This work was supported by the new faculty startup funds from North Carolina State University for Guozhou Xu.

NOTE: An insect cell/baculovirus system with modified expression vectors for secretory plant protein expression and crystallization is used.
1. Modification of a Baculovirus Expression Vector with the GP67 Signal Peptide for Plant Protein Secretion Expression
<ol>
	<li>Synthesize a DNA fragment containing a 5&#39; BglII cutting site13, the GP67 secretion signal sequence, and a multi-cloning site with NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI, and XhoI (Figure 1A). 
	NOTE: Since both BglII and BamHI digested DNA resulted in the same adhesive ends, the linearized vector can ligate to the digested DNA fragment while both the BglII and BamHI sites in the annealed ligation sequence will be mutated to a sequence that is not cleavable by either BglII or BamHI14.</li>
	<li>Digest 4 &#181;g of the DNA with BglII and XhoI, and 4 &#181;g of an expression vector DNA with BamHI and XhoI14. Mix 10 units of each restriction enzyme with the DNA in a 1x concentration reaction buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, and 100 &#181;g/mL BSA, pH 7.9 at 25 &#176;C) and incubate the mixture at 37 &#176;C for 4 h.
	<ol>
		<li>Purify the excised DNA fragment and the linearized vector DNA by a DNA gel extraction kit15.</li>
	</ol>
	</li>
	<li>Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-&#181;L ligation reaction mixture containing 1x T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, and 10 mM DTT, pH 7.5 at 25 &#176;C) and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 &#176;C for 16 h.</li>
	<li>Transform 5 &#181;L of the ligation mixture into 100 &#181;L of DH5&#945; competent cells following a standard transformation protocol and select the resulting colonies on an ampicillin-LB agar plate16. Pick up 5 - 10 colonies and grow each colony in 2 mL of LB medium containing 100 &#181;g/mL ampicillin at 220 rpm and 37 &#176;C in a shaking incubator for 16 h.</li>
	<li>Extract each plasmid DNA with a DNA miniprep kit17 and confirm the clones by DNA sequencing with a primer AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-amplify the A. thaliana TDR gene fragment encoding residues 30 - 642 from a synthetic TDR gene construct (forward primer: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, reverse primer: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplify the DNA for 30 cycles in a DNA polymerase reaction buffer containing a 0.5 mM dNTP mix, 0.2 &#181;M primers, 0.1 &#181;g of template DNA, 0.4 mM MgCl2, and 1 reaction unit of the DNA polymerase.
	<ol>
		<li>For the PCR cycle steps, set the initial denaturation at 95 &#176;C for 30 s, and then 30 cycles of denaturation at 95 &#176;C for 30 s, annealing at 55 &#176;C for 30 s, and extension at 72 &#176;C for 1 min, with a final extension at 72 &#176;C for 5 min.</li>
	</ol>
	</li>
	<li>Digest both the PCR fragment and the modified vector with NotI and BamHI restriction endonuclease enzymes. Ligate the gene fragment with the linearized vector. Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-&#181;L ligation reaction mixture containing T4 DNA ligase reaction buffer and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 &#176;C for 16 h.</li>
	<li>Transform 5 &#181;L of the ligation mixture into 100 &#181;L of DH5&#945; competent cells following a standard transformation protocol and select the resulting colonies on an ampicillin-LB agar plate16. Confirm the correct clones by DNA sequencing.</li>
</ol>
2. Modification of a Baculovirus Expression Vector with the Insect Hemolin Signal Peptide for Plant Protein Secretion Expression
<ol>
	<li>Synthesize a DNA fragment containing a 5&#39; BglII cutting site13, the insect hemolin secretion signal sequence, and a multi-cloning site with NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI, and XhoI (Figure 1B).</li>
	<li>Digest 4 &#181;g of the DNA with BglII and XhoI, and 4 &#181;g of an expression vector DNA with BamHI and XhoI14. Mix 10 units of each restriction enzyme with the DNA in a 1x concentration reaction buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, and 100 &#181;g/mL BSA, pH 7.9 at 25 &#176;C) and incubate the mixture at 37 &#176;C for 4 h.
