JoVE Logo

Zaloguj się

Aby wyświetlić tę treść, wymagana jest subskrypcja JoVE. Zaloguj się lub rozpocznij bezpłatny okres próbny.

W tym Artykule

  • Podsumowanie
  • Streszczenie
  • Wprowadzenie
  • Protokół
  • Wyniki
  • Dyskusje
  • Ujawnienia
  • Podziękowania
  • Materiały
  • Odniesienia
  • Przedruki i uprawnienia

Podsumowanie

The goal of this manuscript is to describe the KitV558Δ/+ mouse model and techniques for successful dissection and processing of mouse specimens.

Streszczenie

Gastrointestinal stromal tumor (GIST) is the most common human sarcoma and is typically driven by a single mutation in the KIT receptor. Across tumor types, numerous mouse models have been developed in order to investigate the next generation of cancer therapies. However, in GIST, most in vivo studies use xenograft mouse models which have inherent limitations. Here, we describe an immunocompetent, genetically engineered mouse model of gastrointestinal stromal tumor harboring a KitV558Δ/+ mutation. In this model, mutant KIT, the oncogene responsible for most GISTs, is driven by its endogenous promoter leading to a GIST which mimics the histological appearance and immune infiltrate seen in human GISTs. Furthermore, this model has been used successfully to investigate both targeted molecular and immune therapies. Here, we describe the breeding and maintenance of a KitV558Δ/+ mouse colony. Additionally, this paper details the treatment and procurement of GIST, draining mesenteric lymph node, and adjacent cecum in KitV558Δ/+ mice, as well as sample preparation for molecular and immunologic analyses.

Wprowadzenie

GIST is the most common sarcoma in humans with an incidence of about 6,000 cases in the United States of America1. GIST appears to originate from the gastrointestinal pacemaker cells named the interstitial cells of Cajal, and is typically driven by a single mutation in the tyrosine kinase KIT or PDGFRA2. Surgery is the mainstay of treatment for GIST and can be curative, but patients with advanced disease may be treated with the tyrosine kinase inhibitor (TKI), imatinib. Since its introduction over 20 years ago, imatinib has transformed the treatment paradigm in GIST, improving the survival in advanced disease from 1 to over 5 years3,4,5. Unfortunately, imatinib is rarely curative due to acquired KIT mutations, so new treatments are needed for this tumor.

Mouse models are an important research tool in the investigation of novel therapies in cancer. Multiple subcutaneous xenograft and patient-derived xenograft models have been developed and investigated in GIST6,7. However, immunodeficient mice do not fully represent human GIST since GISTs harbor differential immune profiles depending on their oncogenic mutation, and altering the gastrointestinal tumor microenvironment improves upon the effects of TKI therapy8,9. The KitV558Δ/+ mouse has a heterozygous germline deletion in Kit exon 11, which encodes the juxtamembrane domain, the most commonly mutated site in human GIST10. KitV558Δ/+ mice develop a single cecal GIST with 100% penetrance, and tumors have similar histology, molecular signaling, immune infiltration, and response to therapy as human GIST8,11,12,13. Here, we describe breeding, treatment, and specimen isolation and processing in KitV558Δ/+ mice for use in molecular and immunologic research in GIST.

Access restricted. Please log in or start a trial to view this content.

Protokół

All mice were housed under pathogen-free conditions at the University of Pennsylvania according to NIH guidelines and with approval of the University of Pennsylvania IACUC. Euthanasia was performed following the University of Pennsylvania Laboratory Animal Resources standard operating procedures.

1. KitV558Δ/+ mouse breeding

  1. Backcross the KitV558Δ/+ mice more than 10 times onto a C57BL/6J background using C57BL/6J mice. To do this, breed the male KitV558Δ/+ mice with female C57BL/6J mice at a 1:2 ratio.
    NOTE: The homozygous KitV558Δ/V558Δ genotype is lethal in utero. It is possible to breed female KitV558Δ/+ mice with male C57BL/6J mice, but litter size is about half as that seen from female wildtype C57BL/6J mice. Furthermore, female KitV558Δ/+ mice produce limited litters after 4 months of age.
  2. Genotype the pups at 7-14 days of age by toe clipping to confirm the presence of the KitV558Δ/+ genotype. Use the forward primer: TCTCCTCCAGAAACCCATGTATGAA; reporter 1: CCTCGACAACCTTCCA; reverse primer: TTGCGTCGGGTCTATGTAAACAT; and reporter 2: TCTCCTCGACCTTCCA for genotyping.

