Name: bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses
Uploaded: 2015-12-29T13:00:00.000+00:00
Duration: 12 min 20 s
Description: Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

The authors would like to acknowledge the Utah Science Technology and Research fund for support of YML and the Korea National Research Foundation grants (2009-0069679 and 2010-0010154) for support of SIY. This research was supported by the Utah Agricultural Experiment Station, Utah State University, and approved as journal paper number UAES #8753. Also, the authors thank Dr. Deborah McClellan for editorial assistance.

The authors have declared that they have no competing financial interests.

The current protocol has been successfully used to generate full-length infectious cDNA clones for two different strains (CNU/LP227 and SA14-14-228) of JEV, a flavivirus whose functional cDNA has proved to be inherently difficult to construct and propagate because of host cell toxicity and the genetic instability of the cloned cDNA.8,74-76 This protocol involves three major components: first, maximizing the synthesis/amplification of a faithful cDNA copy of the viral RNA using high-fidelity reverse transcriptase/DNA polymerase; second, cloning the viral prM-E coding region containing toxic sequences (unpublished data)74,77,78 in a very low-copy number vector BAC from the initial cDNA subcloning to the final full-length cDNA assembly steps; and third, utilizing a cloning vector BAC that can accommodate a foreign DNA with an average size of 120-350 kb,19-21 which apparently tolerates larger DNA inserts than do other cloning vectors. This cloning approach will be generally applicable to many other positive-strand RNA viruses, particularly those with a large RNA genome of ~10 to 32 kb. Generation of an infectious cDNA clone is a key step in developing a reverse genetics system for RNA viruses, especially for positive-strand RNA viruses, because its genome acts as viral mRNA that is translated into proteins by host cell ribosomes. Thus, viral replication can be initiated by the introduction of a cDNA-derived genome-length RNA molecule into a susceptible host cell. The availability of an infectious JEV cDNA clone, when combined with recombinant DNA technology, has increased our understanding of various aspects of the viral life cycle at the molecular level, such as gene expression73,79 and genome replication.63,64 Also, a full-length JEV cDNA clone has proven to be a valuable tool for the development of antiviral vaccines28 and gene delivery vectors.80,81
As with all positive-strand RNA viruses, there are multiple critical steps in constructing a reliable functional cDNA for JEV from which highly infectious RNAs can be synthesized in vitro. Ideally, the sequence of the synthetic RNAs transcribed from a clone of the full-length cDNA should be identical to that of the viral genomic RNA, particularly the 5&#39;- and 3&#39;-terminal sequences that are required for the initiation of viral RNA replication.60-62 In the current protocol, the authentic 5&#39;- and 3&#39;-ends were ensured by placing the SP6 promoter sequence upstream of the first adenine nucleotide of the viral genome and positioning a unique artificial Xba I restriction site downstream of the last thymine nucleotide of the viral genome, respectively. Capped synthetic RNAs with the authentic 5&#39; and 3&#39; ends were produced by run-off transcription of an Xba I-linearized and MBN-treated cDNA template using SP6 RNA polymerase primed with the m7G(5&#39;)ppp(5&#39;)A cap analog. This protocol can be modified in several ways. For in vitro transcription, another bacteriophage RNA polymerase (e.g., T3 or T7) can be used in conjunction with its well-defined promoter sequence.27 As a run-off site, a different restriction site can be utilized if it is not present in the viral genome and if synthetic RNA from the linearized cDNA ends with the authentic 3&#39; end. The importance of the 3&#39;-end nucleotide sequence has been demonstrated by a ~10-fold decrease in RNA infectivity when a synthetic RNA contains three or four virus-unrelated nucleotides at its 3&#39; end.27 In an in vitro transcription reaction, both the m7G(5&#39;)ppp(5&#39;)A and m7G(5&#39;)ppp(5&#39;)G cap analog can be used equally well, although the latter places an unrelated extra G nucleotide upstream of the viral 5&#39;-end, but that addition does not alter the infectivity or replication of synthetic RNA.27 Moreover, removal of the cDNA template from the RNA transcripts by DNase I digestion is not necessary for RNA infectivity tests, because the cDNA template itself is not infectious.27
The BAC technology has now been applied to constructing infectious cDNA clones for a handful of positive-strand RNA viruses, namely, two JEVs, CNU/LP227 and SA14-14-228 (genome size, ~11 kb); two dengue viruses, BR/9026 and NGC29 (~11 kb); the bovine viral diarrhea virus, SD1 (~12 kb);25 two classical swine fever viruses, C and Paderborn (~12 kb);24 the border disease virus, Gifhorn (~12 kb);24 the porcine reproductive and respiratory syndrome virus, PL97-1/LP1 (~15 kb);30 the transmissible gastroenteritis virus, PUR46-MAD (~29 kb);16 the feline infectious peritonitis virus, DF-2 (~29 kb);32 the severe acute respiratory syndrome coronavirus, Urbani (~30 kb);9 the Middle East respiratory syndrome coronavirus, EMC/2012 (~30 kb);17 and the human coronavirus, OC43 (~31 kb).31 The main advantage of using BACs for cDNA construction is the high genetic stability of the large, 1- or 2-copy BAC plasmids; however, the intrinsic nature of its extremely low-copy number is also a great disadvantage, because of very low yields of BAC DNA and the consequent reduction in the purity of the BAC DNA with respect to host chromosomal DNA. In the current protocol, the yield of BAC DNA is maximized by growing E. coli DH10B transformed with the infectious BAC pBAC/SA14-14-2 in a nutrient-rich medium, 2xYT. Despite this effort, the average yield is only ~15 &#181;g of BAC DNA from 500 ml of 2xYT broth. Also, the purity of the BAC DNA is best achieved by using CsCl-EtBr density gradient centrifugation for purification, rather than the commonly used column-based plasmid isolation. However, it is important to keep in mind that the BAC-transformed E. coli should not overgrow because it might jeopardize the genetic stability of the cloned cDNA, and higher growth does not necessarily lead to greater yields or higher-purity BAC DNA.
The protocol described here is an optimized, efficient, and streamlined method for the construction and propagation of a genetically stable full-length infectious cDNA clone as a BAC for JEV, a procedure once thought practically impossible. This same cloning strategy may also be applied to many other positive-strand RNA viruses. In general, infectious cDNA clones enable us to introduce a variety of mutations (e.g., deletions, insertions, and point mutations) into a viral RNA genome to study their biological functions in viral replication and pathogenesis. This cDNA-based reverse genetics system makes it possible to develop and test vaccine and therapeutic candidates targeting a virulence factor(s) of a particular positive-strand RNA virus of interest. In addition, this infectious cDNA technology can also be utilized as a viral vector, capable of expressing a foreign gene(s) of interest for many applications in biomedical research.