	<ol>
		<li>Purify the excised DNA fragment and the linearized vector DNA by a DNA gel extraction kit15.</li>
	</ol>
	</li>
	<li>Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-&#181;L ligation reaction mixture containing 1x T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, and 10 mM DTT, pH 7.5 at 25 &#176;C) and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 &#176;C for 16 h.</li>
	<li>Transform 5 &#181;L of the ligation mixture into 100 &#181;L of DH5&#945; competent cells and select the colonies on an ampicillin-LB agar plate. Pick up 5 - 10 colonies and grow each colony in a 2-mL LB medium containing 100 &#181;g/mL of ampicillin at 220 rpm and 37 &#176;C in a shaking incubator for 16 h.</li>
	<li>Extract plasmid DNA with a DNA miniprep kit17 and confirm the clones by DNA sequencing with a primer AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-amplify A. thaliana Pollen Receptor Kinase 3 (PRK3) gene fragment encoding residues 20 - 237 from a synthetic PRK3 gene construct (forward primer: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, reverse primer: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplify the DNA for 30 cycles in a DNA polymerase reaction buffer containing a 0.5 mM dNTP mix, 0.2 &#181;M primers, 0.1 &#181;g of template DNA, 0.4 mM MgCl2, and 1 reaction unit of the DNA polymerase.
	<ol>
		<li>For the PCR cycle steps, set the initial denaturation at 95 &#176;C for 30 s, and then 30 cycles of denaturation at 95 &#176;C for 30 s, annealing at 55 &#176;C for 30 s, and extension at 72 &#176;C for 30 s within each cycle, and the final extension at 72 &#176;C for 5 min.</li>
	</ol>
	</li>
	<li>Digest both the PCR fragment and the modified vector with NotI and BamHI restriction endonuclease enzymes. Ligate the gene fragment with the linearized vector. Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-&#181;L ligation reaction mixture containing T4 DNA ligase reaction buffer and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 &#176;C for 16 h.</li>
	<li>Transform 5 &#181;L of the ligation mixture into 100 &#181;L of DH5&#945; competent cells following a standard transformation protocol and select the resulting colonies on an ampicillin-LB agar plate16. Confirm the correct clones by DNA sequencing.</li>
</ol>
3. Production and Amplification of Baculovirus Constructs Harboring the Recombinant Protein Expression Cassette
<ol>
	<li>Use 100 ng of the construct plasmid to transform 40 &#181;L of DH10Bac competent cells following the protocol of the baculovirus expression system1. Incubate the transformation plates at 37 &#176;C for 48 h.</li>
	<li>Pick up two white colonies from each transformation plate, inoculate each colony into 2 mL of LB medium containing 50 &#181;g/mL kanamycin, 7 &#181;g/mL gentamicin, and 10 &#181;g/mL tetracycline. Follow the protocol of the baculovirus expression system1 to extract and verify the bacmid DNA. Aliquot each DNA in two tubes with 20 &#181;L each, and store the tubes at -20 &#176;C. 
	NOTE: The following steps require an aseptic operation.</li>
	<li>Grow a monolayer of Sf9 cells in the culture media with 10% fetal bovine serum (FBS) and 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics at 27 &#176;C to 80% confluence in a 6-well plate. Estimate the percentage of confluence based on the percentage of covered area on the tissue culture plate.</li>
	<li>Prepare the following solutions in two sterile 1.5-mL centrifuge tubes.
	<ol>
		<li>Tube 1: For each transfection, dilute 20 &#181;L of bacmid DNA into 100 &#181;L of unsupplemented Sf9 cell culture medium without antibiotics. Mix the dilution gently by flicking the side of the tube.</li>
		<li>Tube 2: For each transfection, dilute 8 &#181;L of lipid transfection reagent into 100 &#181;L of unsupplemented Sf9 cell culture medium without antibiotics. Mix the dilution thoroughly by pipetting up and down for 6x.</li>
	</ol>
	</li>
	<li>Combine the two solutions, mix them gently by pipetting slowly up and down for 3x, and incubate them for 20 - 40 min at room temperature.</li>
