Name: genome editing in astyanax mexicanus using transcription activator-like effector nucleases (talens)
Uploaded: 2016-06-20T14:00:00.000+00:00
Duration: 7 min 42 s
Description: Watch this Scientific Journal Video about Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs at JoVE.com

This work was funded by the Department of Genetics, Development and Cell Biology and Iowa State University and by NIH grant EY024941 (WJ).Dr. Jeffrey Essner provided comments on the manuscript.

All animal procedures were in accordance with the guidelines of the National Institutes of Health and were approved by the Institutional Animal Care and Use Committee at Iowa State University and the University of Maryland.
1. TALEN Design
<ol>
	<li>Input desired target sequence to a TALEN design website. (For example: <a href="https://tale-nt.cac.cornell.edu/node/add/talen">https://tale-nt.cac.cornell.edu/node/add/talen</a>). Input chosen spacer/repeat array lengths.
	<ol>
		<li>Copy the genomic sequence into the box labeled &#34;Sequence&#34;.</li>
		<li>Within the &#34;Provide Custom Spacer/RVD Lengths&#34; tab select the spacer length and array length. 
		Note: Spacer lengths of 15 base pairs and repeat array lengths of 15-17 work well and make assembly less complex.</li>
	</ol>
	</li>
	<li>Select a TALEN pair. TALEN pairs designed around a unique restriction enzyme site allow for genotyping by restriction enzyme digesting a PCR product.</li>
	<li>Design primers to amplify the genomic region surrounding the TALEN target site using a website such as Primer330-32. When genotyping with a restriction enzyme, design primers to amplify a region that contains the restriction enzyme site only once. It is recommended that this region is amplified and sequenced prior to TALEN construction to identify any polymorphisms present in the A. mexicanus lab population to be used for microinjection.</li>
</ol>
2. TALEN Assembly (Modified from the TALEN Kit Protocol)33,34
For additional details and troubleshooting, see the protocol34.
<ol>
	<li>Prepare and sequence necessary plasmids from the TALEN kit according to the manufacturer&#39;s instructions.</li>
	<li>Set up the #1 reactions for reactions A and B. Include repeat-variable diresidues (RVDs) 1-10 and the destination vector pFUS_A in Reaction A. Include RVDs 11-(N-1) and the destination vector pFUS_B(N-1) in Reaction B where N is the total number of RVDs in the TALEN.
	<ol>
		<li>Add to each reaction: 1 &#181;l of each plasmid containing each RVD (100 ng/&#181;l), the destination vector (100 ng/&#181;l), 1 &#181;l BsaI restriction enzyme, 1 &#181;l Bovine Serum Albumin (BSA) (2 mg/ml), 1 &#181;l ligase, 2 &#181;l of 10x ligase buffer and x &#181;l of water for a total volume of 20 &#181;l. For example, see Table 1. 
		Note: Half reactions can also be used.</li>
		<li>Place reactions in a thermocycler and run the cycle: 10x (37 &#176;C/5 min + 16 &#176;C/10 min) + 50 &#176;C/5 min + 80 &#176;C/5 min.</li>
	</ol>
	</li>
	<li>Incubate the reactions with nuclease. To each reaction add 1 &#181;l 25 mM ATP and 1 &#181;l nuclease. Incubate reactions at 37 &#176;C for 1 hr.</li>
	<li>Transform Reactions.
	<ol>
		<li>Transform 2.5 &#181;l of each reaction into 25 &#181;l chemically competent cells. 
		Note: Homemade competent cells can be used. However, cells with low competence can result in lack of colonies.
		<ol>
			<li>Mix 2.5 &#181;l of the reaction with 25 &#181;l of chemically competent cells. Incubate on ice for five min. Incubate the cells for 30 sec at 42 &#176;C.</li>
			<li>Place the tubes on ice for 2 min. Add 125 &#181;l of Super Optimal broth with Catabolite repression (SOC). Shake the tubes at 37 &#176;C for 1 hr.</li>
		</ol>
		</li>
		<li>Plate 100 &#181;l of the transformed cells onto LB plates with spectinomycin (50 &#181;g/ml), X-gal and Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG). Grow O/N at 37 &#176;C.</li>
	</ol>
	</li>
	<li>Pick 2-3 white colonies for each reaction and check by colony PCR using primers pCR8_F1 and pCR8_R1 (Table 2).
	<ol>
		<li>Make a master mix of the reagents. For example, see Table 3.</li>
		<li>Pick a colony and smear it into the bottom of a PCR tube, and then put the remains of the colony into 2 ml LB with spectinomycin (50 &#181;g/ml). Place 15 &#181;l of the master mix into the tube with the colony.</li>
		<li>Run the following PCR program (Table 4)</li>
		<li>Check the PCR (run the entire volume) on a 1.5% agarose gel by electrophoresis. The correct clones will have a band at the expected size as well as a smear and a ladder of bands. For an example of the appropriate smear, see34,33.</li>
		<li>Grow 2 ml cultures of the correct clones in LB media O/N at 37 &#176;C in a shaking incubator.</li>
	</ol>
	</li>
	<li>Miniprep the plasmids according to the manufacturer&#39;s instructions.</li>
	<li>Sequence to check TALEN sequence with pCR8_F1 and pCR8_R1. Follow previously described methods35.</li>
	<li>Using the correct clones verified by sequencing, set up the reaction #2 (TALEN kit), which will place the RVDs from the A and B vectors and the final RVD into the destination vector.
	<ol>
		<li>Prepare mix for reaction 2 (Table 5). 
		Note: Half reactions can be used.</li>
		<li>Place the reactions in a thermocycler and run the following program: 37 &#176;C/10 min + 16 &#176;C/15 min + 37 &#176;C/15 min + 80 &#176;C/5 min.</li>
	</ol>
	</li>
	<li>Transform Reactions.
	<ol>
		<li>Transform 2.5 &#181;l of each reaction into 25 &#181;l chemically competent cells.
		<ol>
			<li>Mix 2.5 &#181;l of the reaction with 25 &#181;l of chemically competent cells. Incubate on ice for 5 min. Heat shock the cells for 30 sec at 42 &#176;C.</li>
			<li>Place the tubes on ice. Add 125 &#181;l of SOC. Place the tubes in a shaking incubator at 37 &#176;C for 1 hr.</li>
		</ol>
		</li>
		<li>Plate 100 &#181;l of the transformed cells onto LB plates with ampicillin (100 &#181;g/ml), X-gal and IPTG. Grow O/N at 37&#176; C.</li>
	</ol>
	</li>
	<li>Pick 1-3 white colonies for each reaction and check by colony PCR using primers TAL_F1 and TAL_R2 (Table 2).
	<ol>
		<li>Make a solution of the polymerase mastermix, water and primers as described in Table 3. Pick a colony and smear it into the bottom of a PCR tube, and then put the remains of the colony into 2 ml LB with ampicillin (100 &#181;g/ml). Place 15 &#181;l of the solution into the tube with the colony.</li>
		<li>Run the PCR program (Table 6).</li>
		<li>Check the PCR on a 1.5% agarose gel by electrophoresis. The correct clones will have a smearing and a ladder of bands. For an example of the appropriate smear, see34,33.</li>
		<li>Grow 2 ml cultures of the correct clones in LB media O/N at 37 &#176;C in a shaking incubator.</li>
	</ol>
	</li>
	<li>Miniprep the plasmids according to the manufacturer&#39;s instructions.</li>
	<li>Sequence to check TALEN sequence with TAL_F1 and TAL_R2 following previously described methods35.</li>
</ol>
3. mRNA Transcription of TALENs
<ol>
	<li>Digest 4 &#181;g of sequence-verified template with 2 &#181;l SacI for 2 hr at 37 &#176;C.</li>
	<li>Run 2 &#181;l of the SacI-digested plasmid on a 1.5% agarose gel by electrophoresis. Plasmids that are correctly digested will display a single band.</li>
	<li>Purify the remaining SacI-digested plasmid following the PCR purification kit protocol. Wash twice with the wash solution prior to elution. Elute into 30 &#181;l of nuclease-free water.</li>
	<li>Follow the standard protocol for T3 mRNA production.
	<ol>
		<li>Set up half reactions using 0.5 &#181;g of linearized template (prepared above). Incubate at 37 &#176;C for 2 hr.</li>
		<li>Add 0.5 &#181;l of DNase (included in kit) and incubate at 37 &#176;C for 15 min.</li>
	</ol>
	</li>
	<li>Purify the mRNA, following the manufacturer&#39;s instructions. Elute into 30 &#181;l nuclease-free water.</li>
	<li>Run a 1.5% agarose gel by electrophoresis to check the mRNA.
	<ol>
		<li>Clean the gel apparatus with a product to eliminate RNase contamination and prepare a 1.2% gel.</li>
		<li>Mix 1 &#181;l mRNA + 4 &#181;l nuclease-free water + 5 &#181;l glyoxyl loading dye. Incubate samples at 50 &#176;C for 30 min. Centrifuge the tubes briefly and place on ice before running the gel.</li>