For RNA virologists, the advent of recombinant DNA technology in the late 1970s made it possible to convert viral RNA genomes into cDNA clones, which could then be propagated as plasmids in bacteria for the genetic manipulation of RNA viruses.1 The first RNA virus to be molecularly cloned was bacteriophage Q&#946;, a positive-strand RNA virus that infects Escherichia coli. A plasmid containing a complete cDNA copy of the Q&#946; genomic RNA gave rise to infectious Q&#946; phages when introduced into E. coli.2 Shortly thereafter, this technique was applied to poliovirus, a positive-strand RNA virus of humans and animals. A plasmid bearing a full-length cDNA of the poliovirus genomic RNA was infectious when transfected into mammalian cells and capable of producing infectious virions.3 In this &#34;DNA-launched&#34; approach, the cloned cDNAs should be transcribed intracellularly to initiate viral RNA replication; however, it is unclear how the transcription is initiated and how the transcripts are processed to the correct viral sequence. This concern has led to the development of an alternative &#34;RNA-launched&#34; approach, whereby a complete cDNA copy of the viral RNA genome is cloned under a promoter recognized by an E. coli or phage RNA polymerase for the production of synthetic RNAs in vitro with defined 5&#39; and 3&#39; termini, which undergo the complete viral replication cycle when introduced into host cells.4,5 The first success with this approach was reported for brome mosaic virus,6,7 a positive-strand RNA virus of plants. Since then, the RNA-launched approach has been developed for a wide range of positive-strand RNA viruses, including caliciviruses, alphaviruses, flaviviruses, arteriviruses, and coronaviruses.1,4,5,8
In both the DNA- and RNA-launched reverse genetics systems, the construction of a full-length cDNA clone is the key to generating infectious DNA or RNA of positive-strand RNA viruses, but it becomes a considerable technical challenge as the size of the viral genome increases.9-17 In particular, a large RNA genome of ~10-32 kb presents three major obstacles to the cloning of a full-length functional cDNA.18 The first difficulty is the synthesis of a faithful cDNA copy, since the fidelity of RT-PCR is inversely proportional to the length of the viral RNA. The second hurdle is the presence of potentially toxic sequences, since long RNA molecules are more likely to contain unexpected sequences capable of making the cDNA fragment in plasmids unstable in E. coli. The third and most critical issue is the availability of a suitable vector, since it is difficult to find a cloning vector that can house a viral cDNA insert of &#62;10 kb. Over the past three decades, these barriers have been overcome by several advances in enzymology, methodology, and vectorology.1,4,5,8 Of these, the most promising and innovative development is the cloning of large positive-strand RNA viruses as infectious bacterial artificial chromosomes (BACs). The BAC vector is a low-copy cloning plasmid (1-2 copies/cell) based on the E. coli fertility factor, with an average DNA insert size of ~120-350 kb.19-21 A DNA fragment is inserted into the BAC vector in a similar fashion to cloning into general cloning vectors; the resulting BAC clones are stable over many generations in E. coli.22,23 To date, the BAC technology has been used to create infectious cDNA clones for &#62;10 members of three positive-strand RNA virus families, i.e., Flaviviridae,24-29Arteriviridae,30 and Coronaviridae.9,16,17,31,32
Using Japanese encephalitis virus (JEV) as an example, the present work reports the detailed procedures that can be used to construct a genetically stable full-length infectious BAC for a variety of positive-strand RNA viruses. JEV is a zoonotic flavivirus33 that is transmitted in nature between birds, pigs, and other vertebrate hosts by mosquito vectors.34,35 In humans, JEV infection can cause the severe often fatal neurological disease Japanese encephalitis (JE),36 which occurs in Asia and parts of the Western Pacific,37,38 with an estimated annual incidence of ~50,000-175,000 clinical cases.39,40 The genome of JEV is an ~11-kb, single-stranded, positive-sense RNA molecule and consists of a single open reading frame (ORF) flanked by two non-coding regions (NCRs) at the 5&#39; and 3&#39; ends.41,42 The ORF encodes a polyprotein that is cleaved by host and viral proteases to generate 10 individual proteins, designated C, prM, E, NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 in the N- to C-terminal direction.34,43,44 Also, an extended form of NS1 (NS1&#39;) is expressed by -1 ribosomal frameshifting at codons 8-9 of NS2A.45,46 Of these 11 proteins, the three structural proteins (C, prM, and E) are essential for the formation of infectious virions,47,48 and the remaining eight nonstructural proteins (NS1 to NS5, and NS1&#39;) are crucial for viral RNA replication,49-51 particle assembly,52-56 and innate immunity evasion.57-59 Both the 5&#39; and 3&#39; NCRs contain conserved primary sequences and form RNA secondary/tertiary structures,60-62 which are important for modulating viral RNA replication.63,64
This protocol describes the tools, methods, and strategies for generating a full-length infectious BAC of JEV SA14-14-2.28 This functional BAC clone contains a complete cDNA copy of the JEV genomic RNA,65 which is encompassed by a promoter for the SP6 RNA polymerase upstream of the viral 5&#39;-end and a unique Xba I restriction site downstream of the viral 3&#39;-end for in vitro run-off transcription. This BAC technology is applicable to constructing a fully functional cDNA molecular clone for an array of positive-strand RNA viruses.