	<li>Wash each well of the Sf9 monolayer cells 2x with 3 mL of unsupplemented Sf9 cell culture medium without antibiotics. For each transfection, add 0.8 mL of unsupplemented Sf9 cell culture medium without antibiotics to each tube containing the lipid-DNA mixture. Mix the contents of the tubes gently by pipetting slowly up and down for 3x. Aspirate the wash media from the plates and overlay the samples with the transfection mixture.</li>
	<li>After the addition of the transfection mixture, incubate the transfected plate for 5 h at 27 &#176;C. Replace the transfection media with the complete Sf9 cell culture medium containing 10% FBS and 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics. Incubate the transfected plate at 27 &#176;C for 4 d.</li>
	<li>Harvest and amplify the recombinant baculovirus.
	<ol>
		<li>Collect the supernatant of the infected plate in a sterile 15-mL conical tube after 4 d of incubation. Spin the supernatant at 1010 x g for 5 min to remove the cell debris. Discard the pellet and decant the supernatant to a clean tube and store it at 4 &#176;C for up to 1 year. 
		NOTE: This is the P0 virus. It can be aliquoted and stored at -80 &#176;C for a longer period of time.</li>
		<li>To amplify each recombinant virus, grow a monolayer of Sf9 cells on a 150-mm plate to 80% confluence. Aspirate the media from the plate, add 2 mL of the P0 virus to the cells adherent to the plate and incubate the plate for 1 h in a 27 &#176;C incubator. Rock the plate every 15 min to mix the medium with the cells.
		<ol>
			<li>Add 25 mL of complete Grace&#39;s media containing 10% FBS and 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics. Incubate the plate for 3 d in a 27 &#176;C incubator to obtain the P1 passage virus.</li>
		</ol>
		</li>
		<li>Collect the supernatant of the infected plate in a sterile 50-mL conical tube and spin at 1010 x g for 5 min to remove the cell debris. Decant the supernatant to a clean tube and store it at 4 &#176;C for up to 1 year. 
		NOTE: The P1 virus can be aliquoted and stored at -80 &#176;C for a longer period of time.</li>
		<li>To amplify the virus from P1 to P2 passage, grow a monolayer of Sf9 cells on a 150-mm plate to 90% confluence, aspirate the media of the plate, add 2 mL of the P1 virus to the plate, and incubate it for 1 h in a 27 &#176;C incubator.</li>
		<li>Repeat steps 3.8.2 and 3.8.3 to obtain the P2 and P3 passages of the viruses. Do not store the P3 virus for more than 2 months.</li>
	</ol>
	</li>
</ol>
4. Protein Expression, Purification with NiNTA, and Crystallization
<ol>
	<li>Culture 1 L of Hi5 insect cells in the culture media with 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics to a density of 2 x 106 at 100 rpm in a 27 &#176;C incubator shaker. Spin down the cells at 570 x g for 5 min, decant the supernatant, resuspend the cells in 20 mL of the freshly produced P3 virus, and keep it at room temperature for 1 h. Gently shake the spin bottle to resuspend the cells 1x every 15 min.</li>
	<li>Transfer the cells to 1 L of culture media with 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics, culture the cells at 100 rpm in a 27 &#176;C incubator shaker for 72 h. Spin down the cells at 1,010 x g for 5 min and collect the supernatant.</li>
	<li>Use pH indicator strips to adjust the pH of the supernatant to 8.0 by adding either 0.1 M HCl or 0.1 M NaOH and add binding buffer at a final concentration, containing 20 mM Tris buffer at pH 8.0, 100 mM NaCl, and 5 mM imidazole. Add a certain amount of NiNTA resin (10 - 40 mL) based on the estimated yield of the expressed His-tagged recombinant protein.
	<ol>
		<li>Mix the solution on a magnetic stir with low speed at 4 &#176;C for 1 h. Wash the resin and elute the bound protein following the standard NiNTA purification protocol18.</li>
	</ol>
	</li>
	<li>Subject the purified protein to ion exchange and gel filtration chromatography, as well as other protein purification methods, to yield a homogeneous sample. 
	NOTE: For the TDR ectodomain, 20 mM Tris, pH 8, 100 mM NaCl were used as gel filtration buffer. For the PRK3 ectodomain, 20 mM bis-Tris, pH 6, 100 mM NaCl were used as the preferred gel filtration buffer.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