	</ol>
	</li>
	<li>Check the concentration using a method of quantifying nucleic acid concentrations and store the RNA in aliquots at -80 &#176;C. Choose an aliquot size such that RNA is not frozen/thawed more than once. 
	Note: Concentrations of 500-1,000 ng/nl are typically obtained. RNA with a lower concentration can be used as long as RNA integrity is maintained (as assessed by a band rather than a smear on the gel).</li>
</ol>
4. Inject Astyanax mexicanus Embryos with TALEN mRNA
<ol>
	<li>Prepare Tools for Injection.
	<ol>
		<li>Pour injection plates by pouring 1.2% agarose in fish water (water conditioned with sodium bicarbonate and sea salt to pH 7.4 and conductivity 700 &#181;S) into a petri dish. Place a mold (plastic piece with projections to make wells for fish eggs) inside the dish. Remove the mold when the agarose has hardened and store at 4 &#176;C. For details on the mold see36.</li>
		<li>Pull needles for injection using a needle puller according to manufacturer&#39;s instructions. 
		Note: Appropriate needle length is important for injections. Needles that are too long will be too flexible for injections. The protocol for pulling needles will vary with the equipment used to pull needles. An example of an appropriate needle is shown in Figure 1. For our equipment, we pull needles that are 5-6 cm in length, and have an outer diameter at the tip of approximately 0.011 mm when broken. However, needles should be calibrated (step 4.3.4) to determine opening width. An example program for pulling needles can be found in Table 7.</li>
		<li>Prepare glass pipettes for embryo transfer by breaking the pipette so that the opening is large enough for an egg to pass through. Flame the broken end until it is no longer sharp. 
		Note: It is important to use glass pipettes and glass bowls when working with A. mexicanus eggs and embryos as they are sticky and will adhere to plastic.</li>
	</ol>
	</li>
	<li>Collect 1-cell Stage Eggs.
	<ol>
		<li>Breed A. mexicanus following standard protocols37. 
		Note: For example, if fish are maintained on a 14 light:10 dark cycle and using Zeitgerber time (ZT) with ZT0 as lights on and ZT14 as lights off, our surface fish spawn between ZT15 and ZT19. Exact spawning time must be determined for each individual lab.</li>
		<li>Induce spawning by overfeeding fish for 3-4 days prior to mating and placing fish into fresh water. Raise the temperature 2 &#176;F. Note: Our initial water temperature is approximately 74 &#176;F.</li>
		<li>Collect surface fish eggs in the dark, checking every 15 min to obtain eggs at the 1 cell stage. Hundreds of eggs can be obtained from a single pair of surface fish.</li>
		<li>Collect eggs in glass bowls to prevent sticking to plastic surfaces and sort to isolate embryos at the 1 cell stage prior to injection by observing eggs under the microscope and collecting eggs that are a single cell. Keep eggs in fresh system water (tank water in which adult fish are housed, which has been treated for pH and conductivity).</li>
	</ol>
	</li>
	<li>Inject TALEN mRNA.
	<ol>
		<li>Inject different amounts of total mRNA (equal amounts of each TALEN in the pair) to determine the optimal concentration for injection as toxicity and efficiency vary by TALEN pair. Start by injecting concentrations of total mRNA that are 400-800 pg. Dilute and combine mRNA to desired concentrations for injecting 1.5 nl.</li>
		<li>Load diluted mRNA into the back of the needle and attach the needle to a micro-injector.</li>
		<li>Break the needle using forceps.</li>
		<li>Calibrate the needle. For example, eject 10 times and collect the resulting drop in a micro capillary. For 10 x 100 disposable 1.0 &#181;l, 32 mm micro capillary, the drop should fill the micro capillary to 0.5 mm for 1.5 nl/1 injection. Adjust the injection time and pressure as needed.</li>
		<li>Insert the needle into the single cell and inject the mRNA. Inject the mRNA directly into the cell, not into the yolk.</li>
		<li>Collect injected embryos in glass bowls. Keep embryos at 23-25 &#176;C. Remove dead embryos (embryos that become cloudy and irregularly shaped) regularly for the first few days following injection. Record numbers of dead and deformed embryos from control (uninjected) and injected plates. 
		Note: Increased mRNA concentration can lead to increased toxicity and deformity/death of embryos. Thus, toxicity versus efficiency must be balanced to determine the best concentration of mRNA to inject.</li>
	</ol>
	</li>
</ol>
5. Phenotype Founder Fish and Evaluate TALEN Efficiency
<ol>
	<li>Sacrifice embryos according to institutional animal protocol. 
	Note: We euthanize embryos by rapid chilling on ice.</li>
	<li>Collect embryos into 0.8 &#181;l PCR strip tubes using a transfer pipette. 
	Note: Genotyping can be performed on individual embryos or pools of embryos.</li>
	<li>Extract DNA.
	<ol>
		<li>Place embryos into 100 &#181;l 50 mM sodium hydroxide (NaOH) and incubate at 95 &#176;C for 30 min, then cool to 4 &#176;C.</li>
		<li>Add 1/10th volume (10 &#181;l) of 1 M Tris-HCl pH 8.</li>
	</ol>
	</li>
	<li>Perform a PCR on the region using the primers designed in step 1.3 (see Tables 8 and 9 for sample protocols). For individual embryos 1 &#181;l of DNA is sufficient for the PCR reaction.</li>
	<li>Digest the resulting PCR product with the appropriate restriction enzyme and run a 1.5% agarose gel by electrophoresis.
	<ol>
		<li>For example, for genotyping the oculocutaneous albinism 2 (oca2) locus in injected embryos digest the PCR product using the restriction enzyme BsrI by adding 0.5 &#181;l of BsrI directly to 12.5 &#181;l of the completed PCR reaction, incubating at 65 &#176;C for 2 hr. Run the undigested and the digested product on a gel. Restriction enzyme resistant bands (i.e., bands that do not digest) indicate that TALEN-induced mutations are present (Figure 2).</li>
	</ol>
	</li>
	<li>(Optional) Calculate percentage mutation rate by determining the percentage of uncut product by analyzing images of gels in Fiji38 using the gel analysis tool to calculate the intensity value of each band as described previously29.</li>
	<li>Determine the sequence of mutant alleles by TA cloning the gel purified restriction enzyme resistant mutant band and sequencing clones.
	<ol>
		<li>Gel purify the restriction enzyme resistant mutant band following the manufacturer&#39;s instructions. TA clone the band following the manufacturer&#39;s instructions. Pick colonies and grow in 1.5 ml LB O/N at 37 &#176;C in a shaking incubator.</li>
		<li>Miniprep cultures following the manufacturer&#39;s instructions. Send the DNA for sequencing.</li>
		<li>Using a program such as ApE, align the mutant sequences to the wildtype sequence.
		<ol>
			<li>Copy and paste both sequences into ApE files. Choose the &#34;Align Two Sequences&#34; tool from the &#34;Tools&#34; menu.</li>
			<li>Specify the two DNA sequences using the dropdown menus. 
			Note: The reverse complement of the cloned sequence may need to be used depending on the direction the PCR went into the cloning vector. If the sequences do not align, repeat steps checking the &#34;Rev-Com&#34; box in the &#34;Align DNA&#34; box.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Evaluate founder fish for phenotypes at appropriate stage and using appropriate methods for the expected phenotype29 (For example, Figure 3). Methods of phenotyping will be based on the expected phenotype for the gene targeted by the researcher using the protocol.</li>
</ol>
6. Screen for Germline Transmission
Note: A. mexicanus reach sexual maturity at 4-8 months.
<ol>
	<li>Cross sexually mature founder fish to wild type fish.</li>
	<li>Screen embryos or adult fish using methods in steps 5.1-5.7 (Figure 4). For adult fish, a piece of the tail can be clipped following anesthetization.
	<ol>
		<li>Anesthetize fish by submerging fish in a solution of tricaine (3-aminobenzoic acid ethyl ester) to reduce stress during fin clipping. Following fin clipping, allow fish to recover in fresh water. Fish recover rapidly; observe until they have recovered (are swimming normally).</li>
	</ol>
	</li>
</ol>