<table><tbody><tr><td>&lt;strong&gt;1. Molecular Cloning&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>2xYT Broth</td><td>Sigma-Aldrich</td><td>Y2377</td><td></td></tr><tr><td>[&lt;sup&gt;3&lt;/sup&gt;H]UTP</td><td>PerkinElmer</td><td>NET380250UC</td><td>Radioactive</td></tr><tr><td>50 ml Tube</td><td>Thermo Scientific (Nalgene)</td><td>3114-0050</td><td></td></tr><tr><td>250 ml Bottle</td><td>Beckman Coulter</td><td>356011</td><td></td></tr><tr><td>Agarose</td><td>Lonza</td><td>50004</td><td></td></tr><tr><td>Agarose (Low Melting Point)</td><td>Life Technologies (Invitrogen)</td><td>16520-100</td><td></td></tr><tr><td>AvaI</td><td>New England BioLabs</td><td>R0152S</td><td></td></tr><tr><td>AvrII</td><td>New England BioLabs</td><td>R0174S</td><td></td></tr><tr><td>BamHI</td><td>New England BioLabs</td><td>R0136S</td><td></td></tr><tr><td>BsiWI</td><td>New England BioLabs</td><td>R0553S</td><td></td></tr><tr><td>BsrGI</td><td>New England BioLabs</td><td>R0575S</td><td></td></tr><tr><td>Butanol</td><td>Fisher Scientific</td><td>A399-1&amp;nbsp;</td><td></td></tr><tr><td>Cesium Chloride</td><td>Fisher Scientific</td><td>BP1595-1</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma-Aldrich</td><td>C0378</td><td></td></tr><tr><td>Chloroform</td><td>Sigma-Aldrich</td><td>C2432</td><td>Carcinogenic</td></tr><tr><td>DE-81 Filter Paper</td><td>GE Healthcare Life Sciences</td><td>3658-023</td><td></td></tr><tr><td>dNTP mix</td><td>Life Technologies (Invitrogen)</td><td>18427-088</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DH10B&amp;nbsp;</td><td>Life Technologies (Invitrogen)</td><td>18297-010</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>E5134</td><td></td></tr><tr><td>Ethanol&amp;nbsp;</td><td>Sigma-Aldrich</td><td>E7023</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Sigma-Aldrich</td><td>E7637</td><td>Toxic and highly mutagenic</td></tr><tr><td>Filter Column (Plasmid Maxiprep Kit)</td><td>Life Technologies (Invitrogen)</td><td>K2100-26</td><td></td></tr><tr><td>Glacial Acetic Acid</td><td>Sigma-Aldrich</td><td>A6283</td><td>Irritating</td></tr><tr><td>Glucose</td><td>Sigma-Aldrich</td><td>G5400</td><td></td></tr><tr><td>Glycogen&amp;nbsp;</td><td>Roche</td><td>10901393001</td><td></td></tr><tr><td>High-fidelity DNA Polymerase</td><td>New England BioLabs</td><td>M0491S</td><td></td></tr><tr><td>Isoamyl Alcohol</td><td>Sigma-Aldrich</td><td>I9392</td><td>Flammable</td></tr><tr><td>Isopropanol&amp;nbsp;</td><td>Amresco</td><td>0918</td><td>Flammable</td></tr><tr><td>LB Broth</td><td>Life Technologies (Invitrogen)</td><td>12795-027</td><td></td></tr><tr><td>Lithium Chloride</td><td>Sigma-Aldrich</td><td>L9650</td><td></td></tr><tr><td>Lysozyme</td><td>Amresco</td><td>0663</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Sigma-Aldrich</td><td>M8266</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Life Technologies (Invitrogen)</td><td>18080-044</td><td></td></tr><tr><td>Mung Bean Nuclease</td><td>New England BioLabs</td><td>M0250S</td><td></td></tr><tr><td>Needle (18G, 20G)</td><td>BD</td><td>305196, 305175</td><td>Biohazardous (Sharps waste)</td></tr><tr><td>NotI</td><td>New England BioLabs</td><td>R0189S</td><td></td></tr><tr><td>Oligonucleotide</td><td>Integrated DNA Technologies</td><td>Custom Oligonucleotide Synthesis</td><td></td></tr><tr><td>PacI</td><td>New England BioLabs</td><td>R0547S</td><td></td></tr><tr><td>pBeloBAC11</td><td>New England BioLabs</td><td>ER2420S (E4154S)</td><td></td></tr><tr><td>Phenol (Buffer-Saturated)</td><td>Life Technologies (Invitrogen)</td><td>15513-039</td><td>Toxic and highly corrosive</td></tr><tr><td>Phenol:Chloroform:Isoamyl Alcohol</td><td>Life Technologies (Invitrogen)</td><td>15593-031</td><td>Toxic and highly corrosive</td></tr><tr><td>Phenol:Guanidine Isothiocyanate</td><td>Life Technologies (Ambion)</td><td>10296-010</td><td>Toxic, corrosive, and irritating</td></tr><tr><td>Pme I</td><td>New England BioLabs</td><td>R0560S</td><td></td></tr><tr><td>Potassium Acetate</td><td>Amresco</td><td>0698</td><td></td></tr><tr><td>RNase Inhibitor</td><td>Life Technologies (Invitrogen)</td><td>10777-019</td><td></td></tr><tr><td>rNTP Set</td><td>GE Healthcare Life Sciences</td><td>27-2025-01</td><td></td></tr><tr><td>Sealable Polypropylene Tube (16 &amp;times; 76 mm)&amp;nbsp;</td><td>Beckman Coulter</td><td>342413</td><td></td></tr><tr><td>SfiI</td><td>New England BioLabs</td><td>R0123S</td><td></td></tr><tr><td>Sma I</td><td>New England BioLabs</td><td>R0141S</td><td></td></tr><tr><td>Sodium Acetate</td><td>Sigma-Aldrich</td><td>S2889</td><td></td></tr><tr><td>Sodium Dodecyl Sulfate</td><td>Amresco</td><td>0227</td><td></td></tr><tr><td>Sodium Hydroxide</td><td>Sigma-Aldrich</td><td>S5881</td><td></td></tr><tr><td>SP6 RNA Polymerase</td><td>New England BioLabs</td><td>M0207S</td><td></td></tr><tr><td>Spin Column (Plasmid Miniprep Kit)</td><td>Life Technologies (Invitrogen)</td><td>K2100-11</td><td></td></tr><tr><td>Syringe</td><td>HSW NORM-JECT</td><td>4200.000V0</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England BioLabs</td><td>M0202S</td><td></td></tr><tr><td>Tris</td><td>Amresco</td><td>0826</td><td></td></tr><tr><td>tRNA (yeast)</td><td>Life Technologies (Invitrogen)</td><td>15401-011</td><td></td></tr><tr><td>XbaI&amp;nbsp;</td><td>New England BioLabs</td><td>R0145S</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;2. Cell Culture&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Alpha Minimal Essential Medium</td><td>Life Technologies (Gibco)</td><td>12561-049</td><td></td></tr><tr><td>Conical Tube (50 mL)</td><td>VWR</td><td>21008-242</td><td></td></tr><tr><td>Crystal Violet&amp;nbsp;</td><td>Sigma-Aldrich</td><td>C0775</td><td></td></tr><tr><td>Culture Dish (150 mm)&amp;nbsp;</td><td>TPP</td><td>93150&amp;nbsp;</td><td></td></tr><tr><td>Cuvette (2-mm Gap)</td><td>Harvard Apparatus</td><td>450125&amp;nbsp;</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Life Technologies (Gibco)</td><td>16000-044</td><td></td></tr><tr><td>Formaldehyde</td><td>Sigma-Aldrich</td><td>F1635</td><td>Toxic and carcinogenic</td></tr><tr><td>Glutamine</td><td>Life Technologies (Gibco)</td><td>25030-081</td><td></td></tr><tr><td>Minimal Essential Medium</td><td>Life Technologies (Gibco)</td><td>61100-061</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Life Technologies (Gibco)</td><td>15070-063</td><td></td></tr><tr><td>Potassium Chloride</td><td>Sigma-Aldrich</td><td>P3911</td><td></td></tr><tr><td>Potassium Phosphate Monobasic</td><td>Sigma-Aldrich</td><td>P9791</td><td></td></tr><tr><td>Six-Well Plate</td><td>TPP</td><td>92006</td><td></td></tr><tr><td>Sodium Chloride</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>Sodium Phosphate Dibasic</td><td>Sigma-Aldrich</td><td>S3264</td><td></td></tr><tr><td>Trypsin-EDTA (0.25%)</td><td>Life Technologies (Gibco)</td><td>25200-056</td><td></td></tr><tr><td>Vitamins</td><td>Sigma-Aldrich</td><td>M6895</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;3. Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Agarose Gel Electrophoresis System</td><td>Mupid</td><td>MPDEXU-01</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Incubator</td><td>Thermo Scientific</td><td>Heracell 150i</td><td></td></tr><tr><td>Desktop Centrifuge&amp;nbsp;</td><td>Thermo Scientific</td><td>ST16R</td><td></td></tr><tr><td>Electroporator</td><td>Harvard Apparatus</td><td>ECM 830</td><td></td></tr><tr><td>Longwave Ultraviolet Lamps (Handheld)</td><td>UVP</td><td>UVGL-58</td><td></td></tr><tr><td>Tabletop Centrifuge</td><td>Beckman Coulter</td><td>368826</td><td></td></tr><tr><td>Thermocycler</td><td>Life Technologies (Applied Biosystems)</td><td>GeneAmp PCR System 9700</td><td></td></tr><tr><td>Vortexer</td><td>Scientific Industries</td><td>G-560</td><td></td></tr><tr><td>Water Bath</td><td>Jeio Tech</td><td>WB-10E</td><td></td></tr></tbody></table>

