of bacteria during initial colonization of plant roots and after their transfer into different growth environments.

Bacteria form complex rhizosphere microbiomes shaped by interacting microbes, larger organisms, and the abiotic environment. Under laboratory conditions, ...

Immunology and Infection

Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements

Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition.
This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient.
The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

Here, we present an easy-to-follow protocol to establish a successful hydroponic system for plant nutrition studies. This protocol has been extensively tested in Arabidopsis and can easily be adapted to other plant species to study specific nutritional requirements or the effect of non-essential elements on plant growth and development.

Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several ...

A Hydroponic Co-cultivation System for Simultaneous and Systematic Analysis of Plant/Microbe Molecular Interactions and Signaling

An experimental design mimicking natural plant-microbe interactions is very important to delineate the complex plant-microbe signaling processes. Arabidopsis thaliana-Agrobacterium tumefaciens provides an excellent model system to study bacterial pathogenesis and plant interactions. Previous studies of plant-Agrobacterium interactions have largely relied on plant cell suspension cultures, the artificial wounding of plants, or the artificial induction of microbial virulence factors or plant defenses by synthetic chemicals. However, these methods are distinct from the natural signaling in planta, where plants and microbes recognize and respond in spatial and temporal manners. This work presents a hydroponic cocultivation system where intact plants are supported by metal mesh screens and cocultivated with Agrobacterium. In this cocultivation system, no synthetic phytohormone or chemical that induces microbial virulence or plant defense is supplemented. The hydroponic cocultivation system closely resembles natural plant-microbe interactions and signaling homeostasis in planta. Plant roots can be separated from the medium containing Agrobacterium, and the signaling and responses of both the plant hosts and the interacting microbes can be investigated simultaneously and systematically. At any given timepoint/interval, plant tissues or bacteria can be harvested separately for various &#34;omics&#34; analyses, demonstrating the power and efficacy of this system. The hydroponic cocultivation system can be easily adapted to study: 1) the reciprocal signaling of diverse plant-microbe systems, 2) signaling between a plant host and multiple microbial species (i.e.&#160;microbial consortia or microbiomes), 3) how nutrients and chemicals are implicated in plant-microbe signaling, and 4) how microbes interact with plant hosts and contribute to plant tolerance to biotic or abiotic stresses.

The described hydroponic cocultivation system supports intact plants with metal mesh screens and cocultivates them with bacteria. Plant tissue, bacteria, and secreted molecules can then be separately harvested for downstream analyses, simultaneously allowing for the molecular responses of both plant hosts and interacting microbes or microbiomes to be investigated.

An experimental design mimicking natural plant-microbe interactions is very important to delineate the complex plant-microbe signaling processes. ...

Identification of Novel Regulators of Plant Transpiration by Large-Scale Thermal Imaging Screening in Helianthus Annuus

Plant adaptation to biotic and abiotic stresses is governed by a variety of factors, among which the regulation of stomatal aperture in response to water deficit or pathogens plays a crucial role. Identifying small molecules that regulate stomatal movement can therefore contribute to understanding the physiological basis by which plants adapt to their environment. Large-scale screening approaches that have been used to identify regulators of stomatal movement have potential limitations: some rely heavily on the abscisic acid (ABA) hormone signaling pathway, therefore excluding ABA-independent mechanisms, while others rely on the observation of indirect, long-term physiological effects such as plant growth and development. The screening method presented here allows the large-scale treatment of plants with a library of chemicals coupled with a direct quantification of their transpiration by thermal imaging. Since evaporation of water through transpiration results in leaf surface cooling, thermal imaging provides a non-invasive approach to investigate changes in stomatal conductance over time. In this protocol, Helianthus annuus seedlings are grown hydroponically and then treated by root feeding, in which the primary root is cut and dipped into the chemical being tested. Thermal imaging followed by statistical analysis of cotyledonary temperature changes over time allows for the identification of bioactive molecules modulating stomatal aperture. Our proof-of-concept experiments demonstrate that a chemical can be carried from the cut root to the cotyledon of the sunflower seedling within 10 minutes. In addition, when plants are treated with ABA as a positive control, an increase in leaf surface temperature can be detected within minutes. Our method thus allows the efficient and rapid identification of novel molecules regulating stomatal aperture.

Identification of Novel Regulators of Plant Transpiration by Large-Scale Thermal Imaging Screening in Helianthus Annuus

We provide a method for identifying modulators of foliar transpiration by large-scale screening of a compound library.

Plant adaptation to biotic and abiotic stresses is governed by a variety of factors, among which the regulation of stomatal aperture in response to water ...

Semihydroponic Glass Jar System for Exudate Analysis in Multiple Plant Species

A Versatile Glass Jar System for Semihydroponic Root Exudate Profiling

Root exudates shape the plant-soil interface, are involved in nutrient cycling&#160;and modulate interactions with soil organisms. Root exudates are dynamic and shaped by biological, environmental, and experimental conditions. Due to their wide diversity and low concentrations, accurate exudate profiles are challenging to determine, even more so in natural environments where other organisms are present, turning over plant-derived compounds and producing additional compounds themselves. The semihydroponic glass jar experimental system introduced here allows control over biological, environmental, and experimental factors. It allows the growth of various phylogenetically distinct plant species for up to several months with or without microbes, in a variety of different growth media. The glass-based design offers a low metabolite background for high sensitivity and low environmental impact as it can be reused. Exudates can be sampled nondestructively, and conditions can be altered over the course of an experiment if desired. The setup is compatible with mass spectrometry analytics and other downstream analytical procedures. In summary, we present a versatile growth system suited for sensitive root exudate analysis in a variety of conditions.

Author Spotlight: Exploring Plant-Microbe Interactions Through Root Exudates in a Novel Growth System 

We present a protocol for a glass-based, semihydroponic experimental system supporting the growth of a variety of phylogenetically distinct plants with or without microbes. The system is compatible with different growth media and permits nondestructive root exudate sampling for downstream analysis.

Root exudates shape the plant-soil interface, are involved in nutrient cycling&#160;and modulate interactions with soil organisms. Root exudates are ...

A Flexible Low Cost Hydroponic System for Assessing Plant Responses to Small Molecules in Sterile Conditions

Samenvatting

Meer video's verkennen