JoVE Logo

Zaloguj się

Aby wyświetlić tę treść, wymagana jest subskrypcja JoVE. Zaloguj się lub rozpocznij bezpłatny okres próbny.

W tym Artykule

  • Podsumowanie
  • Streszczenie
  • Wprowadzenie
  • Protokół
  • Wyniki
  • Dyskusje
  • Ujawnienia
  • Podziękowania
  • Materiały
  • Odniesienia
  • Przedruki i uprawnienia

Podsumowanie

Methods to prepare and characterize the physicochemical properties and bioactivity of neutrally-charged, pH-responsive siRNA nanoparticles are presented. Criteria for successful siRNA nanomedicines such as size, morphology, surface charge, siRNA loading, and gene silencing are discussed.

Streszczenie

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical success for treating previously ‘undruggable’ hepatic disease targets with siRNA has been achieved. However, efficient tumor siRNA delivery necessitates additional pharmacokinetic design considerations, including long circulation time, evasion of clearance organs (e.g., liver and kidneys), and tumor penetration and retention. Here, we describe the preparation and in vitro physicochemical/biological characterization of polymeric nanoparticles designed for efficient siRNA delivery, particularly to non-hepatic tissues such as tumors. The siRNA nanoparticles are prepared by electrostatic complexation of siRNA and the diblock copolymer poly(ethylene glycol-b-[2-(dimethylamino)ethyl methacrylate-co-butyl methacrylate]) (PEG-DB) to form polyion complexes (polyplexes) where siRNA is sequestered within the polyplex core and PEG forms a hydrophilic, neutrally-charged corona. Moreover, the DB block becomes membrane-lytic as vesicles of the endolysosomal pathway acidify (< pH 6.8), triggering endosomal escape and cytosolic delivery of siRNA. Methods to characterize the physicochemical characteristics of siRNA nanoparticles such as size, surface charge, particle morphology, and siRNA loading are described. Bioactivity of siRNA nanoparticles is measured using luciferase as a model gene in a rapid and high-throughput gene silencing assay. Designs which pass these initial tests (such as PEG-DB-based polyplexes) are considered appropriate for translation to preclinical animal studies assessing the delivery of siRNA to tumors or other sites of pathology.

Wprowadzenie

Because siRNAs inhibit the translation of proteins from mRNA sequences, they can theoretically be used to drug all known pathologies1,2,3,4,5. However, the use of siRNA in medicine is limited by the comprehensively poor pharmacokinetic profile of siRNA molecules6,7. When injected intravenously, siRNAs are rapidly cleared through the kidneys and/or degraded by nucleases8,9. Due to its large size and negative charge, siRNA cannot enter cells or escape the endolysosomal pathway to access the RNA-Induced Silencing Complex (RISC) that resides in the cytosol10,11,12,13. Thus, extensive effort has focused on the design and implementation of siRNA delivery strategies14. This effort has largely focused on the development of lipid- and polymer-based nanoparticles which package siRNA, protect it from clearance and degradation in vivo, and initiate cellular uptake and endosomal escape through ionizable, cationic amine groups. Many pre-clinical successes have been reported and most recently, the first clinical success has been reported for nanoparticle-based hepatic siRNA delivery to treat hereditary transthyretin-mediated (hATTR) amyloidosis15.

There are many cancer-causing genes that are currently “undruggable” by conventional pharmacology (i.e., small molecule drugs), motivating the design of polymeric siRNA nanoparticles (si-NPs) to treat cancer16. However, there are a separate set of design parameters that must be considered for non-hepatic siRNA delivery. The delivery system must shield the cationic charge of the polyplex which causes agglutination within the systemic circulation17,18,19. For tumor delivery, specifically, si-NP stability is essential to endow long circulation and thus increased accumulation within tumors via the enhanced permeability and retention (EPR) effect20,21. Moreover, control over si-NP size is essential since only nanoparticles approximately 20 – 200 nm diameter in size leverage EPR22, and smaller si-NPs (~20 – 50 nm diameter) exhibit improved tumor penetration over larger sized nanoparticles and microparticles23.