The authors have nothing to disclose.

Great strides have been made in recent years towards understanding the genetic basis of the evolution of traits. While candidate genes underlying the evolution of a number of traits have been identified, it has remained challenging to test these genes in vivo due to the lack of genetic tractability of most evolutionarily interesting species. Here we report a method for genome editing in A. mexicanus, a species used to study the evolution of cave animals. Genetic mapping studies1,21,23 and candidate gene approaches19,40 have identified a number of candidate genes for the evolution of traits in the cave form of A. mexicanus. The recent publication of the cavefish genome41 provides an additional powerful tool for identifying candidate genes for the evolution of cave traits. Testing the function of many of these candidate genes requires techniques to reduce gene expression. The only current option for studying reduced gene expression in A. mexicanus is by the use of morpholinos. However, morpholino gene knockdown is transient, limited to a few days post fertilization, and is not useful for studying traits in adult animals, such as behavioral differences between adult cave and surface fish like schooling17, hyperphagia19 and vibration attraction behavior42. Generation of loss of function alleles of genes, such as those that can be made using TALENs, will be critical for testing the role of candidate genes for these traits.
Methods have been developed for easy assembly of TALEN pairs33 and the detailed protocol for this method is available34. This protocol was optimized for zebrafish use by Bedell et al.7, using a different final destination vector, pT3Ts-goldyTALEN (pT3TS-gT). This vector allows for transcription of TALEN mRNA for injection into single celled zebrafish embryos. We have used this modified assembly method, explained in detail here, to assemble and transcribe TALENs for injection into A. mexicanus. We found that when injected into single-celled surface A. mexicanus embryos, as described within this protocol, we could mutate A. mexicanus genes29. For future research on candidate genes not described in this protocol, sequences can be found in the cavefish genome41 and used to identify TALEN target sites.
Critical for successful injections is high quality TALEN mRNA. Thus, checking for RNA quality by running a small amount of RNA on a gel prior to injection is important (Step 3.6). Other precautions for maintaining RNA integrity, such as freezing aliquots to avoid freeze thaws (Step 3.7), and maintaining sterile conditions by using clean water and RNAse-free tubes and tips during injections (Step 4), should be taken. An additional critical step to raising injected fish is cleaning out dead embryos following injection, as dead embryos can rapidly affect water quality. Thus, we remove dead embryos the morning following injections, and periodically for the next few days following injections to maintain healthy live embryos (Step 4.3.6).
TALEN mutagenesis in Astyanax mexicanus can be highly efficient; however, efficiency varies depending on the TALEN pair injected29. Increased mRNA concentrations can lead to increased toxicity and deformity and death of injected embryos. Thus, toxicity versus efficiency must be tested and balanced to determine the optimal concentration of mRNA to inject. For highly efficient TALEN pairs, phenotypes may be assessed in injected founder fish. For example, injection of TALENs targeting oca2 resulted in albino patches in surface fish29 (Figure 3). For other traits or genes, however, assessment of phenotypes in founder fish may be challenging due to subtly of the phenotype or low efficiency of the TALEN pair injected. Thus, for many applications it will be desirable to generate germline mutations in a gene of interest for analysis of the role of a candidate gene in a non-mosaic animal. Obtaining germline transmission of TALEN-induced mutations in A. mexicanus is possible29 (Figure 4). Thus, this technique can be applied to evaluate other candidate genes.
A few limitations to performing genetic manipulations in Astyanax mexicanus exist at this time. Surface and cavefish breed in the dark, late in the night. In a laboratory where it is not possible to reverse the light dark cycle, researchers must come in late at night to perform injections, as it is critical to inject immediately after spawning. Additionally, it is important to collect surface fish embryos in the dark, as light will affect spawning.
Other techniques, in particular the CRISPR/Cas system (reviewed in43), exist for genome editing and will likely be applicable to A. mexicanus. Indeed, protocols for guide RNA assembly exist that are rapid and easy44 and the protocol reported here can be modified for CRISPR/Cas injection. Additionally, new applications for genome editing are rapidly being developed, and many of these may prove useful for A. mexicanus researchers. For example, in zebrafish precise mutations have been made in a gene of interest by coinjecting TALENs with a single stranded oligo containing a mutation7. This technique could be useful for evaluating the role of cave alleles in generating cave phenotypes, such as the role of a missense mutation in certain cave alleles of mc4r in differences in metabolism observed between cavefish and surface fish19. TALENs have also been used to generate alleles of genes via homologous recombination that express fluorescent markers in patterns similar to the endogenous loci45. These methods could be used in A. mexicanus to evaluate subsets of cells or expression of candidate genes. The CRISPR/Cas system has been used in zebrafish to obtain tissue-specific gene knockout46. These techniques, applied to A. mexicanus, could be useful to evaluate the genetic basis of processes such as eye loss in cavefish. The lens plays a critical role in the process of eye loss in cavefish47 and the tissue-specific CRISPR/Cas system could be used to evaluate the role of candidate genes for eye loss specifically in the lens versus other tissues of the eye. These and other genome-editing techniques can be utilized in A. mexicanus in future studies to answer critical questions about the evolution of cave traits.