The authors have nothing to disclose.

Given the diversity in size and stability of the thousands of proteins present in the biological systems, it is often empirical for a research laboratory to decide which heterologous expression system has to be chosen for the expression of a specific protein. The E. coli expression system is often the first choice for protein expression due to the short life cycle of the bacteria, low cost of the culture media, and relative ease to scale up19. For the expression of large eukaryotic protei...

It is imperative for a research laboratory to be capable of producing large quantities of homogeneous recombinant proteins for biochemical and biophysical characterizations, especially for X-ray crystallographic studies. There are many well-established heterologous expression systems such as Escherichia coli, yeast, insect cells, mammalian cells, plant cells, etc. Among them, the baculovirus-mediated insect cell expression system is one of the most commonly used techniques to produce large quantities of structurally folded large-sized recombinant eukaryotic proteins for protein crystallization1.
The expression vectors of the baculovirus expression system are engineered to contain a strong polyhedrin or P10 promoter to produce a high yield of recombinant intracellular proteins2,3. To make a recombinant baculovirus, the gene of interest is cloned into an insect vector containing the polyhedrin (polh) locus of the Autographa californica multi-nucleopolyhedroviral genome. The resulting construct is then sequenced and its correct open reading frame (ORF) is verified. The correct construct is then introduced into the host insect cell through the process of transfection. The gene of interest is inserted into the viral genome by homologous recombination. This event results in the production of the recombinant viral genome, which then replicates to produce recombinant budded virus particles1.
The insect cells that are most commonly used in the expression system are Sf9 and High Five (Hi5) cells. Sf9 cells are a clonal isolate of Sf21, derived from the pupal ovarian cells of Spodoptera frugiperda, and Hi5 cells are a clonal isolate derived from the parental Trichoplusia ni ovarian cell line TN-3684,5. Co-transfections, virus amplification, and plaque assays are conducted on Sf9 cells, while Hi5 cells are typically selected to produce higher quantities of recombinant proteins6. It is worth noting that the Hi5 cells are not suitable for the generation and amplification of virus progenies because of their tendency to produce mutant viruses. Traditionally, a temperature range of 25 - 30 &#176;C is considered to be good for the cultivation of insect cells. However, it has been reported that 27 - 28 &#176;C is the optimal temperature for the insect cell growth and infection7,8.
The introduction of a strong signal sequence preceding the gene is needed for the high expression of the secreted proteins. The signal sequence would efficiently guide the translated recombinant protein into the endoplasmic reticulum for protein secretion and post-translational modifications necessary for proper folding and stabilization3. Signal peptide sequences, such as the baculovirus envelop protein GP64/67, honeybee melittin, and others, have been chosen to facilitate the expression of secretory recombinant proteins in the baculovirus-mediated expression systems3. The introduction of the signal peptide of GP67 has been shown to improve the expression yield of a secreted recombinant protein, in comparison to using the intrinsic signal peptide of the target gene9. Hemolin is a hemolymph protein of the giant silk moth Hyalophora cecropia, induced upon bacteria infection10. Due to the relatively high level of induced expression, the signal peptide sequence of the gene can be used to mediate the secretion expression of the recombinant proteins in the baculovirus-insect cell system.
The A. thaliana Tracheary Element Differentiation Inhibitory Factor Receptor (TDR) and Pollen Receptor Kinase 3 (PRK3) both belong to the plant Leucine-rich Repeat Receptor-like Kinase (LRR-RLK) family of proteins11,12. In order to study the structure and function of this family of plant receptor proteins, as well as to facilitate the structural and biochemical characterization of other plant secreted proteins, the baculovirus-insect cell expression system has been modified to improve protein quality and production yield. The extracellular domains of both TDR and PRK3 have successfully been expressed using two modified expression vectors in the baculovirus-insect cell expression system. Both the extracellular domains of TDR and PRK3 proteins have been crystallized. This article reports the expression and purification of large amounts of recombinant secreted plant proteins with two modified baculovirus expression vectors by incorporating either a GP67 or a hemolin signal sequence between the promoter and multiple cloning sites.