To address these additional design constraints for systemic tumor delivery of siRNA following intravenous administration, neutrally-charged, pH-responsive si-NPs have been developed (Figure 1)24. These si-NPs are PEGylated, or most recently, Zwitterionated25, for neutral surface charge and resistance to protein adsorption and opsonization in circulation. Since they cannot rely solely on cationic character to drive intracellular delivery, extremely efficient endosomal escape is imperative for achieving potent gene silencing. Accordingly, the core of these si-NPs is composed of a highly endosomolytic core which is inert at extracellular pH (7.4), but which is triggered in a switch-like manner in the acidified conditions of the endolysosomal pathway [pH 6.8 (early endosomes) – 5.0 (lysosomes)]. Lastly, a mixture of cationic and hydrophobic content within the core of si-NPs provide both electrostatic and van der Waals stabilization forces, improving stability of the si-NPs in blood compared to merely cationic systems.

The integration of many functions into a relatively simple design is possible using Reversible Addition-Fragmentation chain Transfer (RAFT) controlled polymerization to produce polymers with complex architecture and precise composition. To produce si-NPs with neutral surface charge, pH-responsiveness, and NP stability, RAFT is used to synthesize poly(ethylene glycol-b-[2-(dimethylamino)ethyl methacrylate-co-butyl methacrylate]) (PEG-DB; Figure 1A). PEG-DB is electrostatically complexed with siRNA, forming si-NPs with a PEG corona and DB/siRNA core (Figure 1B). PEG forms an inert, neutrally-charged hydrophilic layer on the si-NP corona. The DB block consists of a 50:50 molar ratio of 2-(dimethylamino)ethyl methacrylate (DMAEMA) and butyl methacrylate (BMA). Cationic DMAEMA electrostatically complexes negatively-charged siRNA. BMA self-associates within the NP core by van der Waals interactions, increasing NP stability. Together, DMAEMA and BMA impart pH-dependent lipid bilayer-lytic behavior to the DB polymer block. At extracellular pH, the DB block is sequestered to the si-NP core and is inert to lipid bilayers. Under acidic conditions, such as those within the endolysosomal pathway, ionizable DMAEMA within the DB block facilitates the proton sponge effect, where endosomal buffering leads to osmotic swelling and rupture26. Additionally, hydrophobic BMA moieties within the DB block actively integrate into and lyse lipid bilayers, resulting in potent endosomolysis. Thus, siRNA is complexed with PEG-DB to form si-NPs that are neutrally-charged and highly stable at extracellular pH but which disrupt lipid bilayers at acidic pH, ensuring cytosolic delivery of the siRNA payload.

Herein are described the experimental procedures to produce si-NPs from PEG-DB. Methods to characterize the physicochemical parameters and bioactivity of si-NPs are presented and discussed. In order to rapidly assess si-NP bioactivity, luciferase is used as a model gene for knockdown studies. Firefly Luciferase is the protein responsible for the ‘glow’ of fireflies27. Accordingly, mammalian cells transfected with the firefly luciferase gene produce a bioluminescent ‘glow’ that can be captured using a luminometer to quantify levels of Luciferase expression. Here, we use Luciferase to assess bioactivity of si-NPs by delivering siRNA against Luciferase and quantifying the corresponding reduction in bioluminescence in Luciferase-expressing cells compared to cells that receive a scrambled siRNA.

Access restricted. Please log in or start a trial to view this content.

