Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016

Podsumowanie

Here, we present protocols for working with Limosilactobacillus reuteri DSM20016, detailing growth, plasmid transformation, colony PCR, fluorescent reporter protein measurement, and limited plasmid mini-prep, as well as common issues and troubleshooting. These protocols allow the measurement of reporter proteins in DSM20016, or confirmation via colony PCR if no reporter is involved.

Streszczenie

Lactobacillus were an incredibly large, diverse genus of bacteria comprising 261 species, several of which were commensal strains with the potential for use as a chassis for synthetic biological endeavors within the gastrointestinal tract. The wide phenotypic and genotypic variation observed within the genus led to a recent reclassification and the introduction of 23 novel genera.

Due to the breadth of variations within the old genera, protocols demonstrated in one member may not work as advertised with other members. A lack of centralized information on how exactly to manipulate specific strains has led to a range of ad hoc approaches, often adapted from other bacterial families. This can complicate matters for researchers starting in the field, who may not know which information does or does not apply to their chosen strain.

In this paper, we aim to centralize a set of protocols with demonstrated success, specifically in the Limosilactobacillus reuteri strain designation F275 (other collection numbers: DSM20016, ATCC23272, CIP109823), along with troubleshooting advice and common issues one may encounter. These protocols should enable a researcher with little to no experience working with L. reuteri DSM20016 to transform a plasmid, confirm transformation, and measure system feedback in a plate reader via a reporter protein.

Wprowadzenie

The genus Lactobacillus were historically classified as gram-positive, rod-shaped, non-spore-forming, either facultative anaerobes or microaerophiles that break sugars down to primarily produce lactic acid¹. These loose criteria led to Lactobacillus being, phenotypically and genotypically, an extremely diverse genus. This broad categorization resulted in the genus being reclassified, introducing 23 novel genera in 2020².

The old, broader genus included major commensal and probiotic species generally regarded as safe (GRAS) for consumption³. The Lactobacillaceae family maintains a public perception of being 'good bacteria' due to many reported health benefits bestowed via the consumption of various strains^4,5,6,7. The ease with which they can navigate the gastrointestinal tract⁸ and their public acceptance combine to position Lactobacillaceae strains as strong candidates as chassis organisms for ingestible medicinal, therapeutic, or diagnostic applications.

The wide range of characteristics present within the Lactobacillaceae family has led to a situation in which there is no de facto model-organism strain; research groups have tended to select species with the properties most relevant to their particular aims. (For example, dairy fermentation labs could choose L. lactis; studies of vegetable fermentation might select L. plantarum; research on probiotics might focus on L. acidophilus; and so on.)

This same wide range of characteristics across species has led to an accumulation of protocols and procedures that may work well for one subset of the Lactobacillaceae family, but require optimization to work efficiently (or perhaps to function at all) in others⁹. This need for optimization between family members and even within members of the same species can frustrate the efforts of unfamiliar researchers. Protocols published in the methods sections of papers can also include their own modifications¹⁰, leading to fragmented, decentralized protocol collections.

L. reuteri is considered a widely vertebrate commensal, found consistently in mammalian, avian¹¹ and fish¹² gastrointestinal (GI) tracts. L. reuteri sub-strains are often genetically specialized, via mucus adhesion protein adaptation, to more permanently colonize specific native hosts^8,11,13. GI tract Limosilactobacillus species can be isolated in hosts outside their native host, but tend more toward a transient nature⁸.

Due to human-host specialization, L. reuteri DSM20016 positions itself very well as a chassis for diagnostic or therapeutic applications at any point in the human GI tract, and the strain DSM20016 could provide a longer-lasting window of effect for interventions when compared to more transitory strains.

In this paper, we outline a series of protocols with demonstrated effectiveness in Limosilactobacillus reuteri (strain designation: F275; other collection numbers: DSM20016, ATCC23272, CIP109823), along with centralized information on the strain from other sources to aid in molecular and systems biology applications. Procedures laid out herein should enable a researcher with no prior experience to culture L. reuteri, create electrocompetent stocks, select transformed colonies, confirm transformation via colony polymerase chain reaction (PCR), and measure designed system response via fluorescent reporter proteins.

We note that related protocols have covered CRISPR-Cas9 assisted ssDNA genome recombineering in L. reuteri (strain: ATCC-PTA-6475)¹⁴, and CRSIPR-Cas9 nickase-assisted genome editing in multiple non-L. reuteri, Lactobacillaceae family stains^15,16; these do not, however, address the L. reuteri DSM20016 strain that is our focus here.

Protokół

1. Preparing L. reuteri DSM20016 electrocompetent cells

NOTE: This is based on a protocol by Berthier et al.¹⁷, with centrifugation speeds informed by Rattanachaikunsopon et al.¹⁸.