<table><tbody><tr><td>Incubator shaker</td><td>VWR</td><td>Model Excella E25</td><td>27 &lt;sup&gt;o&lt;/sup&gt;C</td></tr><tr><td>Incubator</td><td>VWR</td><td>Model 2005</td><td>27 &lt;sup&gt;o&lt;/sup&gt;C</td></tr><tr><td>Centrifuge</td><td>BECKMAN</td><td>Model J-6</td><td>with a swing bucket rotor</td></tr><tr><td>Herculase II Fusion DNA Polymerase</td><td>Agilent</td><td>600677-51</td><td>For PCR amplification of DNA</td></tr><tr><td>Thermal Cycler</td><td>BIO-RAD</td><td>Model C1000 Touch</td><td>For PCR amplification of DNA</td></tr><tr><td>Incubator shaker</td><td>New Brunswick Scientific</td><td>Model I 24</td><td>For growing baceria culture</td></tr><tr><td>Customer DNA synthesis</td><td>GENSCRIPT</td><td></td><td></td></tr><tr><td>BamHI (HF)</td><td>New England Biolabs</td><td>R3136S</td><td>Restriction Endonuclease</td></tr><tr><td>BglII</td><td>New England Biolabs</td><td>R0144S</td><td>Restriction Endonuclease</td></tr><tr><td>NotI (HF)</td><td>New England Biolabs</td><td>R3189S</td><td>Restriction Endonuclease</td></tr><tr><td>XhoI</td><td>New England Biolabs</td><td>R0146S</td><td>Restriction Endonuclease</td></tr><tr><td>T4 DNA ligase</td><td>New England Biolabs</td><td>M0202T</td><td>DNA ligation</td></tr><tr><td>QIAquick Gel Extraction Kit</td><td>Qiagen</td><td>28704</td><td>DNA purification from Agorase gel</td></tr><tr><td>QIAprep Spin Miniprep Kit</td><td>Qiagen</td><td>27104</td><td>Plasmid DNA purification from bacteria culture</td></tr><tr><td>Agarose</td><td>Thermo Fisher Scientific</td><td>15510-019</td><td>For DNA gel electropherosis</td></tr><tr><td>MAX Efficiency DH5&amp;alpha; competen cell</td><td>Invitrogen</td><td>18-258-012</td><td>For transformation of DNA ligation mixture</td></tr><tr><td>Lennox L LB Broth</td><td>Research Product International Corp.</td><td>L24066-5000.0</td><td>For making bacteria culture</td></tr><tr><td>Ampicillin sodium salt</td><td>Thermo Fisher Scientific</td><td>11593-019</td><td>Antibiotics</td></tr><tr><td>Kanamycin Sulfate</td><td>Thermo Fisher Scientific</td><td>15160-054</td><td>Antibiotics</td></tr><tr><td>Tetracycline</td><td>Thermo Fisher Scientific</td><td>64-75-5</td><td>Antibiotics</td></tr><tr><td>Gentamicin</td><td>Thermo Fisher Scientific</td><td>15710-064</td><td>Antibiotics</td></tr><tr><td>MAX Efficiency DH10Bac competent cells</td><td>Thermo Fisher Scientific</td><td>10361-012</td><td>For making bacmid DNA</td></tr><tr><td>S.O.C. Medium</td><td>Thermo Fisher Scientific</td><td>15544-034</td><td>For DNA transformation</td></tr><tr><td>CellFECTIN II Reagent</td><td>Thermo Fisher Scientific</td><td>10362-101</td><td>Insect cell transfection reagent</td></tr><tr><td>Bac-to-Bac Expression System</td><td>Thermo Fisher Scientific</td><td>10359-016</td><td>Baculovirus-insect cells expression kit</td></tr><tr><td>Bluo-gal</td><td>Thermo Fisher Scientific</td><td>15519-028</td><td>For isolation of recominant Bacmid DNA</td></tr><tr><td>IPTG</td><td>Thermo Fisher Scientific</td><td>15529-019</td><td>For isolation of recominant Bacmid DNA</td></tr><tr><td>pFastBac1</td><td>Thermo Fisher Scientific</td><td>10360014</td><td>Baculorirus expression vector</td></tr><tr><td>Sf9 cells</td><td>Thermo Fisher Scientific</td><td>11496015</td><td>Sf9 monolayer cells</td></tr><tr><td>Hi5 cells</td><td>Thermo Fisher Scientific</td><td>B85502</td><td>High Five insect cells</td></tr><tr><td>Grace&amp;rsquo;s insect medium, unsupplemented</td><td>Thermo Fisher Scientific</td><td>11595030</td><td>Sf9 cell transfection minimum medium</td></tr><tr><td>Grace&amp;rsquo;s insect medium, supplemented</td><td>Thermo Fisher Scientific</td><td>11605102</td><td>Sf9 monolayer cell culture complete medium</td></tr><tr><td>Sf-900 II SFM</td><td>Thermo Fisher Scientific</td><td>10902104</td><td>Sf9 suspension cell culture medium without FBS</td></tr><tr><td>Express Five SFM</td><td>Thermo Fisher Scientific</td><td>10486025</td><td>Hi5 cell culture medium</td></tr><tr><td>Penicillin-Streptomycin</td><td>Thermo Fisher Scientific</td><td>15140122</td><td>100 ml (10,000 I.U./ml)</td></tr><tr><td>L-Glutamine (200 mM)</td><td>Thermo Fisher Scientific</td><td>25030081</td><td>100 ml</td></tr><tr><td>FBS Certified</td><td>Thermo Fisher Scientific</td><td>16000-044</td><td>500 ml</td></tr><tr><td>6-well plates</td><td>Thermo Fisher Scientific</td><td>08-772-1B</td><td>Flat-bottom</td></tr><tr><td>150 mm plates</td><td>Thermo Fisher Scientific</td><td>353025</td><td>100/case</td></tr><tr><td>1.5 ml Microcentrifuge Tubes</td><td>USA Scientific</td><td>1415-2500</td><td>500 tubes/bag</td></tr><tr><td>15 ml conical screw cap centrifuge tubes</td><td>USA Scientific</td><td>1475-0511</td><td>25 tubes/bag</td></tr><tr><td>50 ml conical screw cap centrifuge tubes</td><td>USA Scientific</td><td>1500-1211</td><td>25 tubes/bag</td></tr><tr><td>Ni-NTA Superflow</td><td>Qiagen</td><td>30430</td><td>NiNTA resin</td></tr><tr><td>pH-indicator strips</td><td>EMD Millipore Corporation</td><td>1.09535.0001</td><td>pH 0 - 14</td></tr></tbody></table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The baculovirus-mediated insect cell expression system is one of the systems used to express recombinant eukaryotic secretory proteins with some post-translational modifications. The secretory proteins need to be routed through the secretory pathways for protein glycosylation, disulfide bonds formation, and other post-translational modifications. To improve the existing insect cell expression of secretory plant proteins, a baculovirus expression vector is modified by the addition of either a GP67 or a hemolin signal peptide sequence between the promoter and multiple-cloning sites. This newly designed modified vector system successfully produced a high yield of soluble recombinant secreted plant receptor proteins of Arabidopsis thaliana. Two of the expressed plant proteins, the extracellular domains of Arabidopsis TDR and PRK3 plasma membrane receptors, were crystallized for X-ray crystallographic studies. The modified vector system is an improved tool that can potentially be used for the expression of recombinant secretory proteins in the animal kingdom as well.