2. KitV558Δ/+ mouse treatment

  1. Age and sex match the KitV558Δ/+ mice prior to treatment. Use the age- and sex-matched mice in cohorts as tumors from female KitV558Δ/+ mice are larger than those in male mice. Treat the mice at 8-12 weeks old, at which time tumors are established (Figure 1).
  2. Give tyrosine kinase inhibitors orally or by intraperitoneal (i.p.) injection; KitV558Δ/+ tumors are sensitive to tyrosine kinase inhibitors. Provide imatinib in a dose of 600 mg/L in drinking water or i.p. injections of 45 mg/kg twice daily. Measure tumor weight reduction using digital scales after dissection of tumor as shown in step 3, which is approximately 50% at 1 week and 80% at 4 weeks following treatment with imatinib (Figure 2).

3. KitV558Δ/+ mouse organ harvest

  1. Euthanize mice by CO2 narcosis at a flow rate of 60% chamber volume per min. Leave mice in the chamber for at least 2 min after respiration has ceased, then perform cervical dislocation to confirm death.
  2. Sterilize all instruments, wear gloves throughout the procedure, and maintain a sterile field. Prepare the skin with 70% ethanol. Make a 2 cm midline vertical incision using scissors and enter the abdominal cavity. Sharply lyse any intra-abdominal adhesions.
  3. To remove the draining mesenteric lymph node, follow the steps described below.
    1. Identify the cecum and lift its mesentery superiorly. Approximately midway to the base of the colonic mesentery, identify the mesenteric lymph node and sharply dissect it. The lymph node is off-white and about 0.5 cm x 0.5 cm in size.
    2. Divide lymph node tissue into thirds for protein isolation, histology, and single cell suspension, as needed. For single cell suspensions, place lymph node tissue in 20 mL of serum free media (RPMI) and keep on ice.
  4. For isolation of the GIST and cecum, follow the steps described below.
    1. The cecum in KitV558Δ/+ mice is mostly replaced by a GIST. Carefully divide the ileocolic junction from the base of the tumor. To collect the cecum, divide the colon again, 2 cm proximal to the base of the tumor.
    2. In 50%-60% of KitV558Δ/+ mice, the head of the tumor contains a cap of cecal tissue, which typically contains serous fluid but may rarely contain pus (Figure 3). Sharply dissect the cap tissue away from the tumor tissue.
    3. Divide tumor tissue and/or cecum into thirds for protein isolation, histology, and single cell suspension, as needed. For single cell suspensions, place tumor tissue or cecum in HBSS with 2% FCS, enough to cover the sample and keep on ice.

4. Western blot analysis of GIST tissue

  1. Prepare tissue lysis buffer containing 50 mM TrisHCl (pH 7.5), 150 mM NaCl, 5 mM EDTA, 1% nondenaturing detergent, 2 mM Na3VO4, 1 mM PMSF, 10 mM NaF, and 20 μl/ml proteinase inhibitor mixture.
  2. Prepare a 1x Tris-buffered saline solution with 1% Tween 20 (TBST) by combining 1800 mL of deionized water, 2 mL of Tween 20, and 200 mL of 10x Tris-buffered saline (TBS).
  3. Resuspend tissue from step 3.4.3 in a FACS tube in 5mL/g of tissue lysis buffer and homogenize twice with a mechanical homogenizer at 15,000 rpm for 15 s on ice. Incubate lysate for 30 min on ice.
  4. Transfer lysate to a 1.5 mL microcentrifuge tube. Centrifuge at max speed for 20 min at 4 °C. Transfer supernatant into a new microcentrifuge tube.
  5. Run lysates on a 4% to 15% gradient gel, then transfer to a nitrocellulose membrane, as described in14.
  6. Wash membrane once in 1x TBS for 5 min and then block membrane in 5% milk for 1 h. Again, wash membrane once in 1x TBS for 10 min.
  7. Incubate membrane in primary antibody diluted 1:1000 in 5% BSA at 4 °C overnight. Wash membrane 3x in 1x TBST for 10 min each. Incubate blot with secondary antibody diluted 1:2500 in 2.5% milk for 1 h at room temperature.
  8. Wash membrane once in 1x TBS for 5 min. Add enough HRP substrate to cover membrane, typically 200-500 μL, and use a digital imager to detect and quantify chemiluminescence.