1. In a 50 mL centrifuge tube, inoculate L. reuteri from glycerol stock into 6 mL of deMan Rogosa Sharpe (MRS) broth. Incubate aerobically overnight at 37 °C in a static incubator.
2. The next morning, inoculate 4 mL of the overnight culture into 200 mL of MRS broth (1:50 dilution).
3. Allow to grow aerobically in a static 37 °C incubator until the 600 nm optical density value (OD600) reaches 0.5-0.85; this should take roughly 2-3 h.
4. As soon as an adequate OD600 value is reached, decant the media into 50 mL centrifuge tubes and place on ice while balancing the tubes.
5. Centrifuge for 5 min at 5,000 x g in a pre-chilled, 4 °C centrifuge.
6. Discard the supernatant, resuspend each pellet in 50 mL of pre-chilled (0 °C to 4 °C) ddH₂O, and centrifuge again with the same settings as the previous step. Keep the cells on ice as much as possible.
7. Repeat step 1.6.
8. Resuspend each pellet in 25 mL of ddH₂O: 0.5 M sucrose, 10% glycerol. Centrifuge at 5,000 x g at 4 °C for 10 min. Discard the supernatant and put the cells back on ice.
9. Resuspend all the pellets in the same 2 mL of ddH₂O: 0.5 M sucrose, 10% glycerol.
10. Aliquot into 50 µL to 100 µL portions in pre-chilled microcentrifuge tubes; store at -80 °C for later use.

2. Electroporation of L. reuteri

NOTE: Avoid pipetting as much as possible in the following steps. Inclusion of a control electroporation, with no plasmid added, is advised to ensure the antibiotic selection is adequate.

1. Take an entire electrocompetent L. reuteri aliquot and thaw it on ice.
2. Gently mix 5 µL to 10 µL of plasmid (final plasmid concentration >6 nM) into the thawed aliquot, avoiding pipetting as much as possible.
3. Transfer to an ice-chilled, 1 mm gap electroporation cuvette.
4. Electroporate at 1.25 kV, 400 Ω, and 25 µF.
5. Add 1 mL of room temperature (RT) MRS broth and mix by inverting the cuvette once or twice.
6. Place the cuvettes into a static incubator at 37 °C for 2.5-3 h to allow for recovery.
7. Plate the entire amount onto multiple MRS agar plates with appropriate selection.
8. Place the plates inside a completely airtight container with a small lit candle ("tealight") and an anaerobic atmosphere-generating sachet.
9. Grow at 37 °C for 2-3 days or until visible colonies are present.

3. Measurement of the acid-resistant fluorescent reporter protein mCherry2

1. Pick any colonies required for measurement and inoculate into a 96-well storage microplate with 1.5 mL of filter sterilized (non-autoclaved) MRS broth per well and an appropriate selection antibiotic.
2. Incubate aerobically for 24 h overnight at 37 °C without shaking.
   NOTE: This storage microplate should be kept for use in section 4 (colony PCR).
3. L. reuteri will precipitate out of the media when in the stationary phase; resuspend the overnight culture via pipetting.
4. Transfer 200 µL into a flat, clear-bottom, 96-well plate, transfer the plate to a plate reader, and measure the OD and fluorescence of mCherry2 (excitation [Ex]: 589 nm; emission [Em]: 610 nm) or other relevant reporters.

4. Confirmation of plasmid uptake via colony PCR

1. From the 96-well storage microplate from section 3, transfer 5 µL to a PCR tube.
   NOTE: If >5 min have passed, it may be necessary to resuspend the L. reuteri a second time.
2. In a portable benchtop microcentrifuge, spin down until the pellet can be seen (roughly 2 min at 2,000 x g), discard the supernatant, and resuspend the pellet in 20 µL of 20 mM NaOH.
3. Boil at 95 °C for 5 min, vortex, and repeat the boil a second time.
4. Immediately chill the samples; try to keep the samples on ice as much as possible in the following steps to lower the likelihood of template degradation and PCR inhibition.
5. Spin down in a portable benchtop microcentrifuge at 2,000 x g for 2 min until the cell debris is pelleted, then take 1 µL of the supernatant and dilute into 99 µL of ice-cold DNase- and RNase-free ddH₂O (100x dilution).
6. Use the 100x dilution as the template DNA in a standard PCR reaction using plasmid-specific primers. Include a positive control with a plasmid derived from the E. coli mini-prep.
7. Return the samples on ice and add an appropriate loading dye at a 1x concentration.
8. Run in 1% agarose gel in TAE buffer (tris-acetate-ethylenediaminetetraacetic acid [EDTA]) at 110 V for 30 min. Image if necessary.

5. Mini-prep protocol for L. reuteri , followed by PCR to confirm plasmid presence

NOTE: Protocol intended for use with the mini-prep kit listed in the Table of Materials.