Understanding the genetic basis of trait evolution is a critical research goal of evolutionary biologists. Considerable progress has been made in identifying loci underlying the evolution of traits and pinpointing candidate genes within these loci (for example1-3). However, functionally testing the role of these genes has remained challenging as many organisms used for studying the evolution of traits are not currently genetically tractable. The advent of genome editing technologies has greatly increased genetic manipulability of a wide range of organisms. Transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPRs) have been used to generate targeted mutations in genes in a number of organisms (for example4-11). These tools, applied to an evolutionarily relevant system, have the potential to revolutionize the way evolutionary biologists study the genetic basis of evolution.
Astyanax mexicanus is a species of fish that exists in two forms: a river-dwelling surface form (surface fish) and multiple cave-dwelling forms (cavefish). A. mexicanus cavefish evolved from surface fish ancestors (reviewed in12). Populations of cavefish have evolved a number of traits including loss of eyes, decrease or loss of pigmentation, increased numbers of taste buds and cranial neuromasts, and changes in behavior such as loss of schooling behavior, increased aggression, changes in feeding posture and hyperphagia13-19. Cavefish and surface fish are interfertile, and genetic mapping experiments have been performed to identify loci and candidate genes for cave traits1,20-26. Some candidate genes have been tested for a functional role in contributing to cave traits in cell culture1,19, in model organisms of other species21 or by overexpression27 or transient knockdown using morpholinos28 in A. mexicanus. However, each of these methods has limitations. The ability to generate mutant alleles of these genes in A. mexicanus is critical for understanding their function in the evolution of cavefish. Thus, A. mexicanus is an ideal candidate organism for application of genome editing technologies.
Here we outline a method for genome editing in A. mexicanus using TALENs. This method can be used to evaluate mosaic injected founder fish for phenotypes and for isolating lines of fish with stable mutations in genes of interest29.

<table><tbody><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Thermocycler</td><td></td><td></td><td></td></tr><tr><td>Injection station</td><td></td><td></td><td></td></tr><tr><td>Gel apparatus</td><td></td><td></td><td></td></tr><tr><td>Needle puller</td><td></td><td></td><td></td></tr><tr><td>Nanodrop</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Supplies&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Note: As far as we know, supplies from different companies can be used unless otherwise indicated</td><td></td><td></td><td></td></tr><tr><td>Golden Gate TALEN and TAL Effector Kit 2.0</td><td>Addgene</td><td>Kit #1000000024</td><td></td></tr><tr><td>Fisher BioReagents LB Agar, Miller (Granulated)</td><td>Fisher</td><td>BP9724-500</td><td></td></tr><tr><td>Fisher BioReagents Microbiology Media: LB Broth, Miller</td><td>Fisher</td><td>BP1426-500</td><td></td></tr><tr><td>Teknova TET-15 in 50% EtOH</td><td>Teknova (ordered through Fisher)</td><td>50-843-314</td><td></td></tr><tr><td>Spectinomycin Dihydrochloride, Fisher BioReagents</td><td>Fisher</td><td>BP2957-1</td><td></td></tr><tr><td>Super Ampicillin (1,000x solution)</td><td>DNA Technologies</td><td>6060-1</td><td></td></tr><tr><td>ThermoScientific X-Gal Solution, ready-to-use</td><td>Thermo Sci Fermentas Inc (Ordered through Fisher)</td><td>FERR0941</td><td></td></tr><tr><td>IPTG, Fisher BioReagents</td><td>Fisher</td><td>BP1620-1</td><td></td></tr><tr><td>Petri dishes</td><td>Fisher</td><td>08-757-13</td><td></td></tr><tr><td>&lt;em&gt;Bsa&lt;/em&gt;I</td><td>New England Biolabs (ordered through Fisher)</td><td>50-812-203</td><td>Use BsaI, not BsaI-HF (as described in the Golden Gate TALEN and TAL Effector Kit protocol)</td></tr><tr><td>BSA</td><td>New England Biolabs</td><td>provided with restriction enzymes</td><td></td></tr><tr><td>10x T4 ligase buffer</td><td>Promega (ordered through Fisher)</td><td>PR-C1263</td><td></td></tr><tr><td>GoTaq Green Master mix</td><td>Promega (ordered through Fisher)</td><td>PRM7123</td><td>Other Taq can be used, but the reaction should be adjusted accordingly</td></tr><tr><td>Quick ligation kit</td><td>New England Biolabs (ordered through Fisher)</td><td>50-811-728</td><td>We use Quick Ligase for all TALEN assembly reactions</td></tr><tr><td>One Shot TOP10 Chemically Competent E.coli</td><td>Invitrogen</td><td>C4040-06</td><td>Other chemically competent cells or homemade competent cells can be used</td></tr><tr><td>&lt;em&gt;Esp&lt;/em&gt; 3I</td><td>Thermo Sci Fermentas Inc (Ordered through Fisher)</td><td>FERER0451</td><td></td></tr><tr><td>Plasmid-Safe ATP-dependent DNase</td><td>Epicentre (Ordered through Fisher)</td><td>NC9046399</td><td></td></tr><tr><td>QIAprep Spin Miniprep Kit</td><td>Qiagen</td><td>27106</td><td>The Qiagen kit should be used for the initial plasmid preparation (as described in the Golden Gate TALEN and TAL Effector Kit protocol)</td></tr><tr><td>QIAquick PCR Purification Kit</td><td>Qiagen</td><td>28104</td><td></td></tr><tr><td>GeneMate LE Quick Dissolve Agaraose</td><td>BioExpress</td><td>E-3119-125</td><td></td></tr><tr><td>&lt;em&gt;Sac&lt;/em&gt; I</td><td>Promega (Ordered through Fisher)</td><td>PR-R6061</td><td></td></tr><tr><td>mMESSAGE mMACHINE T3 Transcription kit</td><td>Ambion</td><td>AM1348M</td><td></td></tr><tr><td>Rneasy MinElute Cleanup Kit</td><td>Qiagen</td><td>74204</td><td></td></tr><tr><td>NorthernMax-Gly Sample Loading Dye&amp;nbsp;</td><td>Ambion (ordered through Fisher)</td><td>AM8551</td><td></td></tr><tr><td>Eliminase</td><td>Decon (ordered through Fisher)</td><td>04-355-32</td><td></td></tr><tr><td>Fisherbrand Disposable Soda-Lime Glass Pasteur Pipets</td><td>Fisher</td><td>13-678-6B</td><td></td></tr><tr><td>Standard Glass Capillaries</td><td>World Precision Instruments</td><td>1B100-4</td><td></td></tr><tr><td>Microcaps</td><td>Drummond Scientific Company</td><td>1-000-0010</td><td></td></tr><tr><td>Eppendorf Femtotips Microloader Tips for Femtojet Microinjector</td><td>Eppendorf (ordered through Fisher)</td><td>E5242956003</td><td></td></tr><tr><td>Sodium hydroxide</td><td>Fisher</td><td>S318-500</td><td></td></tr><tr><td>Tris base</td><td>Fisher</td><td>BP152-1</td><td></td></tr></tbody></table>