Protokół

1. Preparation and characterization of si-NPs

  1. si-NP preparation
    1. Dissolve polymer in 10 mM citric acid buffer (pH 4.0) at 3.33 mg/mL. Polymer can first be dissolved at 10x concentration in ethanol to ensure dissolution.
      NOTE: Polymer can be dissolved at lower concentrations, but use at concentrations above 3.33 mg/mL can prevent homogenous NP formation.
    2. Add siRNA (50 μM in diH2O) to result in N+:P- ratio of 10. Mix polymer and siRNA solutions thoroughly by pipetting and let incubate for 30 min. The N+:P- ratio represents the number of positively-charged amine groups on the polymer to the number of negatively-charged phosphate groups on the siRNA and is calculated by the formula below:
      figure-protocol-829
      where, mol Pol is the molar amount of polymer, RU amine is the number of repeating units of positively-charged amines per polymer, mol siRNA is the molar amount of siRNA, and bp siRNA is the number of base pairs per siRNA molecule.
    3. Add a 5-fold excess of 10 mM phosphate buffer (pH 8.0) and mix gently either by pipetting or inverting the tube. To confirm that the final pH is neutral (~7.2-7.5), pipette 10 μL of si-NP solution onto pH test strips.
      NOTE: Citric acid and phosphate buffers are prepared according to the Millipore Sigma Buffer Reference Center Charts.
  2. Physicochemical characterization of si-NPs
  3. Record the size and surface charge of resulting si-NPs using dynamic light scattering (DLS). Prepare a DLS sample by filtering 1 mL of si-NPs (0.1 – 1.0 mg/mL) through 0.45 μm pore-size syringe filters into a square quartz or polystyrene cuvette. Record size and surface charge measurements using a DLS instrument according to the manufacturer’s specifications.
    1. Confirm the size and morphology of si-NPs by imaging analysis using transmission electron microscopy (TEM).
      1. Add 5 μL of si-NP solution at 1 mg/mL to TEM grids and incubate for 60 s. Blot dry for 3 s.
      2. Add 5 μL of 3% uranyl acetate solution and incubate for 20 s. Blot dry for 3 s. Dry grids overnight under desiccation.
      3. Image grids according to the protocol established for the specific microscope to be used.
    2. Characterize the loading of siRNA in si-NPs at various N+:P- ratios using agarose gel retardation.
      1. To produce 2% agarose gel, add 2 g of electrophoresis grade agarose powder to 100 mL of 1x TAE (Tris-acetate-EDTA) buffer at pH 8.0. Stir to suspend agarose. Heat uncovered in microwave until all agarose is dissolved (1-3 min).
      2. Once cooled, add 5 μL of ethidium bromide (10 mg/mL in H2O), and mix well. Pour agarose into a gel tray and place comb to produce wells, letting dry for 30 min. Carefully remove comb to leave behind loading wells, and fill the gel tray to the max fill line with 1x TAE buffer.
      3. Generate si-NPs (according to the procedure above) at 0, 1, 2, 5, 7, 10, 20, and 40 N+:P- ratios. Place 2 μL aliquots of loading dye (no SDS and reducing agents) on paraffin film for each si-NP formulation. Mix 10 μL of si-NP solution with loading dye on paraffin film by pipette.
      4. Add si-NP/loading dye solutions to agarose gel wells. Run voltage source at 100 V for 35 min (or until samples have traversed 80% of gel length).
      5. Visualize siRNA bands on a UV transilluminator according to the manufacturer’s specifications.

2. Determining in vitro bioactivity of si-NPs

  1. Knockdown of the model gene luciferase
    1. Generate luciferase si-NPs (according to the procedure above) using luciferase siRNA and scrambled si-NPs using a scrambled siRNA sequence as a control. Formualte both si-NPs at the same final N+:P- ratio and at the optimum ratio identified by agarose gel retardation studies. Example siRNA sequences are included in the Table of Materials.
    2. Seed luciferase-expressing cells [MDA-MB-231/Luciferase (Bsd) stable cells] in 96-well black-walled plates at a density of 2,000 cells per well. Allow to adhere overnight in full media (DMEM, 10% FBS) in an incubator (37 °C, 5% CO2, 95% humidity).
    3. Dilute si-NPs into full serum media for a final volume of 100 μL per well and siRNA concentration of 100 nM. Treat cells for 24 h with si-NPs.
    4. After 24 h, remove treatments and replace media with full serum media containing 150 μg/mL D-luciferin. Incubate cells for 5 min before measuring luminescence on a plate reader or in vivo optical imaging system according to the manufacturer’s specifications.
    5. Replace luciferin-containing media with fresh, full serum media, and incubate 24 h more. Repeat the step above, removing media and replacing with full serum media containing 150 μg/mL D-luciferin, followed by a 5 min incubation prior to measuring luminescence at the 48 h timepoint.
    6. For longitudinal studies, maintain cells under sterile conditions while measuring luminescence. Continue to culture in fresh, full media between measurements after replacing luciferin-containing.
      NOTE: The appropriate siRNA concentration will vary with different si-NPs and siRNA molecules. When using neutrally-charged polyplexes with an endosomolytic core (e.g., PEG-DB), 100 nM is typically well-tolerated by the cells and produces >75% luciferase knockdown. The mass ratio of PEG-DB to siRNA at 10 N+:P- ratio and 100 nM siRNA treatments (assuming 26 bp siRNA) is 23.3, i.e., add 23.3 ng of PEG-DB for every 1.0 ng of siRNA. For example, add 1.16 μL of 3.33 mg/mL polymer for 166.5 ng of siRNA to treat one well at 100 nM in a 96-well plate (100 mL media volume per well).