5. Immunohistochemistry of GIST tissue

  1. Fix tissue from step 3.3.2 or 3.4.3 in 4% paraformaldehyde at 4 °C overnight. Store tissue in 70% EtOH until ready for processing. Embed and section blocks at 5 μm thickness onto glass slides, as described15,16.
  2. Complete immunohistochemical detection using a basic immunodetection kit, as previously described17.

6. Single cell suspension of mesenteric lymph node

  1. Pour RPMI media with lymph node specimen from step 3.3.2 over a 100 μm filter. Move filter to new 50 mL conical and mash lymph node with the soft end of a 3 mL plastic syringe. Wash filter with 20 mL of RPMI media.
  2. Centrifuge the filtrate at 450 x g at 4 °C for 5 min. Aspirate the supernatant. 
  3. Resuspend pellet in 20 mL of 1% FBS in PBS (bead buffer) and pour over a 40 μm filter. Collect the cell filtrate. Count cells using a hemocytometer.
  4. Centrifuge the filtrate at 450 x g at 4 °C for 5 min. Aspirate the supernatant. Resuspend in bead buffer at 6 x 107 cells/mL for flow cytometry.

7. Single cell suspension of GIST

  1. Prepare collagenase buffer by adding 250 mg of collagenase IV, one tablet of EDTA-free protease inhibitor and 100 µL of DNase I to 50 mL of HBSS. Rotate for 10 min at room temperature until dissolved.
  2. Place GIST in a sterile dish and add 2.5 mL of collagenase buffer. Mince tumor using a sterile scalpel and scissors until the tumor is in fine fragments. Use a large bore pipette to aspirate the tumor and collagenase into a 50 mL tube.
  3. Incubate in a shaking incubator at 100 rpm at 37 °C for 30 min. Quench reaction with 2 mL of FBS.
  4. Pour collagenase with GIST specimen over a 100 μm filter and mash tumor with the soft end of a 3 mL plastic syringe and collect in a 50 mL tube. Wash filter with 20 mL of HBSS. Centrifuge the filtrate at 450 x g, 4 °C for 5 min. Aspirate the supernatant.
  5. Resuspend the pellet in 20 mL of bead buffer and pour over a 40 μm filter. Collect the filtrate and count cells using a hemocytometer. Centrifuge the filtrate at 450 x g, 4 °C for 5 min. Aspirate the supernatant. Resuspend in bead buffer at 6 x 107 cells/mL for flow cytometry.

8. Single cell suspension of cecum

  1. Prepare collagenase buffer as in step 7.1. Using scissors, split the cecum longitudinally to expose the inner mucosa. Cut into 0.5 cm sections and place in a 50 mL tube with 5 mL of HBSS with 2% FBS. Shake vigorously for 30 s, centrifuge at 450 x g for 20 s, then aspirate the supernatant.
  2. Add 5 mL of HBSS with 2 mM EDTA. Incubate in a shaking incubator at 37 °C at 100 rpm for 15 min. Centrifuge at 450 x g for 20 s. Aspirate the supernatant.
  3. Add 5 mL of HBSS. Shake vigorously for 30 s, centrifuge at 450 x g for 20 s, then aspirate the supernatant. Repeat once more.
  4. Add 5 mL of collagenase buffer. Incubate in a shaking incubator at 37 °C for 30 min at 100 rpm. Shake vigorously every 10 min. Quench reaction with 2 mL of FBS.
  5. Pour collagenase with cecum specimen over a 100 μm filter and mash with the soft end of a 3 mL plastic syringe. Wash filter with 20 mL of HBSS. Collect filtrate.
  6. Centrifuge the filtrate at 450 x for 5 min at 4 °C. Aspirate the supernatant. Resuspend pellet in 20 mL of bead buffer and pour over a 40 μm filter. Collect filtrate and count cells using a hemocytometer.
  7. Centrifuge the filtrate at 450 x for 5 min at 4 °C. Aspirate the supernatant. Resuspend in bead buffer at 6 x 107 cells/mL for flow cytometry.

Access restricted. Please log in or start a trial to view this content.

Wyniki

The KitV558Δ/+ mouse model allows for the investigation of therapeutics in an immunocompetent mouse model. KitV558Δ/+ mice have an average lifespan of 8 months due to progressive bowel obstruction (Figure 4). Tumors from KitV558Δ/+ mice express canonical markers of GIST including the tyrosine kinase KIT and the transmembrane channel DOG1 (Figure 5...