genome editing in astyanax mexicanus using transcription activator-like effector nucleases (talens)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

TALEN pair injections result in binding of the RVDs to specific DNA nucleotides and thus dimerization of FokI domains, resulting in double stranded breaks39 which can be repaired through non-homologous end joining (NHEJ). NHEJ often introduces errors that result in insertions or deletions (indels). Indels can be identified by amplifying the region surrounding the TALEN target site and digesting the resulting amplicon with a restriction enzyme that cuts within the TALEN spacer region. Alleles without an indel will digest while alleles containing indels that change the restriction enzyme target sequence will not digest, producing a restriction enzyme resistant band (Figure 2).
TALEN injections can likely result in biallelic gene mutations in A. mexicanus29. Thus, some phenotypes may be assessed in founder fish. For example, we evaluated pigmentation in surface fish injected with TALENs targeting oca2, the gene hypothesized to be responsible for albinism in multiple albino populations of cavefish1,28. We found albino patches in oca2 TALEN-injected fish not present in uninjected fish29 (Figure 3).
For many experiments, it is desirable to have mutant lines of fish for evaluating phenotypes. Founder fish with transmitted mutant alleles can be identified by genotyping progeny from crosses of founder fish to wild type fish (Figure 4).
<img alt="Figure 1" src="/files/ftp_upload/54113/54113fig1.jpg" /> 
Figure 1.&#160;Needle for injecting mRNA. Photograph of a micropipette prior to being broken used for injecting TALEN mRNA into single celled embryos. <a href="https://www.jove.com/files/ftp_upload/54113/54113fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/54113/54113fig2.jpg" /> 
Figure 2.&#160;TALEN efficiency for Oca2. 306 bp PCR products from exon 9 of oca2 in Astyanax mexicanus were examined for loss of the restriction enzyme site when different amounts of TALEN mRNA were injected29. The amplicon from a control embryo was digested while a portion of the amplicon was resistant to restriction digest in the pools of 10 TALEN injected embryos. Restriction enzyme digest resistant bands from embryos injected with TALEN mRNA targeted oca2 have been shown to contain indels29. Note that increasing concentrations of mRNA injected results in increased TALEN efficiency (more undigested DNA). Lanes with &#34;-&#34; are undigested, lanes with &#34;+&#34; are digested with restriction enzyme. <a href="https://www.jove.com/files/ftp_upload/54113/54113fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/54113/54113fig3.jpg" /> 
Figure 3.&#160;Phenotyping founder fish for changes in pigmentation. (A) Control uninjected surface A. mexicanus. (B) Patch lacking melanophores in a founder surface fish injected with 400 pg TALEN mRNA targeting oca2 (arrow). <a href="https://www.jove.com/files/ftp_upload/54113/54113fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/54113/54113fig4.jpg" /> 
Figure 4.&#160;Germline transmission of TALEN induced mutations. 306 bp PCR products from exon 9 of oca2 in A. mexicanus were examined for loss of the restriction enzyme site in pools of 10 F1 fish from an injected founder fish. The amplicon from a control embryo was digested while a portion of the amplicon was resistant to restriction digest in the pools of 10 F1 embryos. Restriction enzyme digest resistant bands from oca2 F1s have been shown to contain indels29. Lanes with &#34;-&#34; are undigested, lanes with &#34;+&#34; are digested with restriction enzyme. <a href="https://www.jove.com/files/ftp_upload/54113/54113fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Reaction A</td>
			<td></td>
			<td></td>
			<td>Reaction B</td>
			<td></td>
		</tr>
		<tr>
			<td>amount</td>
			<td>reagent</td>
			<td></td>
			<td>amount</td>
			<td>reagent</td>
		</tr>
		<tr>
			<td>4 &#181;l</td>
			<td>water</td>
			<td></td>
			<td>10 &#181;l</td>
			<td>water</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pFUS_A</td>
			<td></td>
			<td>1 &#181;l</td>
			<td>pFUS_B4</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>BsaI</td>
			<td></td>
			<td>1 &#181;l</td>
			<td>BsaI</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>BSA</td>
			<td></td>
			<td>1 &#181;l</td>
			<td>BSA</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>Ligase</td>
			<td></td>
			<td>1 &#181;l</td>
			<td>Ligase</td>
		</tr>
		<tr>
			<td>2 &#181;l</td>
			<td colspan="2">10x Ligase buffer</td>
			<td>1 &#181;l</td>
			<td>10x Ligase buffer</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pNH1</td>
			<td></td>
			<td>1 &#181;l</td>
			<td>pNG1</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pNH2</td>
			<td></td>
			<td>1 &#181;l</td>
			<td>pHD2</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pNG3</td>
			<td></td>
			<td>1 &#181;l</td>
			<td>pNH3</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pHD4</td>
			<td></td>
			<td>1 &#181;l</td>
