We thank Dr. Jian-Horng Leu of Institute of Marine Biology, National Taiwan Ocean University for providing 3 plasmid constructions. This research was supported by Grant 106-2311-B-197 -001 - from the Ministry of Science and Technology (MOST).

1. Preparations
<ol>
	<li>Insect cell culture
	<ol>
		<li>Prepare 50 mL of cell culture medium. To do so, add 500 &#181;L of antibiotics (Amphotericin B = 0.25 &#181;g/mL, Penicillin = 100 unit/mL, Streptomycin = 100 &#181;g/mL) and 5 mL of heat-inactivated fetal bovine serum in serum-free cell culture medium (without FBS or antibiotics). 
		NOTE: Heat the fetal bovine serum at 65 &#176;C for 30 min in a water bath before use.</li>
		<li>Maintain Spodoptera frugiperda (Lepidoptera: Noctuidae), sf9 insect cells. Detach ca. 80% of the cells from 25 cm2 cell culture flask by shaking the flask and check under light microscopy. Then, transfer 50% of the cell suspension to a new 25 cm2 cell culture flask and allow the cells to attach for 15 min at room temperature. Replace the medium with 5 mL fresh cell culture medium and grow in an incubator at 28 &#176;C. Passage cells every 2 to 3 days depending on the cell growth.</li>
	</ol>
	</li>
	<li>Preparation of plasmids for cell transfection
	<ol>
		<li>Insert the target DNA fragments (e.g., Lymantria xylina MNPV (LyxyMNPV) iap3 gene and its deletion constructs) into pDHsp/V5-His by PCR-based cloning method11. Check the growth of transformed colonies by colony PCR using PCR Master Mix (2X) and the pDhsp-F2/Op-IE2R primer set. Confirm the plasmid sequences by commercial sequencing service. 
		NOTE: Table 1 lists the primers used for PCR and the corresponding constructs.</li>
		<li>Culture single sequenced bacterial colonies, which contain the aforementioned plasmid constructions (step 1.2) in 200 mL LB medium containing selected antibiotics (50 &#181;g/mL), respectively.</li>
		<li>Extract the plasmids from the cultured E. coli using Midi Plasmid Kit according to manufacturer&#39;s instructions12.</li>
	</ol>
	</li>
	<li>Prepare plating medium by mixing 1.5 mL of cell culture medium and 8.5 mL of serum-free cell culture medium.</li>
	<li>Prepare Actinomycin D (ActD) cell culture medium by adding 1.5 &#181;L of ActD stock (1 mg/mL) into 10 mL of cell culture medium (final concentration = 150 ng/mL). Store at 4 &#176;C.</li>
</ol>
2. Protein transient expression
<ol>
	<li>Cell seeding
	<ol>
		<li>Harvest the sf9 cells by shaking culture flask, topple and fall the cell suspension to 50 mL tube, and transfer 10 &#181;L to hemocytometer by a P10 pipette. Count the cell number under a light microscope.</li>
		<li>Plate 3 &#215; 105 sf9 cells into each well in a 24-well plate for 15 min at room temperature. Replace the medium with 0.5 mL of plating medium.</li>
	</ol>
	</li>
	<li>Transfection of plasmids
	<ol>
		<li>Dilute cell transfection reagent: Dilute 8 &#181;L of cell transfection reagent in 100 &#181;L serum-free cell culture medium and mix by vortexing for 1&#160;s.</li>
		<li>Add 2 &#181;g of plasmid DNA (pDHsp70-Ac-P35/V5-His or pDHsp70-Ly-IAP3/V5-His or pDHsp70-Ly-IAP3-BIR/V5-His or pDHsp70-Ly-IAP3-RING/V5-His) into 100 &#181;L of serum-free cell culture medium and mix by vortexing for 1 s (Figure 2).</li>
		<li>Combine the diluted plasmid DNA and diluted cell transfection reagent (210 &#181;L), and mix by vortexing for 1 s. Incubate for 30 min at room temperature.</li>
		<li>Add 210 &#181;L of DNA transfection reagent mixture dropwise onto the cells by a P1000 pipette. Incubate at 28 &#176;C for 5 h.</li>
		<li>Replace the plating medium with 0.5 mL of cell culture medium using a P1000 pipette. Seal the 24-well plate with tape and incubate the cells at 28 &#176;C for 16 h.</li>
	</ol>
	</li>
	<li>Heat shock the transfected cells: Put the plate in a 42 &#176;C water bath (floating on the water surface). Heat for 30 min and return the 24-well plate to the 28 &#176;C incubator.</li>
	<li>Detection of protein expression
	<ol>
		<li>After 1 h or 5 h heat shock,wash the cells with 0.5 mL of 1x&#160;PBS buffer briefly three times. 