As shown in Figure 1, two modified pFastBac1 baculovirus expression vectors were used to express the secreted proteins with either the GP67 or the hemolin signal sequence to replace the intrinsic signal sequence of the target gene. The viral GP67 and the insect hemolin genes have been demonstrated to have high secretion expression levels in the cells. Fusion proteins with either of these two signal sequences are expected to have greatly improved secretion exp...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Here, we present the protocols for utilizing the insect cell and baculovirus protein expression system to produce large quantities of plant secreted proteins for protein crystallization. A baculovirus expression vector has been modified with either GP67 or insect hemolin signal peptide for plant protein secretion expression in insect cells.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Research

JoVE Journal

Biochemistry

11.4K Views.  North Carolina State University. Hier presenteren we de protocollen voor het gebruik van het insect cel en baculovirus eiwit expressie systeem voor de productie van grote hoeveelheden uitgescheiden eiwithoudende gewassen voor eiwit kristallisatie. Een vector baculovirus expressie is gewijzigd met GP67 of insect hemolin signaal peptide voor plant secretie eiwituitdrukking in insect cellen.

Video: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Transient Expression of Foreign Genes in Insect Cells (sf9) for Protein Functional Assay

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell culture system. This system was developed to express foreign genes under the control of the baculoviral promoter in transient expression plasmids. Furthermore, this system can be applied to a functional assay of either the baculovirus itself or foreign proteins. The most widely and commercially available transient gene expression system is developed based on the immediate-early gene (IE) promoter of Orgyia pseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV). However, a low expression level of foreign genes in insect cells was observed. Therefore, a transient gene expression system was constructed for improving protein expression. In this system, recombinant plasmids were constructed to contain the target sequence under the control of the Drosophila heat shock 70 (Dhsp70) promoter. This protocol presents the application of this heat shock-based pDHsp/V5-His (V5 epitope with 6 histidine)/Spodoptera frugiperda cell (sf9 cell) system; this system is available not only for gene expression but also for evaluating the anti-apoptotic activity of candidate proteins in insect cells. Furthermore, this system can be either transfected with one recombinant plasmid or co-transfected two potentially functionally antagonistic recombinant plasmids in insect cells. The protocol demonstrates the efficiency of this system and provides a practical case of this technique.

Transient Expression of Foreign Genes in Insect Cells sf9 for Protein Functional Assay

This protocol describes a heat shock-induced protein expression system (pDHsp/V5-His/sf9 cell system), which can be used for either expressing foreign proteins or evaluating the anti-apoptotic activity of potential foreign proteins and their truncated amino acids in insect cells.

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell ...

Genetics

Production and Purification of Baculovirus for Gene Therapy Application

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a promising vector for gene therapy application. Here, baculovirus is produced by transient transfection of the baculovirus plasmid DNA (bacmid) in an adherent culture of Sf9 cells. Baculovirus is subsequently expanded in Sf9 cells in a serum-free suspension culture until the desired volume is obtained. It is then purified from the culture supernatant using heparin affinity chromatography. Virus supernatant is loaded onto the heparin column which binds baculovirus particles in the supernatant due to the affinity of heparin for baculovirus envelop glycoprotein. The column is washed with a buffer to remove contaminants and baculovirus is eluted from the column with a high-salt buffer. The eluate is diluted to an isotonic salt concentration and baculovirus particles are further concentrated using ultracentrifugation. Using this method, baculovirus can be concentrated up to 500-fold with a 25% recovery of infectious particles. Although the protocol described here demonstrates the production and purification of the baculovirus from cultures up to 1 L, the method can be scaled-up in a closed-system suspension culture to produce a clinical-grade vector for gene therapy application.

In this protocol, baculovirus is produced by transient transfection of baculovirus plasmid into Sf9 cells and amplified in a serum-free suspension culture. The supernatant is purified by heparin affinity chromatography and further concentrated by ultracentrifugation. This protocol is useful for the production and purification of baculovirus for gene therapy application.

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a ...

Expression and Purification of Mammalian Bestrophin Ion Channels

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- channel (CaCC) predominantly expressed in retinal pigment epithelium (RPE). The physiological and pathological significance of BEST1 is highlighted by the fact that over 200 distinct mutations in the BEST1 gene have been genetically linked to a spectrum of at least five retinal degenerative disorders, such as Best vitelliform macular dystrophy (Best disease). Therefore, understanding the biophysics of bestrophin channels at the single-molecule level holds tremendous significance. However, obtaining purified mammalian ion channels is often a challenging task. Here, we report a protocol for the expression of mammalian bestrophin proteins with the BacMam baculovirus gene transfer system and their purification by affinity and size-exclusion chromatography. The purified proteins have the potential to be utilized in subsequent functional and structural analyses, such as electrophysiological recording in lipid bilayers and crystallography. Importantly, this pipeline can be adapted to study the functions and structures of other ion channels.

The purification of ion channels is often challenging, but once achieved, it can potentially allow in vitro investigations of the functions and structures of the channels. Here, we describe the stepwise procedures for the expression and purification of mammalian bestrophin proteins, a family of Ca2+-activated Cl- channels.

The human genome encodes four bestrophin paralogs, namely BEST1, BEST2, BEST3, and BEST4. BEST1, encoded by the BEST1 gene, is a Ca2+-activated Cl- ...