bacterial artificial chromosomes: a functional genomics tool for the study of positive-strand rna viruses

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose genomes have the same polarity as cellular mRNA. The cDNA-based reverse genetics system is a seminal method that enables direct manipulation of the viral genomic RNA, thereby generating recombinant viruses for molecular and genetic studies of both viral RNA elements and gene products in viral replication and pathogenesis. It also provides a valuable platform that allows the development of genetically defined vaccines and viral vectors for the delivery of foreign genes. For many positive-strand RNA viruses such as Japanese encephalitis virus (JEV), however, the cloned cDNAs are unstable, posing a major obstacle to the construction and propagation of the functional cDNA. Here, the present report describes the strategic considerations in creating and amplifying a genetically stable full-length infectious JEV cDNA as a bacterial artificial chromosome (BAC) using the following general experimental procedures: viral RNA isolation, cDNA synthesis, cDNA subcloning and modification, assembly of a full-length cDNA, cDNA linearization, in vitro RNA synthesis, and virus recovery. This protocol provides a general methodology applicable to cloning full-length cDNA for a range of positive-strand RNA viruses, particularly those with a genome of &gt;10 kb in length, into a BAC vector, from which infectious RNAs can be transcribed in vitro with a bacteriophage RNA polymerase.

For all positive-strand RNA viruses, the reliability and efficiency of a reverse genetics system depend on the genetic stability of a cloned full-length cDNA, whose sequence is equivalent to the consensus sequence of viral genomic RNA.27 Figure 1 shows a five-step strategy for the construction of a full-length infectious cDNA as a BAC for JEV SA14-14-228: Step 1, purification of viral RNA from the cell culture supernatant of JEV-infected BHK-21 cells (Figure 1A); Step 2, synthesis of four overlapping cDNA amplicons (F1 to F4) spanning the whole viral genome (Figure 1B); Step 3, subcloning of each of the four contiguous cDNA fragments into a BAC vector, creating pBAC/F1 to pBAC/F4 (Figure 1C); Step 4, modification of the cloned cDNAs for in vitro run-off transcription with SP6 RNA polymerase, i.e., placing an SP6 promoter sequence immediately upstream of the viral 5'-end (pBAC/F1SP6), eliminating a pre-existing internal Xba I site at nucleotide 9131 by introducing a silent point mutation, A9134→T (pBAC/F3KO), and inserting a new artificial Xba I run-off site immediately downstream of the viral 3'-end (pBAC/F4RO) (Figure 1D); and Step 5, assembly of a full-length SA14-14-2 cDNA BAC, pBAC/SA14-14-2 (Figure 1E). Table 1 lists the oligonucleotides used in this cloning procedure.28
For the construction of a functional JEV cDNA, the first important step is the synthesis of the four overlapping cDNA fragments using the purified viral RNA as a template for RT-PCR. Figure 2 provides a representative result for the four RT-PCR products that were electrophoresed on a 0.8% agarose gel. This gel demonstrates clearly that a full-length JEV cDNA is amplified into four overlapping cDNA fragments. Occasionally, RT-PCR reactions might yield one or more additional virus-specific or nonspecific products that are mostly smaller than the expected product, because of the nonspecific annealing of primers during cDNA synthesis/amplification. On the other hand, little or no expected RT-PCR product would be amplified because of accidental RNase contamination during the viral RNA isolation or improper RT-PCR performance.
The next key step is the cloning and modification of a partial- or full-length JEV cDNA in BAC, which is a relatively straightforward procedure that uses standard recombinant DNA techniques.69 Figure 3 presents a representative outcome for the purification of the BAC clone containing a full-length cDNA of JEV SA14-14-2 by banding in a CsCl-EtBr gradient. In this experiment, after centrifugation for 16 hr at 401,700 × g, two distinct bands, i.e., the E. coli chromosomal DNA above and the supercoiled BAC plasmid DNA below, are visible in the middle of the tube under long-wave ultraviolet light. A minimal volume (~400 µl) of the lower BAC DNA band was carefully collected by poking a hole with a syringe on the side of the tube. Subsequently, the EtBr was extracted from the BAC DNA by butanol extraction, and the EtBr-free BAC DNA was concentrated by ethanol precipitation.
The final step is the determination of the specific infectivity of the synthetic RNAs transcribed in vitro from the full-length SA14-14-2 BAC (pBAC/SA14-14-2) after RNA transfection into permissive cells (Figure 4). This step involves three sequential steps: Step 1, linearization of the full-length SA14-14-2 cDNA at the 3'-end of the viral genome (Figure 4A); Step 2, production of synthetic RNAs from the linearized cDNA by run-off transcription (Figure 4B); and Step 3, rescue of the recombinant viruses in BHK-21 cells transfected with the synthetic RNAs (Figure 4C). Experimentally, two independent clones of pBAC/SA14-14-2 were linearized with Xba I digestion and treated with MBN to remove the four-base 5' overhang generated by the Xba I digestion. The linearized BACs were cleaned up by phenol-chloroform extraction, followed by ethanol precipitation. The linearization of the two purified BACs was demonstrated on a 0.8% agarose gel (Figure 5A). The phenol-chloroform extraction must be done carefully to ensure that the linearized BACs are RNase-free. Each of the two linearized BACs served as a cDNA template for run-off transcription using SP6 RNA polymerase in the presence of the m7G(5')ppp(5')A cap analog. The integrity of the synthetic RNAs was shown by running aliquots of the two transcription reaction mixtures on a 0.6% agarose gel, along with a reference 1 kb DNA ladder (Figure 5B). In this simple assay, the major prominent RNA band always migrated just below the 3 kb reference DNA band and appeared to be sharp. However, degraded RNA would have a smeared appearance on the same gel.