		NOTE: Dilute 10x&#160;PBS buffer to 1x PBS buffer by adding 1 mL of 10x&#160;PBS buffer to 9 mL sterilized ddH2O</li>
		<li>Lyse the cells with 40 &#181;L of 1x&#160;SDS Loading Dye by pipetting up and down. 
		NOTE: Dilute 4x&#160;SDS Loading Dye by mixing 30 &#181;L of 1x&#160;PBS buffer and 10 &#181;L of 4x&#160;SDS Sample Buffer.</li>
		<li>Heat the protein samples at 98 &#176;C for 10 min in a heat block, spin down for 1 min, and put on ice for Western blot assay.</li>
		<li>Western blot assay 
		Follow the procedure of Western blot assay from Eslami and Lujan13. Run SDS-PAGE gels14: one gel subjected to Coomassie blue staining (loading control for checking that the quantity of protein samples loaded in each well is equal in amount) and the other subjected to Western blot assay, according to Eslami and Lujan13.</li>
		<li>Detect V5-tagged fusion proteins with rabbit anti-V5 antibody (5 mg/mL) (1:5000 dilution in TBST buffer to working concentration 1 &#181;g/mL) and goat anti-rabbit IgG-horseradish peroxidase (HRP) conjugate (0.8 mg/mL) (1:10000 dilution in TBST buffer to working concentration 0.08 &#181;g/mL). 
		NOTE: Adjust the percentage of polyacrylamide to 17.5% when the protein molecular weight to be &#60;17 kDa.</li>
	</ol>
	</li>
</ol>
3. Anti-apoptotic activity assay
<ol>
	<li>Gene-induced cell apoptosis: Repeat the aforementioned procedure from 2.1 to 2.3. Co-transfect 1 &#181;g of pDHsp/D-rpr/FLAG-His plasmid DNA (containing apoptosis inducer gene) with 1 &#181;g of plasmid DNA [pDHsp70/V5-His vector (negative control), pDHsp70-Ac-P35/V5-His (positive control), pDHsp70-Ly-IAP3/V5-His, pDHsp70-Ly-IAP3-BIR/V5-His or pDHsp70-Ly-IAP3-RING/V5-His, respectively.]. At 5 h post-heat shock treatment, conduct the cell viability assay (Figure 2).</li>
	<li>Chemical-induced cell apoptosis: Repeat the aforementioned procedure from 2.1 to 2.3. In step 2.1.2, plate 1 x 106 sf9 cells into each well in a 6-well plate. Transfect 4 &#181;g of plasmid DNA [pDHsp70/V5-His vector (negative control), pDHsp70-Ac-P35/V5-His (positive control), pDHsp70-Ly-IAP3/V5-His, pDHsp70-Ly-IAP3-BIR/V5-His or pDHsp70-Ly-IAP3-RING/V5-His, respectively.]. At 5 h post-heat shock, treat sf9 cells with 2mL of ActD cell culture medium for 16 h and conduct the cell viability assay (Figure 2). 
	NOTE: Minimum volume to cover one&#160; well of 6-well plate is 1 mL.</li>
	<li>Perform the above anti-apoptotic activity assay experiments, including 3.1 and 3.2 in triplicates.</li>
</ol>
4. Cell viability assay
<ol>
	<li>Wash the treated cells by adding 1 mL of 1x&#160;PBS buffer for 1 min 3 times. Resuspend the cells by pipetting 1 mL 1x&#160;PBS buffer containing 0.04% trypan blue and stain for 3 min at room temperature. Transfer the cell suspension into a 1.5 mL microtube. 
