Aby wyświetlić tę treść, wymagana jest subskrypcja JoVE. Zaloguj się lub rozpocznij bezpłatny okres próbny.
This protocol describes a workflow from ex vivo or in vitro cell cultures to transcriptomic data pre-processing for cost-effective transcriptome-based drug screening.
Transcriptomics allows to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease in the costs of library production and sequencing in the last decade, applying these technologies at the scale necessary for drug screening remains prohibitively expensive, obstructing the immense potential of these methods. Our study presents a cost-effective system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics. The optimized mini-bulk protocol provides informative biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules. Depending on the chosen treatment and incubation time, this protocol will result in sequencing libraries within approximately 2 days. Due to several stopping points within this protocol, the library preparation, as well as the sequencing, can be performed time-independently. Processing simultaneously a high number of samples is possible; measurement of up to 384 samples was tested without loss of data quality. There are also no known limitations to the number of conditions and/or drugs, despite considering variability in optimal drug incubation times.
The development of new drugs is a complex and time-consuming process that involves identifying potential drugs and their targets, optimizing and synthesizing drug candidates, and testing their efficacy and safety in preclinical and clinical trials1. Traditional methods for drug screening, i.e., the systematic assessment of libraries of candidate compounds for therapeutic purposes, involve the use of animal models or cell-based assays to test the effects on specific targets or pathways. While these methods have been successful in identifying drug candidates, they often did not provide sufficient insights into the complex molecular mechanisms und....
This protocol follows the guidelines of the local ethics committees of the University of Bonn.
1. Preparation of buffers, solutions, and equipment
2. Cell....
Following the reported protocol, human PBMCs were seeded, treated with different immunomodulatory drugs and, after different incubation times, harvested for bulk transcriptomic analysis using the sequencing protocol (Figure 1).
Ideal drug concentrations and incubation times for test compounds should be identified upstream this protocol with the help of complementary experimental strategies and based on the specific scientific question. In most cases, 2 - 4 h and 2.......
Drug discovery and drug development can greatly benefit from the holistic view of cellular processes that bulk transcriptomics can provide. Nevertheless, this approach is often limited by the high cost of the experiment with standard bulk RNA-seq protocol, prohibiting its application in academic settings as well as its potential for industrial scalability.
The most critical steps of the protocol are cell thawing and the initial steps of library preparation. Ensuring high viability of the cells.......
The authors declare no competing interests.
J.L.S. is supported by the German Research Foundation (DFG) under Germany's Excellence Strategy (EXC2151-390873048), as well as under SCHU 950/8-1; GRK 2168, TP11; CRC SFB 1454 Metaflammation, IRTG GRK 2168, WGGC INST 216/981-1, CCU INST 217/988-1, the BMBF-funded excellence project Diet-Body-Brain (DietBB); and the EU project SYSCID under grant number 733100. M.B. is supported by DFG (IRTG2168-272482170, SFB1454-432325352). L.B. is supported by DFG (ImmuDiet BO 6228/2-1 - Project number 513977171) and Germany's Excellence Strategy (EXC2151-390873048). Images created with BioRender.com.
....Name | Company | Catalog Number | Comments |
50 mL conical tube | fisher scientific | 10203001 | |
Adhesive PCR Plate Seals | Thermo Fisher Scientific | AB0558 | |
Amplicon Tagment Mix (ATM) | Illumina | FC-131-1096 | Nextera XT DNA Library Prep Kit (96 samples) |
AMPure XP beads | Beckman Coulter | A 63881 | |
Betaine | Sigma-Aldrich | 61962 | |
Cell culture grade 96-well plates | Thermo Fisher Scientific | 260860 | |
Cell culture vacuum pump (VACUSAFE) | Integra Bioscience | 158300 | |
Deoxynucleotide triphosphates (dNTPs) mix 10 mM each | Fermentas | R0192 | |
DMSO | Sigma-Aldrich | 276855 | |
DTT (100 mM) | Invitrogen | 18064-014 | |
EDTA | Sigma-Aldrich | 798681 | for adherent cells |
Ethanol | Sigma-Aldrich | 51976 | |
Fetal Bovine Serum | Thermo Fisher Scientific | 26140079 | |
Filter tips (10 µL) | Gilson | F171203 | |
Filter tips (100 µL) | Gilson | F171403 | |
Filter tips (20 µL) | Gilson | F171303 | |
Filter tips (200 µL) | Gilson | F171503 | |
Guanidine Hydrochloride | Sigma-Aldrich | G3272 | |
ISPCR primer (10 µM) | Biomers.net GmbH | SP10006 | 5′-AAGCAGTGGTATCAACGCAGAG T-3′ |
KAPA HiFi HotStart ReadyMix (2X) | KAPA Biosystems | KK2601 | |
Magnesium chloride (MgCl2) | Sigma-Aldrich | M8266 | |
Magnetic stand 96 | Ambion | AM10027 | |
Neutralize Tagment (NT) Buffer | Illumina | FC-131-1096 | Nextera XT DNA Library Prep Kit (96 samples), alternatively 0.2 % SDS |
Nextera-compatible indexing primer | Illumina | ||
Nuclease-free water | Invitrogen | 10977049 | |
PBS | Thermo Fisher Scientific | AM9624 | |
PCR 96-well plates | Thermo Fisher Scientific | AB0600 | |
PCR plate sealer | Thermo Fisher Scientific | HSF0031 | |
Penicillin / Streptomycin | Thermo Fisher Scientific | 15070063 | |
Qubit 4 fluorometer | Invitrogen | 15723679 | |
Recombinant RNase inhibitor (40 U/ul) | TAKARA | 2313A | |
RPMI-1640 cell culture medium | Gibco | 61870036 | If not working with PBMCs, adjust to cell type |
SMART dT30VN primer | Sigma-Aldrich | 5' Bio-AAGCAGTGGTATCAACGCAGAG TACT30VN-3 | |
Standard lab equipment | various | various | e.g. centrifuge, ice machine, ice bucket, distilled water, water bath |
SuperScript II Reverse Transcriptase (SSRT II) | Thermo Fisher Scientific | 18064-014 | |
SuperScript II Reverse Transcriptase (SSRT II) buffer (5x) | Thermo Fisher Scientific | 18064-014 | |
Tagment DNA Buffer (TD) | Illumina | FC-131-1096 | Nextera XT DNA Library Prep Kit (96 samples) |
TapeStation system 4200 | Agilent | G2991BA | |
Thermocycler (S1000) | Bio-Rad | 1852148 | |
TSO-LNA (100 uM) | Eurogentec | 5' Biotin AAGCAGTGGTATCAACGCAGAG TACAT(G)(G){G | |
Vortex-Genie 2 Mixer | Sigma-Aldrich | Z258415 |
Zapytaj o uprawnienia na użycie tekstu lub obrazów z tego artykułu JoVE
Zapytaj o uprawnieniaThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. Wszelkie prawa zastrzeżone