Access restricted. Please log in or start a trial to view this content.

Wyniki

Some essential characteristics of effective si-NPs for in vivo siRNA delivery are the proper size (~20 – 200 nm diameter), siRNA packaging, and gene silencing bioactivity. While this is not an exhaustive list (as addressed in the Discussion), these basic characteristics should be confirmed before considering further testing of a formulation.

Figure 2 illustrates the characterization of si-NP s...

Access restricted. Please log in or start a trial to view this content.

Dyskusje

The si-NPs described here are formed by electrostatic association of anionic siRNA and cationic polymers into polyion complexes (polyplexes). Electrostatic complexing of siRNA and the cationic DB block of PEG-DB polymers is facilitated by mixing at low pH (4.0). At pH 4.0, DMAEMA is highly protonated, and consequently the DB block is highly charged. This ensures that the polymers dissolve as unimers in solution as opposed to forming micelles and that DB complexes efficiently with siRNA. Subsequently, the pH of solution i...

Access restricted. Please log in or start a trial to view this content.

Ujawnienia

The authors disclose no potential conflicts of interest.

Podziękowania

The authors are grateful to Drs. Craig Duvall and Rebecca Cook for access to data and lab resources for conducting this research. The authors are grateful to the Vanderbilt Institute for Nanoscale Science and Engineering (VINSE) for access to DLS and TEM (NSF EPS 1004083) instruments. The authors are grateful to the National Science Foundation for supporting the Graduate Research Fellowship Program (NSF#1445197). The authors are grateful to the National Institutes of Health for financial support (NIH R01 EB019409). The authors are grateful to the Department of Defense Congressionally Directed Medical Research program for financial support (DOD CDMRP OR130302).

Access restricted. Please log in or start a trial to view this content.

Materiały

NameCompanyCatalog NumberComments
0.45 μm pore-size syringe filtersThermo Fisher ScientificF2513317 mm diameter, PTFE membrane
0-14 pH test stripsMillipore SigmaP4786
10x TAE bufferThermo Fisher Scientific/InvitrogenAM9869
6-7.7 pH test stripsMillipore SigmaP3536
96-well black walled platesCorning3603Tissue-culture treated
Agarose PowderThermo Fisher Scientific/Invitrogen16500
Citric acid monohydrateMillipore SigmaC1909
dibasic sodium phosphate dihydrateMillipore Sigma71643
D-luciferinThermo Fisher Scientific88294Monopotassium Salt
DMEMGibco11995065High glucose and pyruvate
EthanolMillipore Sigma459836
ethidium bromideThermo Fisher Scientific/Invitrogen15585011
FBSGibco26140079
loading dyeThermo Fisher Scientific/InvitrogenR0611
Luciferase siRNAIDTN/AAntisense Strand Sequense: GAGGAGUUCAUUAUCAGUGC
AAUUGUU
Sense Strand Sequense: CAAUUGCACU
GAUAAUGAACUCCT*C* *DNA bases
MDA-MB-231 / Luciferase (Bsd) stable cellsGenTarget IncSC059-BsdLuciferase-expressing cells sued to assess si-NP bioactivity
monobasic sodium phosphate monohydrateMillipore SigmaS9638
Scarmbled siRNAIDTN/AAntisense Strand Sequense: AUACGCGUAUU
AUACGCGAUUAACGAC
Sense Strand Sequense: CGUUAAUCGCGUAUAAUAC
GCGUA*T* *DNA bases
square polystyrene cuvettesFisher Scientific14-955-1294.5 mL capacity
TEM gridsTed Pella, Inc.1GC50PELCO Center-Marked Grids, 50 mesh, 3.0mm O.D., Copper
Trisodium citrate dihydrateMillipore SigmaS1804
uranyl acetatePolysciences, Inc.21447-25