An infectious center assay is the gold standard for determining the specific infectivity of the synthetic RNAs. This assay was done by electroporating BHK-21 cells with RNA samples, seeding equal aliquots of the 10-fold serially diluted electroporated cells in 6-well plates containing naïve BHK-21 cells (3 × 105 cells/well), and overlaying agarose onto the cell monolayers. After incubation for 4 days, surviving cells were fixed with formaldehyde and stained with a crystal violet solution to quantify the number of infectious centers (plaques), which corresponds to the number of infectious RNA molecules delivered into the cells (Figure 6A). Since the cDNA template used for in vitro transcription has been proven to be non-infectious,27 an aliquot of the transcription reaction mixture was directly used for electroporation. Electroporation is the preferred method for RNA transfection; alternatively, RNAs can be transfected by other methods using DEAE-dextran and cationic liposomes. RNA electroporation is very effective, but "arcing" of the electric pulse occurs rarely if salts are present in the electroporation reaction or if the electroporation cuvette is reused. The expression of viral proteins in RNA-transfected cells was examined by immunofluorescence assays using an anti-NS1 rabbit antiserum (Figure 6B). The production of viral particles accumulated in the supernatants of RNA-transfected cells was analyzed by plaque assays (Figure 6C). The results of these experiments show clearly that the cDNA-derived synthetic RNAs are infectious in permissive BHK-21 cells, generating a high titer of recombinant viruses.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Oligonucleotide</td>
			<td>Sequencea (5' to 3')</td>
			<td>Positionb</td>
			<td>Polarity</td>
		</tr>
		<tr>
			<td>1RT</td>
			<td>TAGGGATCTGGGCGTTTCTG 
			GCAAAT</td>
			<td>2578–2603</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>1F</td>
			<td>aatcccgggAGAAGTTTATC 
			TGTGTGAACTT</td>
			<td>1–22</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>1R</td>
			<td>attgcggccgcCCACGTCGT 
			TGTGCACGAAGAT</td>
			<td>2532–2553</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>2RT</td>
			<td>TTCTGCCTACTCTGCCCCTC 
			CGTTGA</td>
			<td>5975–6000</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>2F</td>
			<td>aatcccgggTCAAGCTCAGT 
			GATGTTAACAT</td>
			<td>1800–1821</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>2R</td>
			<td>attgcggccgcGATGGGTTT 
			CCGAGGATGACTC</td>
			<td>5929–5950</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>3RT</td>
			<td>ACGGTCTTTCCTTCTGCTGC 
			AGGTCT</td>
			<td>9426–9451</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>3F</td>
			<td>aatcccgggGAGGATACATT 
			GCTACCAAGGT</td>
			<td>5500–5521</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>3R</td>
			<td>attgcggccgcGTAAGTCAG 
			TTCAATTATGGCT</td>
			<td>9380–9401</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>4RT</td>
			<td>AGATCCTGTGTTCTTCCTCA 
			CCACCA</td>
			<td>10952–10977</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>4F</td>
			<td>aatcccgggAGTGGAAGGCT 
			CAGGCGTCCAA</td>
			<td>9200–9221</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>4R</td>
			<td>attgcggccgcAGATCCTGT 
			GTTCTTCCTCACC</td>
			<td>10956–10977</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>SP6F</td>
			<td>cataccccgcgtattcccac 
			ta</td>
			<td></td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>SP6R</td>
			<td>ACAGATAAACTTCTctatag 
			tgtcccctaaa</td>
			<td>1–14</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>F1F</td>
			<td>aggggacactatagAGAAGT 
			TTATCTGTGTG</td>
			<td>1–17</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>F1R</td>
			<td>TGGATCATTGCCCATGGTAA 
			GCTTA</td>
			<td>638–662</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>X1F</td>
			<td>CGAATGGATCGCACAGTGTG 
			GAGAG</td>
			<td>8403–8427</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>X1R</td>
			<td>AAAGCTTCAAACTCAAGATA 
			CCGTGCTCC</td>
			<td>9120–9148</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>X2F</td>
			<td>GGAGCACGGTATCTTGAGTT 
			TGAAGCTTT</td>
			<td>9120–9148</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>X2R</td>
			<td>cacgtggacgagggcatgcc 
			tgcag</td>
			<td></td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td>ROF</td>
			<td>CCAGGAGGACTGGGTTACCA 
			AAGCC</td>
			<td>10670–10694</td>
			<td>Sense</td>
		</tr>
		<tr>
			<td>ROR</td>
			<td>agggcggccgctctagAGAT 
			CCTGTGTTCTTCCTCACCAC</td>
			<td>10954–10977</td>
			<td>Antisense</td>
		</tr>
		<tr>
			<td colspan="4">aJEV sequences are shown in uppercase letters, and BAC sequences are indicated in lowercase letters. 
			bNucleotide position refers to the complete genome sequence of JEV SA14-14-2 (Genbank accession number JN604986).</td>
		</tr>
	</tbody>
</table>
Table 1: Oligonucleotides used for cDNA synthesis, PCR amplification, and BAC mutagenesis.