	NOTE: Dilute 0.4% trypan blue solution by mixing 9 mL of 1x&#160;PBS buffer and 1 mL 0.4% trypan blue solution.</li>
	<li>Transfer 10 &#181;L trypan blue-stained cell suspension to the hemocytometer with a P10 pipette and count the viable intact cells under a light microscope.</li>
	<li>Statistical analysis
	<ol>
		<li>Calculate the recorded data and present as the means &#177; S.D. for all counts.</li>
		<li>Analyze the data using the Student&#39;s two-tailed t-test by with Microsoft Excel. Define statistically significant data as P-value &#60;0.05.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Miller, L. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculoviruses+as+gene+expression+vectors.">Baculoviruses as gene expression vectors.</a> Annual Reviews in Microbiology. 42 (1), 177-199 (1988).</li><li>Theilmann, D. A., Fauquet, C. M., Mayo, M. A., Maniloff, J., Desselberger, U., Ball, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Family+Baculoviridae.">Family Baculoviridae.</a> Virus Taxonomy: Eighth Report of the International Committee on Taxonomy of Viruses. , 1129-1185 (2005).</li><li>Nai, Y. S., Huang, Y. F., Chen, T. H., Chiu, K. P., Wang, C. H., Shields, V. D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+nucleopolyhedrovirus'+taxonomic+position.">Determination of nucleopolyhedrovirus' taxonomic position.</a> Biological Control of Pest and Vector Insects. , 169-200 (2017).</li><li>Friesen, P. D., Miller, L. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+baculovirus+early+gene+expression.">Regulation of baculovirus early gene expression.</a> The Baculoviruses. , 141-170 (1997).</li><li>Smith, G. E., Summers, M., Fraser, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+human+beta+interferon+in+insect+cells+infected+with+a+baculovirus+expression+vector.">Production of human beta interferon in insect cells infected with a baculovirus expression vector.</a> Mol. Cell. Biol. 3 (12), 2156-2165 (1983).</li><li>Luckow, V. A., Summers, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trends+in+the+development+of+baculovirus+expression+vectors.">Trends in the development of baculovirus expression vectors.</a> Nature Biotechnol. 6 (1), 47-55 (1988).</li><li>Jarvis, D. L., Finn, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modifying+the+insect+cell+N-glycosylation+pathway+with+immediate+early+baculovirus+expression+vectors.">Modifying the insect cell N-glycosylation pathway with immediate early baculovirus expression vectors.</a> Nature Biotechnol. 14 (1996), 1288-1292 (1996).</li><li>Clem, R. J., Miller, L. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+programmed+cell+death+by+the+baculovirus+genes+p35+and+iap.">Control of programmed cell death by the baculovirus genes p35 and iap.</a> Mol. Cell. Biol. 14, 5212-5222 (1994).</li><li>Leu, J. H., Kuo, Y. C., Kou, G. H., Lo, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+cloning+and+characterization+of+an+inhibitor+of+apoptosis+protein+(IAP)+from+the+tiger+shrimp,+Penaeus+monodon.">Molecular cloning and characterization of an inhibitor of apoptosis protein (IAP) from the tiger shrimp, Penaeus monodon.</a> Dev. Comp. Immunol. 32, 121-133 (2008).</li><li>Zhao, Y. G., Eggleston, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+promoters+for+transient+gene+expression+in+cultured+mosquito+cells.">Comparative analysis of promoters for transient gene expression in cultured mosquito cells.</a> Insect Mol. Biol. 8 (1), 31-38 (1999).</li><li>Nai, Y. S., Yang, Y. T., Kim, J. S., Wu, C. Y., Chen, Y. W., Wang, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculoviral+IAP2+and+IAP3+encoded+by+Lymantria+xylina+multiple+nucleopolyhedrovirus+(LyxyMNPV)+suppress+insect+cell+apoptosis+in+a+transient+expression+assay.">Baculoviral IAP2 and IAP3 encoded by Lymantria xylina multiple nucleopolyhedrovirus (LyxyMNPV) suppress insect cell apoptosis in a transient expression assay.</a> Appl. Entomol. Zool. 51, 305-316 (2016).</li><li>Eslami, A., Lujan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Western+Blotting:+Sample+Preparation+to+Detection.">Western Blotting: Sample Preparation to Detection.</a> J. Vis. Exp. (44), e2359 (2010).</li><li>. Basic Methods in Cellular and Molecular Biology. Separating Protein with SDS-PAGE Available from: <a target="_blank" href="https://www.jove.com/science-education/5058/separating-protein-with-sds-page">https://www.jove.com/science-education/5058/separating-protein-with-sds-page</a> (2017)</li><li>Vucic, D., Kaiser, W. J., Harvey, A. J., Miller, L. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+reaper-induced+apoptosis+by+interaction+with+inhibitor+of+apoptosis+proteins+(IAPs).">Inhibition of reaper-induced apoptosis by interaction with inhibitor of apoptosis proteins (IAPs).</a> Proc. Natl. Acad. Sci. USA. 94, 10183-10188 (1997).</li></ol>

The authors declare that they have no competing financial interests.