1. Inoculate L. reuteri into 10 mL of MRS broth containing an appropriate antibiotic and incubate overnight aerobically at 37 °C in a static incubator.
2. Centrifuge at 5,000 x g for 10 min in a pre-chilled 4 °C centrifuge.
3. Wash the pellet in 2 mL of standard P1 buffer (included with the kit) in order to negate acidity that may interfere with later steps, centrifuge with the same setting as previously described, and discard the supernatant.
4. Resuspend the pellet in 250 µL of modified P1 buffer containing 10 mg/mL lysozyme and 100 U/mL mutanolysin in order to lyse bacterial cells. Incubate for 1-2 h at 37 °C.
5. Add 250 µL of buffer P2, mix by inverting four to six times, and incubate at RT for no longer than 5 min.
6. Add 350 µL of buffer N3 (included with the kit) and immediately invert four to six times gently to mix.
7. Centrifuge at 10,000 x g for 10 min.
8. Transfer as much supernatant as possible to a spin column and centrifuge at 10,000 x g for 60 s. Discard the flow through.
9. Wash the spin column with 500 µL of buffer PB (included with the kit) and centrifuge at 10,000 x g for 60 s. Discard the flow through.
10. Wash the spin column with 750 µL of buffer PE (included with the kit), and centrifuge at 10,000 x g for 60 s. Discard the flow through and centrifuge for 60 s to remove any residual buffer.
11. Place the spin column in a 1.5 mL microcentrifuge tube. Apply 20-30 µL of DNAse- and RNAse-free ddH₂O to the filter of the spin column and leave for 1-2 min, before centrifuging at 10,000 x g for 60 s.
12. Perform a standard PCR reaction using plasmid-specific primers (pTRKH3_pTUSeq_F: CACCCGTTCTCGGAGCA, pTRKH3_pTUSeq_R: CTACGAGTTGCATGATAAAGAAGACA), with eluate providing the template DNA. Include a positive control with a plasmid derived from the E. coli mini-prep.
    NOTE: The PCR settings used in this study are: 98 °C for 5 min, (98 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s) 30 cycles, 72 °C for 2 min, 4 °C hold. The parameters are highly dependent on the polymerase used, fragment length, and exact primers used by any person utilizing this protocol.

Wyniki

Transformation efficiencies
L. reuteri does not require a dcm^-/dam^- non-methylated plasmid, as observed for other Lactobacillaceae^19,20 (see Figure 1). Electroporation of L. reuteri DSM20016 with 10 µL of the 8.5 kb plasmid pTRKH3_mCherry2 (pAMβ1 theta origin of replication) should give transformation efficiencies of roughly 80 colony forming units (CFU...

Dyskusje

The most critical step for the transformation of L. reuteri DSM20016 is the generation of anaerobic growth conditions after transformations are plated; colonies gained in aerobic conditions are only very occasional and generally fail to grow when inoculated in MRS broth. Plating the entire recovery volume should also be practiced to maximize the probability of colony growth. Even with these two critical steps, transformation efficiency is still a limitation on experimentation, as expected colonies can number as ...

Materiały

Name	Company	Catalog Number	Comments
1 kb Plus DNA Ladder	NEB	N3200L
1mL Spectrophotometer cuvettes	Thomas Scientific	1145J12
Agarose	BioShop	AGR001
Allegra X-15R (refrigerated centrifuge)	Beckman Allegra	N/A	No longer in production
AnaeroGen 2.5 L Sachet	Thermo Scientific	OXAN0025A
BTX, ECM 399 electroporation system	VWR	58017-984
Centrifuge tubes (50 mL)	FroggaBio	TB50-500
DNA gel x6 loading dye	NEB	B7024S
Electroporation cuvette	Fisherbrand	FB101
Erythromycin	Millipore Sigma	E5389-5G
Gel electroporation bath/dock	VWR	76314-748
Glycerol	BioShop	GLY001
Limosilactobacillus reuteri	Leibniz Institute DSMZ	DSM20016	Strain designation F275
Lysozyme	BioShop	LYS702.5
Microcentrifuge tubes (1.7 mL)	FroggaBio	LMCT1.7B
Miniprep kit (Qiagen)	Qiagen	27106	slpGFP replaced with constitutive, codon optimised, mCherry2 reporter protein
MRS Broth (Dehydrated)	Thermo Scientific	CM0359B
Mutanolysin	Millipore Sigma	M9901-5KU
NaOH	Millipore Sigma	1064691000
P100 Pipette	Eppendorf	3123000047
P1000 Pipette	Eppendorf	3123000063
P2.5 Pipette	Eppendorf	3123000012
P20 Pipette	Eppendorf	3123000039
P200 Pipette	Eppendorf	3123000055
PCR tubes	FroggaBio	STF-A120S
Personal benchtop microcentrifuge	Genlantis	E200100
Petri dishes	VWR	25384-088
PTC-150 Thermal Cycler	MJ Research	N/A	No longer in production
pTRKH3_slpGFP (modified)	Addgene	27168
SPECTRONIC 200 Spectrophotometer	Thermo Scientific	840-281700
Storage microplate	Fisher Scientific	14-222-225
Sucrose	BioShop	SUC507
TAE Buffer 50x	Thermo Scientific	B49
Vortex	VWR	58816-121	No longer in production
VWR 1500E incubator	VWR	N/A	No longer in production