<img alt="Viral RNA to cDNA synthesis diagram, JEV genomic process, subcloning, modification steps." src="/files/ftp_upload/53164/53164fig1.jpg" data-altupdatedat="1747911167000" data-alt="Figure 1"> 
Figure 1. Strategy for the construction of a full-length cDNA of JEV SA14-14-2 as a BAC. (A) Isolation of viral RNA from JEV particles. Shown is a schematic diagram of the genomic RNA of JEV SA14-14-2. (B) Synthesis of four overlapping cDNA fragments (F1 to F4) covering the entire viral genome. (C) Subcloning of four overlapping cDNA fragments into a BAC vector, creating pBAC/F1 to pBAC/F4. (D) Modification of the cloned cDNAs for run-off transcription in vitro. pBAC/F1SP6 is a derivative of pBAC/F1 that contains the SP6 promoter sequence upstream of the viral 5'-end. pBAC/F3KO is a derivative of pBAC/F3 that contains a silent point mutation (A9134→T, asterisk). pBAC/F4RO is a derivative of pBAC/F4 that contains an artificial Xba I run-off site downstream of the viral 3'-end. (E) Assembly of a full-length SA14-14-2 BAC (pBAC/SA14-14-2). <a href="https://www.jove.com/files/ftp_upload/53164/53164fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Agarose gel electrophoresis result, DNA bands, size markers, ladder; DNA fragment analysis." src="/files/ftp_upload/53164/53164fig2.jpg" data-altupdatedat="1747911167000" data-alt="Figure 2"> 
Figure 2. Synthesis of four overlapping cDNA fragments (F1 to F4) spanning the full-length genomic RNA of JEV SA14-14-2. The four RT-PCR products are evaluated by electrophoresis in a 0.8% agarose gel. M, 1 kb DNA ladder. The expected sizes of the four cDNA fragments are indicated at the bottom of the gel image. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Cesium chloride density gradient centrifugation diagram; DNA, RNA separation bands marked." src="/files/ftp_upload/53164/53164fig3.jpg" data-altupdatedat="1747911167000" data-alt="Figure 3"> 
Figure 3. Purification of the BAC containing a full-length cDNA of JEV SA14-14-2. The BAC plasmid is isolated from E. coli DH10B by the SDS-alkaline lysis method and further purified by banding in a CsCl-EtBr gradient. Presented is an example of the CsCl-EtBr gradient using a 16 × 76 mm sealable polypropylene tube. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="cDNA linearization, in vitro RNA synthesis diagram, RNA transfection; virus recovery in BHK-21 cells." src="/files/ftp_upload/53164/53164fig4.jpg" data-altupdatedat="1747911167000" data-alt="Figure 4"> 
Figure 4. Overview of the recovery of infectious viruses from a full-length JEV SA14-14-2 cDNA assembled in a BAC. (A) Linearization of the cDNA template. The full-length JEV BAC is cut with Xba I and treated with MBN. (B) Synthesis of the RNA transcripts. The linearized cDNA is transcribed by SP6 RNA polymerase in the presence of the m7G(5')ppp(5')A cap analog. (C) Recovery of the synthetic JEVs. The in vitro transcribed RNAs are transfected into BHK-21 cells by electroporation, which generates a high titer of synthetic virus. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="cDNA and RNA transcription gel electrophoresis results; DNA ladder, molecular weight markers." src="/files/ftp_upload/53164/53164fig5.jpg" data-altupdatedat="1747911167000" data-alt="Figure 5"> 
Figure 5. Synthesis of the RNAs by in vitro transcription using a full-length JEV BAC as a cDNA template. (A) Generation of the linearized full-length JEV BAC, pBAC/SA14-14-2. Two independent clones of pBAC/SA14-14-2 (Cl.1 and Cl.2) are linearized by digestion with Xba I and subsequent treatment with MBN. The linearized BACs are examined by electrophoresis in a 0.8% agarose gel. (B) Production of the synthetic RNAs by run-off transcription. Each of the two linearized BACs is used as a template for SP6 RNA polymerase run-off transcription. Aliquots of the two transcription reactions are run on a 0.6% agarose gel. M, 1 kb DNA ladder. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="RNA infectivity and virus yield analysis; bar graphs, cell imaging, plaque assay results." src="/files/ftp_upload/53164/53164fig6.jpg" data-altupdatedat="1747911167000" data-alt="Figure 6"> 
Figure 6. Specific infectivity of the synthetic RNAs transcribed from a full-length JEV BAC and the recovery of synthetic virus. BHK-21 cells are mock-electroporated (Mock) or electroporated with the RNA transcripts derived from each of the two independent clones of the full-length JEV BAC (Cl.1 and Cl.2). (A) RNA infectivity. The cells are overlaid with agarose and stained with crystal violet at 4 days post-transfection. RNA infectivity is determined by infectious center assays to estimate the amount of infectious RNA electroporated into the cells (left panel). Also, representative images of infectious centers are shown (right panel). (B) Protein expression. The cells are cultured in 4-well chamber slides. Viral protein expression in RNA-electroporated cells at 20 hr post-transfection (hpt) is analyzed by immunofluorescence assays using a primary anti-NS1 rabbit antiserum and a secondary Cy3-conjugated goat anti-rabbit IgG (red). The nuclei are counterstained with 4',6-diamidino-2-phenylindole (blue). The immunofluorescence images are overlaid on their corresponding differential interference contrast images. (C) Virus yield. The cells are cultured in 150 mm culture dishes. The production of infectious virions accumulated in the culture supernatants of RNA-electroporated cells at 22 and 40 hpt is examined by plaque assays. <a href="https://www.jove.com/files/ftp_upload/53164/53164fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses at JoVE.com