The concept of heat shock-based pDHsp/V5-His/sf9 cell system was first described by Clem et al. in 19948. Comparison of the baculoviral gene promoter (IE1) and Drosophila hsp70 showed that hsp70 had a higher efficiency in mosquito cells10. Furthermore, due to the heat shock induction, the timing of protein expression could be controlled precisely after heat shock treatment. This system was then applied for protein functional assays of shrimp and nucleopolyhedrovirus (NPV) IAP proteins9,11. In this protocol, a total of 6 plasmid constructions were used: three (pDHsp/V5-His, pDHsp/Ac-p35/V5-His, and pDHsp/D-rpr/FLAG-His) were provided by Jian-Horng Leu9, and the other three constructions (pDHsp-iap3/V5-His, pDHsp-iap3-BIR/V5-His, and pDHsp-iap3-RING/V5-His) were constructed by Nai et al., 201611. It seems that this promoter in insect cells works more efficiently than baculoviral gene promoters. However, during manipulation of this protocol, there are several points that need to be considered. Before plasmid transfection, checking the insertion of the DNA sequence is important for gene expression; thus, it should be fused with the V5 epitope to form a V5-tagged fusion protein at the end of the target sequence. Moreover, different fusion tags (i.e., FLAG epitope) could also be designed in the pDHsp-based vector for an in vitro protein binding assay. This extension procedure would help further investigate protein-protein interactions9. Therefore, the commercial V5 polyclonal antibody could be used for the detection of proteins. The transfection ratio in different insect cells should be tested before the experiment. Lower transfection rates might result in non-detectable of protein expression; thus, a pDHsp vector containing a suitable report gene (i.e., green fluoresce gene) could be transfected into insect cells to evaluate transfection efficiency.
The major limitation of this heat shock expression platform is the protein expression level. In some cases, a low protein expression level was found. According to a pilot study, there was no significant dose-dependent effect that occurred when more plasmid DNA was transfected into sf9 cells (data not shown). Thus, this effect may be caused by the ubiquitin proteasome pathway (UPP) or other unknown mechanisms11. Researchers should examine the protein expression in the presence of the proteasome inhibitor (i.e., MG-132) to clarify and recolve this issue11. The other limitation is that sustainable production of protein associated with the recombinant viruses could not be achieved. Thus, the stabilization and amount of protein expression are also concerns regarding this system. Therefore, a time course of protein production should also be tested by Western blot assay before the functional assay. In this protocol, we compared two time points (1 and 5 h after heat shock) and observed the accumulation of target protein production from 1 h to 5 h. An increase in time points is suggested in order to determine the best timing conditions for the protein functional assay.
For the protein functional assay, the anti-apoptotic protein Ac-P35 (positive control) and an apoptosis-inducer protein (D-RPR) were also expressed using this heat shock transient expression system. These two proteins are described as functional antagonists9,11,15. Therefore, the vector/D-RPR and Ac-P35/D-RPR could serve as a negative control and positive control, respectively. Using this comparison, the anti-apoptotic activity of target proteins could be determined.
The presented protocol could provide a platform to express foreign proteins more quickly or could be further applied to evaluate protein anti-apoptotic activity in insect cells. Once researchers obtain the preliminary results of protein function, this system could be used for further studies.