Expression of Functional Recombinant Hemagglutinin and Neuraminidase Proteins from the Novel H7N9 Influenza Virus Using the Baculovirus Expression System

The baculovirus expression system is a powerful tool for expression of recombinant proteins. Here we use it to produce correctly folded and glycosylated versions of the influenza A virus surface glycoproteins - the hemagglutinin (HA) and the neuraminidase (NA). As an example, we chose the HA and NA proteins expressed by the novel H7N9 virus that recently emerged in China. However the protocol can be easily adapted for HA and NA proteins expressed by any other influenza A and B virus strains. Recombinant HA (rHA) and NA (rNA) proteins are important reagents for immunological assays such as ELISPOT and ELISA, and are also in wide use for vaccine standardization, antibody discovery, isolation and characterization. Furthermore, recombinant NA molecules can be used to screen for small molecule inhibitors and are useful for characterization of the enzymatic function of the NA, as well as its sensitivity to antivirals. Recombinant HA proteins are also being tested as experimental vaccines in animal models, and a vaccine based on recombinant HA was recently licensed by the FDA for use in humans. The method we describe here to produce these molecules is straight forward and can facilitate research in influenza laboratories, since it allows for production of large amounts of proteins fast and at a low cost. Although here we focus on influenza virus surface glycoproteins, this method can also be used to produce other viral and cellular surface proteins.

Here we describe a way to express correctly folded and functional influenza virus surface antigens derived from the novel Chinese H7N9 virus in insect cells. The technique can be adapted to express ectodomains of any viral or cellular surface proteins.

The baculovirus expression system is a powerful tool for expression of  recombinant proteins. Here we use it to produce correctly folded and  glycosylated ...

Immunology and Infection

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

The MultiBac Protein Complex Production Platform at the EMBL

Proteomics research revealed the impressive complexity of eukaryotic proteomes in unprecedented detail. It is now a commonly accepted notion that proteins in cells mostly exist not as isolated entities but exert their biological activity in association with many other proteins, in humans ten or more, forming assembly lines in the cell for most if not all vital functions.1,2 Knowledge of the function and architecture of these multiprotein assemblies requires their provision in superior quality and sufficient quantity for detailed analysis. The paucity of many protein complexes in cells, in particular in eukaryotes, prohibits their extraction from native sources, and necessitates recombinant production. The baculovirus expression vector system (BEVS) has proven to be particularly useful for producing eukaryotic proteins, the activity of which often relies on post-translational processing that other commonly used expression systems often cannot support.3 BEVS use a recombinant baculovirus into which the gene of interest was inserted to infect insect cell cultures which in turn produce the protein of choice. MultiBac is a BEVS that has been particularly tailored for the production of eukaryotic protein complexes that contain many subunits.4 A vital prerequisite for efficient production of proteins and their complexes are robust protocols for all steps involved in an expression experiment that ideally can be implemented as standard operating procedures (SOPs) and followed also by non-specialist users with comparative ease. The MultiBac platform at the European Molecular Biology Laboratory (EMBL) uses SOPs for all steps involved in a multiprotein complex expression experiment, starting from insertion of the genes into an engineered baculoviral genome optimized for heterologous protein production properties to small-scale analysis of the protein specimens produced.5-8 The platform is installed in an open-access mode at EMBL Grenoble and has supported many scientists from academia and industry to accelerate protein complex research projects.

Protein complexes catalyze key cellular functions. Detailed functional and structural characterization of many essential complexes requires recombinant production. MultiBac is a baculovirus/insect cell system particularly tailored for expressing eukaryotic proteins and their complexes. MultiBac was implemented as an open-access platform, and standard operating procedures developed to maximize its utility.

Proteomics  research revealed the impressive complexity of eukaryotic proteomes in  unprecedented detail. It is now a commonly accepted notion that ...

Biology

Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing worldwide demand for pharmaceuticals due to its limited scalability and high cost. Plants have shown to be one of the most promising alternative pharmaceutical production platforms that are robust, scalable, low-cost and safe. The recent development of virus-based vectors has allowed rapid and high-level transient expression of recombinant proteins in plants. To further optimize the utility of the transient expression system, we demonstrate a simple, efficient and scalable methodology to introduce target-gene containing Agrobacterium into plant tissue in this study. Our results indicate that agroinfiltration with both syringe and vacuum methods have resulted in the efficient introduction of Agrobacterium into leaves and robust production of two fluorescent proteins; GFP and DsRed. Furthermore, we demonstrate the unique advantages offered by both methods. Syringe infiltration is simple and does not need expensive equipment. It also allows the flexibility to either infiltrate the entire leave with one target gene, or to introduce genes of multiple targets on one leaf. Thus, it can be used for laboratory scale expression of recombinant proteins as well as for comparing different proteins or vectors for yield or expression kinetics. The simplicity of syringe infiltration also suggests its utility in high school and college education for the subject of biotechnology. In contrast, vacuum infiltration is more robust and can be scaled-up for commercial manufacture of pharmaceutical proteins. It also offers the advantage of being able to agroinfiltrate plant species that are not amenable for syringe infiltration such as lettuce and Arabidopsis. Overall, the combination of syringe and vacuum agroinfiltration provides researchers and educators a simple, efficient, and robust methodology for transient protein expression. It will greatly facilitate the development of pharmaceutical proteins and promote science education.