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Reverse genetics, an approach to rescue infectious virus entirely from a cloned cDNA, has revolutionized the field of positive-strand RNA viruses, whose ...

bacterial-artificial-chromosomes-functional-genomics-tool-for-study

Research

JoVE Journal

Immunology and Infection

21.3K Views.  Utah State University. Here, a protocol is presented for creating an infectious bacterial artificial chromosome containing a full-length cDNA of the positive-strand genomic RNA of Japanese encephalitis virus. This protocol can be used to construct a functional cDNA of other positive-strand RNA viruses, making it a powerful genomic tool for studying virus biology.

Video: Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Reverse Genetics to Engineer Positive-Sense RNA Virus Variants

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA viruses. By integrating a full RNA genome error-prone PCR and reverse genetics, random genome-wide substitution mutagenesis can be induced. We have developed a method using this technique to synthesize diverse libraries to identify viral mutants with phenotypes of interest. This method, called full-length mutant RNA synthesis (FL-MRS), offers the following advantages: (i) the ability to create a large library via a highly efficient one-step error-prone PCR; (ii) the ability to create groups of libraries with varying levels of genetic diversity by manipulating the fidelity of DNA polymerase; (iii) the creation of a full-length PCR product that can directly serve as a template for mutant RNA synthesis; and (iv) the ability to create RNA that can be delivered into host cells as a non-selected input pool to screen for viral mutants of the desired phenotype. We have found, using a reverse genetics approach, that FL-MRS is a reliable tool to study viral-directed evolution at all stages in the life cycle of the hepatitis C virus, JFH1 isolate. This technique appears to be an invaluable tool to employ directed evolution to understand adaptation, replication, and the role of viral genes in pathogenesis and antiviral resistance in positive-sense RNA viruses.

The protocol describes a method for introducing controllable genetic diversity in the hepatitis C virus genome by combining full-length mutant RNA synthesis using error-prone PCR and reverse genetics. The method provides a model for phenotype selection and can be used for 10 kb long positive-sense RNA virus genomes.

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA ...

Genetics

Generation and Assembly of Virus-Specific Nucleocapsids of the Respiratory Syncytial Virus

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and assay development in virology. The RNA template of nonsegmented negative-sense (NNS) RNA viruses, such as the respiratory syncytial virus (RSV), is not an RNA molecule alone but rather a nucleoprotein (N) encapsidated ribonucleoprotein complex. Despite the importance of the authentic RNA template, the generation and assembly of such a ribonucleoprotein complex remain sophisticated and require in-depth elucidation. The main challenge is that the overexpressed RSV N binds non-specifically to cellular RNAs to form random nucleocapsid-like particles (NCLPs). Here, we established a protocol to obtain RNA-free N (N0) first by co-expressing N with a chaperone phosphoprotein (P), then assembling N0 with RNA oligos with the RSV-specific RNA sequence to obtain virus-specific nucleocapsids (NCs). This protocol shows how to overcome the difficulty in the preparation of this traditionally challenging viral ribonucleoprotein complex.

For in-depth mechanistic analysis of the respiratory syncytial virus (RSV) RNA synthesis, we report a protocol of utilizing the chaperone phosphoprotein (P) for coexpression of the RNA-free nucleoprotein (N0) for subsequent in vitro assembly of the virus-specific nucleocapsids (NCs).

The use of an authentic RNA template is critical to advance the fundamental knowledge of viral RNA synthesis that can guide both mechanistic discovery and ...

Biochemistry

Modeling The Lifecycle Of Ebola Virus Under Biosafety Level 2 Conditions With Virus-like Particles Containing Tetracistronic Minigenomes

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or specific treatments for the disease caused by these viruses, and work with infectious Ebola viruses is restricted to biosafety level 4 laboratories, significantly limiting the research on these viruses. Lifecycle modeling systems model the virus lifecycle under biosafety level 2 conditions; however, until recently such systems have been limited to either individual aspects of the virus lifecycle, or a single infectious cycle. Tetracistronic minigenomes, which consist of Ebola virus non-coding regions, a reporter gene, and three Ebola virus genes involved in morphogenesis, budding, and entry (VP40, GP1,2, and VP24), can be used to produce replication and transcription-competent virus-like particles (trVLPs) containing these minigenomes. These trVLPs can continuously infect cells expressing the Ebola virus proteins responsible for genome replication and transcription, allowing us to safely model multiple infectious cycles under biosafety level 2 conditions. Importantly, the viral components of this systems are solely derived from Ebola virus and not from other viruses (as is, for example, the case in systems using pseudotyped viruses), and VP40, GP1,2 and VP24 are not overexpressed in this system, making it ideally suited for studying morphogenesis, budding and entry, although other aspects of the virus lifecycle such as genome replication and transcription can also be modeled with this system. Therefore, the tetracistronic trVLP assay represents the most comprehensive lifecycle modeling system available for Ebola viruses, and has tremendous potential for use in investigating the biology of Ebola viruses in future. Here, we provide detailed information on the use of this system, as well as on expected results.