Two protein expression systems have been commonly used for producing proteins: prokaryote protein expression systems (Escherichia coli gene expression system) and eukaryote protein expression systems. One popular eukaryote protein expression system is the baculovirus expression vector system (BEVS)1. Baculoviruses were first used as worldwide biological control agents of agricultural and forest pests. In the last few decades, baculoviruses were developed as biotechnological tools for protein expression vectors as well. The genomes of baculoviruses consist of double-stranded circular DNA and enveloped nucleocapsids2. To date, more than seventy-eight baculovirus isolates have been sequenced3. Based on the temporal cascade of baculoviral gene expressions in host insect cells, the gene transcription could be classified into four temporal cascades, including immediate-early, delayed-early, late, and very late genes4.
BEVSs were designated so that the very late gene promoters (i.e., polyhedron or p10 promoter) were used to drive the target genes, while the recombinant baculovirus was generated by homologous recombination. Expression of foreign proteins in insect cells by recombinant baculovirus is similar to that of mammalian proteins in post-translational modifications (suited for glycoprotein production). Thus, the baculovirus has been widely used5,6,7. However, one limitation is the presence of different N-glycosylation pathways in insect cells7.
Therefore, a new baculovirus expression system, the transient gene expression system, was developed. This system expresses foreign genes under the drive of baculoviral immediate-early promoters (ie-1 promoter) in insect cells. By using this system, the target protein can be immediately expressed under the control of ie-1 promoter while modifying the N-glycosylation pathway in insect cells, resulting in better N-linked oligosaccharides7. Moreover, baculoviral immediate-early genes are transcribed by the host cell RNA polymerase II and do not require any viral factor for activation4. Therefore, foreign proteins can be expressed in insect cells within a short time. To date, the transient gene expression system is one of the most important technologies for performing protein functional assays in the baculovirus in vitro cell culture system. The system can be applied to analyze the function of either baculovirus or foreign proteins. One of the commercially available transient gene expression systems is based on the immediate-early gene (IE) promoters of Orgyia pseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV) (OpIE2 and OpIE1 promoters).
However, the lower expression level of foreign genes in insect cells was still a problem when the OpIE promoter-based transient gene expression system was used8,9,10. Thus, another transient gene expression system was constructed based on the promoter of the Drosophila heat shock protein 70 (hsp70) gene8,9. The promoter of hsp70 works more efficiently than baculoviral IE promoter when induced by heat shock in insect cells10. In this system, the target genes were expressed under the drive of Drosophila heat shock 70 (Dhsp70) promoter. Foreign genes can be easily cloned into the transient gene expression plasmid by PCR-based cloning methods. Furthermore, the control of timing for gene expression can be performed by heat shock induction.
In this report, we follow the approach and express three different truncations of the baculoviral gene (inhibitor of apoptosis 3, iap3 from Lymantria xylina MNPV) by using the heat shock-based transient protein expression system and further apply these expressed proteins on anti-apoptotic activity analysis. This system can either express foreign proteins quickly or be further applied to the evaluation of protein anti-apoptotic activity in sf9 cells, while also having the potential to be applied to other protein activity assays.