Plants offer a novel system for the production of pharmaceutical proteins on a commercial scale that is more scalable, cost-efficient and safe than current expression paradigms. In this study, we report a simple and convenient, yet scalable approach to introduce target-gene containing Agrobacterium tumefaciens into plants for protein transient expression.

Mammalian cell culture is the major platform for commercial production of human vaccines and therapeutic proteins. However, it cannot meet the increasing ...

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short period of time. However, this technology is only just beginning to be applied to large-scale production as many technological obstacles to scale up are now being overcome. Here, we demonstrate a simple and reproducible method for industrial-scale transient protein production based on vacuum infiltration of Nicotiana plants with Agrobacteria carrying launch vectors. Optimization of Agrobacterium cultivation in AB medium allows direct dilution of the bacterial culture in Milli-Q water, simplifying the infiltration process. Among three tested species of Nicotiana, N. excelsiana (N. benthamiana &#215; N. excelsior) was selected as the most promising host due to the ease of infiltration, high level of reporter protein production, and about two-fold higher biomass production under controlled environmental conditions. Induction of Agrobacterium harboring pBID4-GFP (Tobacco mosaic virus-based) using chemicals such as acetosyringone and monosaccharide had no effect on the protein production level. Infiltrating plant under 50 to 100 mbar for 30 or 60 sec resulted in about 95% infiltration of plant leaf tissues. Infiltration with Agrobacterium laboratory strain GV3101 showed the highest protein production compared to Agrobacteria laboratory strains LBA4404 and C58C1 and wild-type Agrobacteria strains at6, at10, at77 and A4. Co-expression of a viral RNA silencing suppressor, p23 or p19, in N. benthamiana resulted in earlier accumulation and increased production (15-25%) of target protein (influenza virus hemagglutinin).

Optimization and Utilization of Agrobacterium-mediated Transient Protein Production in Nicotiana

Transient protein production in Nicotiana plants based on vacuum infiltration with Agrobacteria carrying launch vectors (Tobacco mosaic virus-based) is a rapid and economic approach to produce vaccine antigens and therapeutic proteins. We simplified the procedure and improved target accumulation by optimizing conditions of bacteria cultivation, selecting host species, and co-introducing RNA silencing suppressors.

Agrobacterium-mediated transient protein production in plants is a promising approach to produce vaccine antigens and therapeutic proteins within a short ...

Efficient Production and Purification of Recombinant Murine Kindlin-3 from Insect Cells for Biophysical Studies

Kindlins are essential coactivators, with talin, of the cell surface receptors&#160;integrins and also participate in integrin outside-in signalling, and the control of gene transcription in the cell nucleus. The kindlins are ~75 kDa multidomain proteins and bind to an NPxY motif and upstream T/S cluster of the integrin &#946;-subunit cytoplasmic tail. The hematopoietically-important kindlin isoform, kindlin-3, is critical for platelet aggregation during thrombus formation, leukocyte rolling in response to infection and inflammation and osteoclast podocyte formation in bone resorption. Kindlin-3&#39;s role in these processes has resulted in extensive cellular and physiological studies. However, there is a need for an efficient method of acquiring high quality milligram quantities of the protein for further studies. We have developed a protocol, here described, for the efficient expression and purification of recombinant murine kindlin-3 by use of a baculovirus-driven expression system in Sf9 cells yielding sufficient amounts of high purity full-length protein to allow its biophysical characterization. The same approach could be taken in the study of the other mammalian kindlin isoforms.

Kindlins are fundamental to cell adhesion through integrins but studies of them have been hampered by the difficulty encountered in expressing them recombinantly in bacterial hosts. We describe here methods for their efficient production in baculovirus-infected insect cells.

Kindlins are essential coactivators, with talin, of the cell surface receptors&#160;integrins and also participate in integrin outside-in signalling, and ...

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the flexible, low-cost production of high-quality, bioactive products.
In this study, we compared the expression of a target human recombinant protein in traditional fermenter-based cell cultures (bacterial and insect) with plant-based expression systems, both transient and stable.
For each platform, we described the set-up, optimization and length of the production process, the final product quality and the yields and we evaluated provisional production costs, specific for the selected target recombinant protein.
Overall, our results indicate that bacteria are unsuitable for the production of the target protein due to its accumulation within insoluble inclusion bodies. On the other hand, plant-based systems are versatile platforms that allow the production of the selected protein at lower-costs than Baculovirus/insect cell system. In particular, stable transgenic lines displayed the highest-yield of the final product and transient expressing plants the fastest process development. However, not all recombinant proteins may benefit from plant-based systems but the best production platform should be determined empirically with a case-by-case approach, as described here.

In this study the expression of a target human recombinant protein in different production platforms was compared. We focused on traditional fermenter-based cultures and on plants, describing the set-up of each system and highlighting, on the basis of the reported results, the inherent limits and advantages for each platform.

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the ...

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Samenvatting

Meer video's verkennen