Work with infectious Ebola viruses is restricted to biosafety level 4 laboratories. Tetracistronic minigenome-containing replication and transcription-competent virus like particles (trVLPs) represent a lifecycle modeling system that allows us to safely model multiple infectious cycles under biosafety level 2 conditions, relying exclusively on Ebola virus components.

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or ...

Combining Analysis of DNA in a Crude Virion Extraction with the Analysis of RNA from Infected Leaves to Discover New Virus Genomes

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low titers in their host or cannot be mechanically inoculated to another host are difficult to propagate to achieve a greater titer of infectious material. Infected leaves are ground in a mild buffer with optimal pH and ionic composition recommended for purifying most bacilliform Para retroviruses. Urea is used to break up inclusion bodies that trap virions and to dissolve cellular components. Differential centrifugation provides further separation of virions from plant contaminants. Then proteinase K treatment removes the capsids. Then the viral DNA is concentrated and used for next-generation sequencing (NGS). The NGS data are used to assemble contigs which are submitted to NCBI-BLASTn to identify a subset of virus sequences in the generated dataset. In a parallel pipeline, RNA is isolated from infected leaves using a standard column-based RNA extraction method. Then ribosome depletion is carried out to enrich for a subset of mRNA and virus transcripts. Assembled sequences derived from RNA sequencing (RNA-seq) were submitted to NCBI-BLASTn to identify a subset of virus sequences in this dataset. In our study, we identified two related full-length badnavirus genomes in the two datasets. This method is preferred to another common approach which extracts the aggregate population of small RNA sequences to reconstitute plant virus genomic sequences. This latter metagenomic pipeline recovers virus related sequences that are retro-transcribing elements inserted into the plant genome. This is coupled to biochemical or molecular assays to further discern the actively infectious agents. The approach documented in this study, recovers sequences representative of replicating viruses that likely indicate active virus infection.

Here we present a new approach to identify plant viruses with double-strand DNA genomes. We use standard methods to extract DNA and RNA from infected leaves and carry out next-generation sequencing. Bioinformatic tools assemble sequences into contigs, identify contigs representing virus genomes and assign genomes to taxonomic groups.

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low ...

Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. However, these screens are typically conducted in cells that are naturally permissive to the viral pathogen under study. Therefore, the robust replication of viruses in control conditions may limit the dynamic range of these screens. Furthermore, these screens may be unable to easily identify cellular defense pathways that restrict virus replication if the virus is well-adapted to the host and capable of countering antiviral defenses. In this article, we describe a new paradigm for exploring virus-host interactions through the use of screens that center on naturally abortive infections by arboviruses such as vesicular stomatitis virus (VSV). Despite the ability of VSV to replicate in a wide range of dipteran insect and mammalian hosts, VSV undergoes a post-entry, abortive infection in a variety of cell lines derived from lepidopteran insects, such as the gypsy moth (Lymantria dispar). However, these abortive VSV infections can be &#34;rescued&#34; when host cell antiviral defenses are compromised. We describe how VSV strains encoding convenient reporter genes and restrictive L. dispar cell lines can be paired to set-up screens to identify host factors involved in arbovirus restriction. Furthermore, we also show the utility of these screening tools in the identification of virally encoded factors that rescue VSV replication during coinfection or through ectopic expression, including those encoded by mammalian viruses. The natural restriction of VSV replication in L. dispar cells provides a high signal-to-noise ratio when screening for the conditions that promote VSV rescue, thus enabling the use of simplistic luminescence- and fluorescence-based assays to monitor the changes in VSV replication. These methodologies are valuable for understanding the interplay between host antiviral responses and viral immune evasion factors.

Here, we present the protocols to identify 1) virus-encoded immunomodulators that promote arbovirus replication and 2) eukaryotic host factors that restrict arbovirus replication. These fluorescence- and luminescence-based methods allow researchers to rapidly obtain quantitative readouts of arbovirus replication in simplistic assays with low signal-to-noise ratios.

RNA interference- and genome editing-based screening platforms have been widely used to identify host cell factors that restrict virus replication. ...

Confocal Imaging of Double-Stranded RNA and Pattern Recognition Receptors in Negative-Sense RNA Virus Infection

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors (PRRs) such as the retinoic acid (RIG-I) like receptors (RLRs) RIG-I and melanoma differentiation-associated protein 5 (MDA-5) leads to the induction of the innate immune response. The formation and intracellular distribution of dsRNA in positive-sense RNA virus infection has been well characterized by microscopy. Many negative-sense RNA viruses, including some arenaviruses, trigger the innate immune response during infection. However, negative-sense RNA viruses were thought to produce low levels of dsRNA, which hinders the imaging study of PRR recognition of viral dsRNA. Additionally, infection experiments with highly pathogenic arenaviruses must be performed in high containment biosafety level facilities (BSL-4). The interaction between viral RNA and PRRs for highly pathogenic RNA virus is largely unknown due to the additional technical challenges that researchers need to face in the BSL-4 facilities. Recently, a monoclonal antibody (Mab) (clone 9D5) originally used for pan-enterovirus detection has been found to specifically detect dsRNA with a higher sensitivity than the traditional J2 or K1 anti-dsRNA antibodies. Herein, by utilizing the 9D5 antibody, we describe a confocal microscopy protocol that has been used successfully to visualize dsRNA, viral protein and PRR simultaneously in individual cells infected by arenavirus. The protocol is also suitable for imaging studies of dsRNA and PRR distribution in pathogenic arenavirus infected cells in BSL4 facilities.

Double-stranded RNA produced during RNA virus replication can be recognized by pattern recognition receptors to induce an innate immune response. For negative-sense RNA viruses, the interaction between the low-level dsRNA and PRRs remains unclear. We have developed a confocal microscopy method to visualize arenavirus dsRNA and PRR in individual cells.

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors ...

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Podsumowanie

Przeglądaj więcej filmów

PLAYLIST