			<td>pNI4</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pHD5</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pHD6</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pNG7</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pHD8</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pNG9</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>pHD10</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1. Example reaction assembly A and B for a TALEN containing RVDs NH-NH-NG-HD-HD-HD-NG-HD-NG-HD-NG-HD-NH-NI-NG.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>primer name</td>
			<td>sequence (5&#39;-3&#39;)</td>
		</tr>
		<tr>
			<td>pCR8_F1</td>
			<td>ttgatgcctggcagttccct</td>
		</tr>
		<tr>
			<td>pCR8_R1</td>
			<td>cgaaccgaacaggcttatgt</td>
		</tr>
		<tr>
			<td>TAL_F1</td>
			<td>ttggcgtcggcaaacagtgg</td>
		</tr>
		<tr>
			<td>TAL_R2</td>
			<td>ggcgacgaggtggtcgttgg</td>
		</tr>
	</tbody>
</table>
Table 2. PCR primers for colony PCR, from34.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>reagent</td>
			<td>amount</td>
		</tr>
		<tr>
			<td>Taq mastermix, 2x</td>
			<td>50 &#181;l</td>
		</tr>
		<tr>
			<td>pCR8_F1 primer, 10 uM</td>
			<td>4 &#181;l</td>
		</tr>
		<tr>
			<td>pCR8_R1 primer, 10 uM</td>
			<td>4 &#181;l</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>42 &#181;l</td>
		</tr>
		<tr>
			<td colspan="2">*Adjust master mix if a different taq is used</td>
		</tr>
	</tbody>
</table>
Table 3. Master mix for 100 &#181;l (15 &#181;l/reaction) for colony PCR 1.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>step</td>
			<td>temperature (&#176;C)</td>
			<td>time (sec)</td>
		</tr>
		<tr>
			<td>1</td>
			<td>95</td>
			<td>120</td>
		</tr>
		<tr>
			<td>2</td>
			<td>95</td>
			<td>30</td>
		</tr>
		<tr>
			<td>3</td>
			<td>55</td>
			<td>30</td>
		</tr>
		<tr>
			<td>4</td>
			<td>72</td>
			<td>105</td>
		</tr>
		<tr>
			<td>5</td>
			<td colspan="2">Go to step 2 for 30 cycles</td>
		</tr>
		<tr>
			<td>6</td>
			<td>72</td>
			<td>300</td>
		</tr>
	</tbody>
</table>
Table 4. PCR program for colony PCR 1.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>amount</td>
			<td>reagent</td>
			<td>concentration</td>
		</tr>
		<tr>
			<td>12 &#181;l</td>
			<td>water</td>
			<td></td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>vector A</td>
			<td>100 ng/&#181;l</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>vector B</td>
			<td>100 ng/&#181;l</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>destination vector pT3Ts-gT</td>
			<td>50 ng/&#181;l</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>final RVD (pLR-RVD)</td>
			<td>100 ng/&#181;l</td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>Esp3I</td>
			<td></td>
		</tr>
		<tr>
			<td>1 &#181;l</td>
			<td>ligase</td>
			<td></td>
		</tr>
		<tr>
			<td>2 &#181;l</td>
			<td colspan="2">10x Ligase buffer</td>
		</tr>
	</tbody>
</table>
Table 5. Protocol for second assembly reactions.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>step</td>
			<td>temperature (&#176;C)</td>
			<td>time (sec)</td>
		</tr>
		<tr>
			<td>1</td>
			<td>95</td>
			<td>120</td>
		</tr>
		<tr>
			<td>2</td>
			<td>95</td>
			<td>30</td>
		</tr>
		<tr>
			<td>3</td>
			<td>55</td>
			<td>30</td>
		</tr>
		<tr>
			<td>4</td>
			<td>72</td>
			<td>180</td>
		</tr>
		<tr>
			<td>5</td>
			<td colspan="2">Go to step 2 for 30 cycles</td>
		</tr>
		<tr>
			<td>6</td>
			<td>72</td>
			<td>300</td>
		</tr>
	</tbody>
</table>
Table 6. PCR program for colony PCR 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>heat</td>
			<td>290</td>
		</tr>
		<tr>
			<td>pull</td>
			<td>150</td>
		</tr>
		<tr>
			<td>velocity</td>
			<td>100</td>
		</tr>
		<tr>
			<td>time</td>
			<td>150</td>
		</tr>
		<tr>
			<td colspan="2">These parameters are for a Flaming/Brown Micropipette Puller Model P-97 using a trough filament</td>
		</tr>
	</tbody>
</table>
Table 7. Sample needle pulling program.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>reagent</td>
			<td>amount</td>
		</tr>
		<tr>
			<td>Taq mastermix, 2x</td>
			<td>12.5 &#181;l</td>
		</tr>
		<tr>
			<td>gene specific forward primer, 10 &#181;M</td>
			<td>1 &#181;l</td>
		</tr>
		<tr>
			<td>gene specific reverse primer, 10 &#181;M</td>
			<td>1 &#181;l</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>9.5 &#181;l</td>
		</tr>
		<tr>
			<td>DNA</td>
			<td>1 &#181;l</td>
		</tr>
		<tr>
			<td colspan="2">*Adjust master mix if a different taq is used</td>
		</tr>
	</tbody>
</table>
Table 8. Sample protocol for gene specific PCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>step</td>
			<td>temperature (&#176;C)</td>
			<td>time (sec)</td>
		</tr>
		<tr>
			<td>1</td>
			<td>95</td>
			<td>120</td>
		</tr>
		<tr>
			<td>2</td>
			<td>95</td>
			<td>30</td>
		</tr>
		<tr>
			<td>3</td>
			<td>56</td>
			<td>30</td>
		</tr>
		<tr>
			<td>4</td>
			<td>72</td>
			<td>60</td>
		</tr>
		<tr>
			<td>5</td>
			<td colspan="2">Go to step 2 for 35 cycles</td>
		</tr>
		<tr>
			<td>6</td>
			<td>72</td>
			<td>300</td>
		</tr>
		<tr>
			<td colspan="3">*adjust annealing temperature and extension time for specific primers and PCR product size</td>
		</tr>
	</tbody>
</table>
Table 9.&#160;Sample PCR program for gene specific PCR.