Access restricted. Please log in or start a trial to view this content.

Dyskusje

The KitV558Δ/+ mouse model is a powerful research tool in the molecular and immunologic analysis of GIST. Although the breeding strategy requires a single cross, using KitV558Δ/+ mouse cohorts in experiments analyzing tumor response requires extensive breeding. Mice should be age- and sex-matched to ensure similar tumor weights, and 10% of mice die before 8 weeks of age when tumors are established. Less extensive breeding strategies are possible if using advanced ima...

Access restricted. Please log in or start a trial to view this content.

Ujawnienia

The authors have no conflicts of interest to disclose.

Podziękowania

KitV558Δ/+ mice were genetically engineered and shared by Dr. Peter Besmer10. This work was supported by NIH grants R01 CA102613 and T32 CA251063.

Access restricted. Please log in or start a trial to view this content.

Materiały

NameCompanyCatalog NumberComments
100 micron filterEMSCO1194-2360
1x RBC lysis bufferLife Technologies00-4333-57
3mL syringeThermo Fisher Scientific/BD Biosciences14823435
4–15% Mini-PROTEAN TGX Precast Protein Gels, 10-well, 30 µlBio-Rad4561083
4% Paraformaldehyde SolutionThermo Fisher ScientificAAJ19943K2
40 micron filterEMSCO1194-2340
5M NaClSigma AldrichS6546
70 micron filterEMSCO1194-2350
AKT antibody (C67E7)Cell Signaling4691
C57BL/6J miceThe Jackson Laboratory
Collagenase IVSigma AldrichC5138
Complete mini edta free protease inhibitorThomas ScientificC852A34
Countess II Automated Cell CounterThermo Fisher Scientific
Disposable ScalpelsThermo Fisher Scientific/Exel International14-840-00
Dnase IThomas ScientificC756V81
Dog1 antibodyabcamab64085
EDTASigma AldrichE9884
ERK antibody (p44/42)Cell Signaling9102
FBSThomas ScientificC788U23
FIJI softwareFIJIhttps://imagej.net/software/fiji
Fisherbrand 850 HomogenizerThermo Fisher Scientific15-340-169
HBSSUniversity of Pennsylvania Cell Center
Imatinib mesylateSelleck ChemicalsS1026
KIT antibody (D13A2)Cell Signaling3074
KitV558Δ/+ GenotypingTransnetyx
Microcentrifuge tubes (1.5mL)Thermo Fisher Scientific05-408-129
Mouse on Mouse Immunodetection Kit, BasicVector LaboratoriesBMK-2202
Nitrocellulose Membrane, Precut, 0.45 µmRio-Rad1620145
Nonfat Dry MilkThermo Fisher ScientificNC9121673
Nonidet P 40 SubstituteSigma Aldrich74385
p-AKT antibody (S473)Cell Signaling4060
p-ERK antibody (p44/42)Cell Signaling9101
p-KIT antibody (Y719)Cell Signaling3391
PMSF Protease InhibitorThermo Fisher Scientific36978
Proeinase KThermo Fisher ScientificBP170050
Round-Bottom Polystyrene Test (FACS) TubesFalcon/Thermo Fisher Scientific14-959-2A
RPMIUniversity of Pennsylvania Cell Center
Sodium fluoride (NaF)Sigma Aldrich201154
Sodium orthovanadate (Na3VO4)Sigma AldrichS6508
SuperSignal West Dura Extended Duration SubstrateThermo Fisher Scientific34076
TBS buffer (10x)University of Pennsylvania Cell Center
Tissue culture dish (100mm2)Thermo Fisher Scientific/Falcon08-772E
TrisHCLThermo Fisher ScientificBP1757500
Tween 20Rio-Rad1706531
 vivaCT 80 platformScanco medical