Odniesienia

  1. Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391 (6669), 806-811 (1998).
  2. Elbashir, S. M., et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411 (6836), 494-498 (2001).
  3. Soutschek, J., et al. Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature. 432 (7014), 173-178 (2004).
  4. Hannon, G. J. RNA interference. Nature. 418, 244(2002).
  5. Dykxhoorn, D. M., Palliser, D., Lieberman, J. The silent treatment: siRNAs as small molecule drugs. Gene Therapy. 13 (6), 541-552 (2006).
  6. Wittrup, A., Lieberman, J. Knocking down disease: a progress report on siRNA therapeutics. Nature Reviews Genetics. 16 (9), 543(2015).
  7. Li, H. E., Nelson, C. C., Evans, B., Duvall, C. Delivery of Intracellular-Acting Biologics in Pro-Apoptotic Therapies. Current Pharmaceutical Design. 17 (3), 293-319 (2011).
  8. Bartlett, D. W., Davis, M. E. Effect of siRNA nuclease stability on the in vitro and in vivo kinetics of siRNA-mediated gene silencing. Biotechnology and Bioengineering. 97 (4), 909-921 (2007).
  9. Zuckerman, J. E., Choi, C. H., Han, H., Davis, M. E. Polycation-siRNA nanoparticles can disassemble at the kidney glomerular basement membrane. Proceedings of the National Academy of Sciences USA. 109 (8), 3137-3142 (2012).
  10. Dominska, M., Dykxhoorn, D. M. Breaking down the barriers: siRNA delivery and endosome escape. Journal of Cell Science. 123 (Pt 8), 1183-1189 (2010).
  11. Gilleron, J., et al. Image-based analysis of lipid nanoparticle–mediated siRNA delivery, intracellular trafficking and endosomal escape. Nature Biotechnology. 31 (7), 638(2013).
  12. Sahay, G., et al. Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic recycling. Nature Biotechnology. 31 (7), 653-658 (2013).
  13. Wittrup, A., et al. Visualizing lipid-formulated siRNA release from endosomes and target gene knockdown. Nature Biotechnology. 33 (8), 870-876 (2015).
  14. Kanasty, R., Dorkin, J. R., Vegas, A., Anderson, D. Delivery materials for siRNA therapeutics. Nature Materials. 12 (11), 967-977 (2013).
  15. Adams, D., et al. Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis. New England Journal of Medicine. 379 (1), 11-21 (2018).
  16. Dang, C. V., Reddy, E. P., Shokat, K. M., Soucek, L. Drugging the 'undruggable' cancer targets. Nature Reviews Cancer. 17 (8), 502(2017).
  17. Alexis, F., Pridgen, E., Molnar, L. K., Farokhzad, O. C. Factors affecting the clearance and biodistribution of polymeric nanoparticles. Molecular Pharmaceutics. 5 (4), 505-515 (2008).
  18. Verbaan, F. J., et al. The fate of poly(2-dimethyl amino ethyl)methacrylate-based polyplexes after intravenous administration. International Journal of Pharmaceutics. 214 (1-2), 99-101 (2001).
  19. Lv, H., Zhang, S., Wang, B., Cui, S., Yan, J. Toxicity of cationic lipids and cationic polymers in gene delivery. Journal of Controlled Release. 114 (1), 100-109 (2006).
  20. Shi, J., Kantoff, P. W., Wooster, R., Farokhzad, O. C. Cancer nanomedicine: progress, challenges and opportunities. Nature Reviews Cancer. 17 (1), 20(2016).
  21. Torchilin, V. Tumor delivery of macromolecular drugs based on the EPR effect. Advanced Drug Delivery Reviews. 63 (3), 131-135 (2011).
  22. Duncan, R. The dawning era of polymer therapeutics. Nature Reviews Drug Discovery. 2 (5), 347(2003).
  23. Tang, L., et al. Investigating the optimal size of anticancer nanomedicine. Proceedings of the National Academy of Sciences USA. 111 (43), 15344-15349 (2014).
  24. Nelson, C. E., et al. Balancing Cationic and Hydrophobic Content of PEGylated siRNA Polyplexes Enhances Endosome Escape, Stability, Blood Circulation Time, and Bioactivity in vivo. ACS Nano. 7 (10), 8870-8880 (2013).