Watch this Scientific Journal Video about Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs at JoVE.com

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...

genome-editing-astyanax-mexicanus-using-transcription-activator-like

Nanyang Technological University

Research

JoVE Journal

Biology

8.2K Views.  Iowa State University. Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

Video: Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Enhanced Genome Editing with Cas9 Ribonucleoprotein in Diverse Cells and Organisms

Site-specific eukaryotic genome editing with CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems has quickly become a commonplace amongst researchers pursuing a wide variety of biological questions. Users most often employ the Cas9 protein derived from Streptococcus pyogenes in a complex with an easily reprogrammed guide RNA (gRNA). These components are introduced into cells, and through a base pairing with a complementary region of the double-stranded DNA (dsDNA) genome, the enzyme cleaves both strands to generate a double-strand break (DSB). Subsequent repair leads to either random insertion or deletion events (indels) or the incorporation of experimenter-provided DNA at the site of the break.
The use of a purified single-guide RNA and Cas9 protein, preassembled to form an RNP and delivered directly to cells, is a potent approach for achieving highly efficient gene editing. RNP editing particularly enhances the rate of gene insertion, an outcome that is often challenging to achieve. Compared to the delivery via a plasmid, the shorter persistence of the Cas9 RNP within the cell leads to fewer off-target events. 
Despite its advantages, many casual users of CRISPR gene editing are less familiar with this technique. To lower the barrier to entry, we outline detailed protocols for implementing the RNP strategy in a range of contexts, highlighting its distinct benefits and diverse applications. We cover editing in two types of primary human cells, T cells and hematopoietic stem/progenitor cells (HSPCs). We also show how Cas9 RNP editing enables the facile genetic manipulation of entire organisms, including the classic model roundworm Caenorhabditis elegans and the more recently introduced model crustacean, Parhyale hawaiensis.

Utilizing a preassembled Cas9 ribonucleoprotein complex (RNP) is a powerful method for precise, efficient genome editing. Here, we highlight its utility across a broad range of cells and organisms, including primary human cells and both classic and emerging model organisms.

Site-specific eukaryotic genome editing with CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems has ...

Genetics

Manipulation of Gene Function in Mexican Cavefish

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, including eye degeneration, albinism, sleep loss, hyperphagia, and sensory processing. Species of cavefish from around the world display a convergent evolution of morphological and behavioral traits due to shared environmental pressures between different cave systems. Diverse cave species have been studied in the laboratory setting. The Mexican tetra, Astyanax mexicanus, with sighted and blind forms, has provided unique insights into biological and molecular processes underlying the evolution of complex traits and is well-poised as an emerging model system. While candidate genes regulating the evolution of diverse biological processes have been identified in A. mexicanus, the ability to validate a role for individual genes has been limited. The application of transgenesis and gene-editing technology has the potential to overcome this significant impediment and to investigate the mechanisms underlying the evolution of complex traits. Here, we describe a different methodology for manipulating gene expression in A. mexicanus. Approaches include the use of morpholinos, Tol2 transgenesis, and gene-editing systems, commonly used in zebrafish and other fish models, to manipulate gene function in A. mexicanus. These protocols include detailed descriptions of timed breeding procedures, the collection of fertilized eggs, injections, and the selection of genetically modified animals. These methodological approaches will allow for the investigation of the genetic and neural mechanisms underlying the evolution of diverse traits in A. mexicanus.&#160;

We describe approaches for the manipulation of genes in the evolutionary model system Astyanax mexicanus. Three different techniques are described: Tol2-mediated transgenesis, targeted manipulation of the genome using CRISPR/Cas9, and knockdown of expression using morpholinos. These tools should facilitate the direct investigation of genes underlying the variation between surface- and cave-dwelling forms.

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, ...

Direct Gene Knock-out of Axolotl Spinal Cord Neural Stem Cells via Electroporation of CAS9 Protein-gRNA Complexes

The axolotl has the unique ability to fully regenerate its spinal cord. This is largely due to the ependymal cells remaining as neural stem cells (NSCs) throughout life, which proliferate to reform the ependymal tube and differentiate into lost neurons after spinal cord injury. Deciphering how these NSCs retain pluripotency post-development and proliferate upon spinal cord injury to reform the exact pre-injury structure can provide valuable insight into how mammalian spinal cords may regenerate as well as potential treatment options. Performing gene knock-outs in specific subsets of NSCs within a restricted time period will allow study of the molecular mechanisms behind these regenerative processes, without being confounded by development perturbing effects. Described here is a method to perform gene knock-out in axolotl spinal cord NSCs using the CRISPR-Cas9 system. By injecting the CAS9-gRNA complex into the spinal cord central canal followed by electroporation, target genes are knocked out in NSCs within specific regions of the spinal cord at a desired timepoint, allowing for molecular studies of spinal cord NSCs during regeneration.

Presented here is a protocol to perform time- and space-restricted gene knock-out in axolotl spinal cords by injecting CAS9-gRNA complex into the spinal cord central canal followed by electroporation.

The axolotl has the unique ability to fully regenerate its spinal cord. This is largely due to the ependymal cells remaining as neural stem cells (NSCs) ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

CRISPR/Cas9 Editing of the C. elegans rbm-3.2 Gene using the dpy-10 Co-CRISPR Screening Marker and Assembled Ribonucleoprotein Complexes.

The bacterial Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Streptococcus pyogenes CRISPR-associated protein (Cas) system has been harnessed by researchers to study important biologically relevant problems. The unparalleled power of the CRISPR/Cas genome editing method allows researchers to precisely edit any locus of their choosing, thereby facilitating an increased understanding of gene function. Several methods for editing the C. elegans genome by CRISPR/Cas9 have been described previously. Here, we discuss and demonstrate a method which utilizes in vitro assembled ribonucleoprotein complexes and the dpy-10 co-CRISPR marker for screening. Specifically, in this article, we go through the step-by-step process of introducing premature stop codons into the C. elegans rbm-3.2 gene by homology-directed repair using this method of CRISPR/Cas9 editing. This relatively simple editing method can be used to study the function of any gene of interest and allows for the generation of homozygous-edited C. elegans by CRISPR/Cas9 editing&#160;in less than two weeks.

CRISPR/Cas9 Editing of the C. elegans rbm-3.2 Gene using the dpy-10 Co-CRISPR Screening Marker and Assembled Ribonucleoprotein Complexes.

The goal of this protocol is to enable seamless CRISPR/Cas9 editing of the C. elegans genome using assembled ribonucleoprotein complexes and the dpy-10 co-CRISPR marker for screening. This protocol can be used to make a variety of genetic modifications in C. elegans including insertions, deletions, gene replacements and codon substitutions.

The bacterial Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Streptococcus pyogenes CRISPR-associated protein (Cas) system has been ...