Odniesienia

  1. Mastrangelo, G., et al. Incidence of soft tissue sarcoma and beyond: a population-based prospective study in 3 European regions. Cancer. 118 (21), 5339-5348 (2012).
  2. Joensuu, H., DeMatteo, R. P. The management of gastrointestinal stromal tumors: a model for targeted and multidisciplinary therapy of malignancy. Annual Review of Medicine. 63, 247-258 (2012).
  3. Blanke, C. D., et al. Long-term results from a randomized phase II trial of standard- versus higher-dose imatinib mesylate for patients with unresectable or metastatic gastrointestinal stromal tumors expressing KIT. Journal of Clinical Oncology. 26 (4), 620-625 (2008).
  4. Demetri, G. D., et al. Efficacy and safety of regorafenib for advanced gastrointestinal stromal tumours after failure of imatinib and sunitinib (GRID): an international, multicentre, randomised, placebo-controlled, phase 3 trial. Lancet. 381 (9863), 295-302 (2013).
  5. Gold, J. S. Outcome of metastatic GIST in the era before tyrosine kinase inhibitors. Annals of Surgical Oncology. 14 (1), 134-142 (2007).
  6. Huynh, H., et al. Sorafenib induces growth suppression in mouse models of gastrointestinal stromal tumor. Molecular Cancer Therapeutics. 8 (1), 152-159 (2009).
  7. Na, Y. S., et al. Establishment of patient-derived xenografts from patients with gastrointestinal stromal tumors: analysis of clinicopathological characteristics related to engraftment success. Scientific Reports. 10 (1), 7996(2020).
  8. Balachandran, V. P., et al. Imatinib potentiates antitumor T cell responses in gastrointestinal stromal tumor through the inhibition of Ido. Nature Medicine. 17 (9), 1094-1100 (2011).
  9. Vitiello, G. A., et al. Differential immune profiles distinguish the mutational subtypes of gastrointestinal stromal tumor. Journal of Clinical Investigation. 129 (5), 1863-1877 (2019).
  10. Sommer, G., et al. Gastrointestinal stromal tumors in a mouse model by targeted mutation of the Kit receptor tyrosine kinase. Proceedings of the National Academy of Sciences of the United States of America. 100 (11), 6706-6711 (2003).
  11. Cavnar, M. J., et al. KIT oncogene inhibition drives intratumoral macrophage M2 polarization. Journal of Experimental Medicine. 210 (13), 2873-2886 (2013).
  12. Medina, B. D., et al. Oncogenic kinase inhibition limits Batf3-dependent dendritic cell development and antitumor immunity. Journal of Experimental Medicine. 216 (6), 1359-1376 (2019).
  13. Zhang, J. Q., et al. Macrophages and CD8(+) T cells mediate the antitumor efficacy of combined CD40 ligation and imatinib therapy in gastrointestinal stromal tumors. Cancer Immunology Research. 6 (4), 434-447 (2018).
  14. General Protocol for Western Blotting. , Available from: https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Buttetin_6376.pdf (2022).
  15. Sadeghipour, A., Babaheidarian, P. Making formalin-fixed, paraffin embedded blocks. Biobanking: Methods and Protocols. , Springer. New York. 253-268 (2019).
  16. Sy, J., Ang, L. -C. Microtomy: Cutting formalin-fixed, paraffin-embedded sections. Biobanking: Methods and Protocols. , Springer. New York. 269-278 (2019).
  17. Seifert, A. M., et al. PD-1/PD-L1 blockade enhances T-cell activity and antitumor efficacy of imatinib in gastrointestinal stromal tumors. Clinical Cancer Research. 23 (2), 454-465 (2017).
  18. Liu, M., et al. Oncogenic KIT modulates Type I IFN-mediated antitumor immunity in GIST. Cancer Immunology Research. 9 (5), 542-553 (2021).
  19. Rossi, F., et al. Oncogenic Kit signaling and therapeutic intervention in a mouse model of gastrointestinal stromal tumor. Proceedings of the National Academy of Sciences of the United States of America. 103 (34), 12843-12848 (2006).

Access restricted. Please log in or start a trial to view this content.

Przedruki i uprawnienia

Zapytaj o uprawnienia na użycie tekstu lub obrazów z tego artykułu JoVE

Zapytaj o uprawnienia

Przeglądaj więcej artyków

Gastrointestinal Stromal TumorGenetically Engineered Mouse ModelGISTImmunocompetent Mouse ModelMolecular TechniquesImmunologic TechniquesTyrosine Kinase InhibitorsSingle cell SuspensionHistologyProtein IsolationMesenteric Lymph NodeRPMI MediumCell FiltrationFlow Cytometry

This article has been published

Video Coming Soon

JoVE Logo

Prywatność

Warunki Korzystania

Zasady

Badania

Edukacja

O JoVE

Copyright © 2025 MyJoVE Corporation. Wszelkie prawa zastrzeżone