  25. Jackson, M. A., et al. Zwitterionic Nanocarrier Surface Chemistry Improves siRNA Tumor Delivery and Silencing Activity Relative to Polyethylene Glycol. ACS Nano. , (2017).
  26. Akinc, A., Thomas, M., Klibanov, A. M., Langer, R. Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis. The Journal of Gene Medicine. 7 (5), 657-663 (2005).
  27. de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., Subramani, S. Firefly luciferase gene: structure and expression in mammalian cells. Molecular and Cellular Biology. 7 (2), 725-737 (1987).
  28. Aggarwal, P., Hall, J. B., McLeland, C. B., Dobrovolskaia, M. A., McNeil, S. E. Nanoparticle interaction with plasma proteins as it relates to particle biodistribution, biocompatibility and therapeutic efficacy. Advanced Drug Delivery Reviews. 61 (6), 428-437 (2009).
  29. Geng, Y., et al. Shape effects of filaments versus spherical particles in flow and drug delivery. Nature Nanotechnology. 2 (4), 249(2007).
  30. Chauhan, V. P., et al. Fluorescent nanorods and nanospheres for real-time in vivo probing of nanoparticle shape-dependent tumor penetration. Angewandte Chemie International Edition. 50 (48), 11417-11420 (2011).
  31. Chu, K. S., et al. Plasma, tumor and tissue pharmacokinetics of Docetaxel delivered via nanoparticles of different sizes and shapes in mice bearing SKOV-3 human ovarian carcinoma xenograft. Nanomedicine. 9 (5), 686-693 (2013).
  32. Werfel, T. A., et al. Selective mTORC2 Inhibitor Therapeutically Blocks Breast Cancer Cell Growth and Survival. Cancer Research. 78 (7), 1845-1858 (2018).
  33. Sarett, S. M., et al. Lipophilic siRNA targets albumin in situ and promotes bioavailability, tumor penetration, and carrier-free gene silencing. Proceedings of the National Academy of Sciences USA. 114 (32), E6490-E6497 (2017).
  34. Williams, M. M., et al. Intrinsic apoptotic pathway activation increases response to anti-estrogens in luminal breast cancers. Cell Death and Disease. 9 (2), 21(2018).
  35. Evans, B. C., et al. Ex Vivo Red Blood Cell Hemolysis Assay for the Evaluation of pH-responsive Endosomolytic Agents for Cytosolic Delivery of Biomacromolecular Drugs. Journal of Visualized Experiments. (73), e50166(2013).
  36. Werfel, T., et al. Combinatorial Optimization of PEG Architecture and Hydrophobic Content Improves siRNA Polyplex Stability, Pharmacokinetics, and Potency In vivo. Journal of Controlled Release. , (2017).
  37. Kilchrist, K. V., Evans, B. C., Brophy, C. M., Duvall, C. L. Mechanism of Enhanced Cellular Uptake and Cytosolic Retention of MK2 Inhibitory Peptide Nano-polyplexes. Cellular and Molecular Bioengineering. 9 (3), 368-381 (2016).
  38. Kilchrist, K. V., et al. Gal8 Visualization of Endosome Disruption Predicts Carrier-Mediated Biologic Drug Intracellular Bioavailability. ACS Nano. , (2019).

Access restricted. Please log in or start a trial to view this content.

Przedruki i uprawnienia

Zapytaj o uprawnienia na użycie tekstu lub obrazów z tego artykułu JoVE

Zapytaj o uprawnienia

Przeglądaj więcej artyków

Neutrally charged NanoparticlesPH responsive NanoparticlesSiRNA DeliveryCytosolic DeliveryBioavailability EnhancementSmall Interfering RNAPolymer DissolutionDynamic Light ScatteringTransmission Electron MicroscopyNanoparticle CharacterizationSystemic AdministrationCancer TreatmentAutoimmune DisordersCardiovascular Disease

This article has been published

Video Coming Soon

JoVE Logo

Prywatność

Warunki Korzystania

Zasady

Badania

Edukacja

O JoVE

Copyright © 2025 MyJoVE Corporation. Wszelkie prawa zastrzeżone