An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing

Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of cells or tissues in model organisms. These systems contain two components as separate transgenic lines. A driver line expresses a transcriptional activator under the control of tissue-specific promoters/enhancers, and a reporter/effector line harbors a target gene placed downstream to the binding site of the transcription activator. Animals harboring both components induce tissue-specific transactivation of a target gene expression. Precise spatiotemporal expression of the gene in targeted tissues is critical for unbiased interpretation of cell/gene activity. Therefore, developing a method for generating exclusive cell/tissue-specific driver lines is essential. Here we present a method to generate highly tissue-specific targeted expression system by employing a &#34;Clustered Regularly Interspaced Short Palindromic Repeat/CRISPR-associated&#34; (CRISPR/Cas)-based genome editing technique. In this method, the endonuclease Cas9 is targeted by two chimeric guide RNAs (gRNA) to specific sites in the first coding exon of a gene in the Drosophila genome to create double-strand breaks (DSB). Subsequently, using an exogenous donor plasmid containing the transactivator sequence, the cell-autonomous repair machinery enables homology-directed repair (HDR) of the DSB, resulting in precise deletion and replacement of the exon with the transactivator sequence. The knocked-in transactivator is expressed exclusively in cells where the cis-regulatory elements of the replaced gene are functional. The detailed step-by-step protocol presented here for generating a binary transcriptional driver expressed in Drosophila fgf/branchless-producing epithelial/neuronal cells can be adopted for any gene- or tissue-specific expression.

An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing

Here, we present a method for generating tissue-specific binary transcription systems in Drosophila by replacing the first coding exon of genes with transcription drivers. The CRISPR/Cas9-based method places a transactivator sequence under the endogenous regulation of a replaced gene, and consequently facilitates transctivator expression exclusively in gene-specific spatiotemporal patterns.

Binary transcription systems are powerful genetic tools widely used for visualizing and manipulating cell fate and gene expression in specific groups of ...

Developmental Biology

Wholemount In Situ Hybridization for Astyanax Embryos

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of genes. Prior research into this emerging model system capitalized on comprehensive genome-wide investigations that have identified numerous quantitative trait loci (QTL) associated with various cave-associated phenotypes. However, the ability to connect genes of interest to the heritable basis for phenotypic change remains a significant challenge. One technique that can facilitate deeper understanding of the role of development in troglomorphic evolution is whole-mount in situ hybridization. This technique can be implemented to directly compare gene expression between cave- and surface-dwelling forms, nominate candidate genes underlying established QTL, identify genes of interest from next-generation sequencing studies, or develop other discovery-based approaches. In this report, we present a simple protocol, supported by a flexible checklist, that can be widely adapted for use well beyond the presented study system. It is hoped that this protocol can serve as a broad resource for the Astyanax community and beyond.

Wholemount In Situ Hybridization for Astyanax Embryos

This protocol enables visualization of gene expression in embryonic Astyanax cavefish. This approach has been developed with the goal of maximizing gene expression signal, while minimizing non-specific background staining.

In recent years, a draft genome for the blind Mexican cavefish (Astyanax mexicanus) has been released, revealing the sequence identities for thousands of ...

Mouse Genome Engineering Using Designer Nucleases

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well as for modeling human diseases and testing therapeutic strategies. Recent advances in the use of designer nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system for site-specific genome engineering open the possibility to perform rapid targeted genome modification in virtually any laboratory species without the need to rely on embryonic stem (ES) cell technology. A genome editing experiment typically starts with identification of designer nuclease target sites within a gene of interest followed by construction of custom DNA-binding domains to direct nuclease activity to the investigator-defined genomic locus. Designer nuclease plasmids are in vitro transcribed to generate mRNA for microinjection of fertilized mouse oocytes. Here, we provide a protocol for achieving targeted genome modification by direct injection of TALEN mRNA into fertilized mouse oocytes.

Designer nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can be used to modify the genome of mouse preimplantation embryos by triggering both the nonhomologous end joining (NHEJ) and homologous recombination (HR) pathways. These advances enable the rapid generation of mice with precise genetic modifications.

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

Gamete Collection and In Vitro Fertilization of Astyanax mexicanus

Astyanax mexicanus is emerging as a model organism for a variety of research fields in biological science. Part of the recent success of this teleost fish species is that it possesses interfertile cave and river-dwelling populations. This enables the genetic mapping of heritable traits that were fixed during adaptation to the different environments of these populations. While this species can be maintained and bred in the lab, it is challenging to both obtain embryos during the daytime and create hybrid embryos between strains. In vitro fertilization (IVF) has been used with a variety of different model organisms to successfully and repeatedly breed animals in the lab. In this protocol, we show how, by acclimatizing A. mexicanus to different light cycles coupled with changes in water temperature, we can shift breeding cycles to a chosen time of the day. Subsequently, we show how to identify suitable parental fish, collect healthy gametes from males and females, and produce viable offspring using IVF. This enables related procedures such as the injection of genetic constructs or developmental analysis to occur during normal working hours. Furthermore, this technique can be used to create hybrids between the cave and surface-dwelling populations, and thereby enable the study of the genetic basis of phenotypic adaptations to different environments.

Gamete Collection and In Vitro Fertilization of Astyanax mexicanus

In vitro fertilization is a commonly used technique with a variety of model organisms to maintain lab populations and produce synchronized embryos for downstream applications. Here, we present a protocol that implements this technique for different populations of the Mexican tetra fish, Astyanax mexicanus.

Astyanax mexicanus is emerging as a model organism for a variety of research fields in biological science. Part of the recent success of this teleost fish ...

Genome Editing

A well-established technique for modifying specific sequences in the genome is gene targeting by homologous recombination, but this method can be laborious and only works in certain organisms. Recent advances have led to the development of &#8220;genome editing&#8221;, which works by inducing double-strand breaks in DNA using engineered nuclease enzymes guided to target genomic sites by either proteins or RNAs that recognize specific sequences. When a cell attempts to repair this damage, mutations can be introduced into the targeted DNA region. In this video, JoVE explains the principles behind genome editing, emphasizing how this technique relates to DNA repair mechanisms. Then, three major genome editing methods&#8212;zinc finger nucleases, TALENs, and the CRISPR-Cas9 system&#8212;are reviewed, followed by a protocol for using CRISPR to create targeted genetic changes in mammalian cells. Finally, we discuss some current research that applies genome editing to alter the genetic material in model organisms or cultured cells.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Enhanced Genome Editing with Cas9 Ribonucleoprotein in Diverse Cells and Organisms

Manipulation of Gene Function in Mexican Cavefish

Direct Gene Knock-out of Axolotl Spinal Cord Neural Stem Cells via Electroporation of CAS9 Protein-gRNA Complexes

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

CRISPR/Cas9 Editing of the C. elegans rbm-3.2 Gene using the dpy-10 Co-CRISPR Screening Marker and Assembled Ribonucleoprotein Complexes.

An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing

Wholemount In Situ Hybridization for Astyanax Embryos

Mouse Genome Engineering Using Designer Nucleases

Gamete Collection and In Vitro Fertilization of Astyanax mexicanus

Genome Editing