<table><tbody><tr><td>Antibiotic-Antimycotic, 100X</td><td>Gibco</td><td>15240-062</td><td>for insect cell culture</td></tr><tr><td>Certified Foetal Bovine Serum</td><td>Bioind</td><td>04-001-1A</td><td></td></tr><tr><td>Sf-900 II SFM</td><td>Thermo Fisher</td><td>10902096</td><td>serum-free cell culture medium</td></tr><tr><td>Sf9 cells</td><td>ATCC</td><td>CRL-1711</td><td></td></tr><tr><td>25cm2 cell culture flask</td><td>Nunc, Thermo Fisher</td><td>156340</td><td></td></tr><tr><td>Inverted light microscopy</td><td>WHITED</td><td>WHITED WI-400</td><td></td></tr><tr><td>RBC HIT Competent Cell</td><td>Bioman</td><td>RH618-J80</td><td>&lt;em&gt;Escherichia coli&lt;/em&gt; (DH5&amp;alpha;)</td></tr><tr><td>L.B. Broth (Miller)</td><td>Bioman</td><td>LBL407</td><td></td></tr><tr><td>Agar, Bacteriological Grade</td><td>Bioman</td><td>AGR001</td><td></td></tr><tr><td>Zeocin</td><td>Invitrogen</td><td>ant-zn-1</td><td>selection antibiotic</td></tr><tr><td>PCR Master Mix (2X)</td><td>ThermoFisher</td><td>K0171</td><td></td></tr><tr><td>Geneaid Midi Plasmid Kit (Endotoxin Free)</td><td>Geneaid</td><td>PIE25</td><td></td></tr><tr><td>Actinomycin D</td><td>SIGMA</td><td>A9415</td><td></td></tr><tr><td>Corning 50 mL centrifuge tubes</td><td>SIGMA</td><td>CLS430829-500EA</td><td>50 mL tubes</td></tr><tr><td>Hemocytometer</td><td>Gizmo Supply Co</td><td>B-CNT-SLDE-V2</td><td></td></tr><tr><td>24-Well Multidish</td><td>Nunc, Thermo Fisher</td><td>142475</td><td>24-well plate</td></tr><tr><td>Cellfectin II Reagent</td><td>Thermo Fisher</td><td>10362100</td><td>cell transfectin reagent</td></tr><tr><td>PBS-Phosphate-Buffered Saline (10X) pH 7.4</td><td>Thermo Fisher</td><td>AM9624</td><td></td></tr><tr><td>4&amp;times;SDS Loading Dye</td><td>Bioman</td><td>P1001</td><td></td></tr><tr><td>Immobilon-P (PVDF Blotting Membranes)</td><td>Merck Milipore</td><td>IPVH00010</td><td>PVDF membranes</td></tr><tr><td>Mini Trans-Blot Cell system</td><td>BIO-RED</td><td>1703930</td><td>Blotting device</td></tr><tr><td>Ponceau S solution</td><td>SIGMA</td><td>6226-79-5</td><td></td></tr><tr><td>Anti-V5</td><td>SIGMA</td><td>V8137</td><td>rabbit anti-V5 antibody</td></tr><tr><td>Goat anti-rabbit IgG-horseradish peroxidase (HRP)</td><td>Jackson</td><td>111-035-003</td><td></td></tr><tr><td>Tween 20</td><td>Merck</td><td>817072</td><td></td></tr><tr><td>6-Well Multidish</td><td>Nunc, Thermo Fisher</td><td>145380</td><td></td></tr><tr><td>0.4 % trypan blue solution</td><td>AMRESCO</td><td>K940-100ML</td><td></td></tr><tr><td>P10 pipetman</td><td>Gilson</td><td>F144802</td><td></td></tr><tr><td>P1000 pipetman</td><td>Gilson</td><td>F123602</td><td></td></tr><tr><td>Tape</td><td>Symbio</td><td>PPS7</td><td>24 well tape ( 19 mm&amp;times;36 M)</td></tr></tbody></table>

transient expression of foreign genes in insect cells (sf9) for protein functional assay

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell culture system. This system was developed to express foreign genes under the control of the baculoviral promoter in transient expression plasmids. Furthermore, this system can be applied to a functional assay of either the baculovirus itself or foreign proteins. The most widely and commercially available transient gene expression system is developed based on the immediate-early gene (IE) promoter of Orgyia pseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV). However, a low expression level of foreign genes in insect cells was observed. Therefore, a transient gene expression system was constructed for improving protein expression. In this system, recombinant plasmids were constructed to contain the target sequence under the control of the Drosophila heat shock 70 (Dhsp70) promoter. This protocol presents the application of this heat shock-based pDHsp/V5-His (V5 epitope with 6 histidine)/Spodoptera frugiperda cell (sf9 cell) system; this system is available not only for gene expression but also for evaluating the anti-apoptotic activity of candidate proteins in insect cells. Furthermore, this system can be either transfected with one recombinant plasmid or co-transfected two potentially functionally antagonistic recombinant plasmids in insect cells. The protocol demonstrates the efficiency of this system and provides a practical case of this technique.

The full length and other two truncations (BIR and RING domains) of Ly-IAP3 from LyxyMNPV were overexpressed in sf9 cells, based on the heat shock-based pDHsp/V5-His/Spodoptera frugiperda cell (sf9 cell) system. The pDHsp/V5-His contained a Drosophila heat shock protein promoter, which drives downstream gene expression at a temperature of 42 &#176;C condition by using cellular transcriptional factors and the translation system (Figure 1)8,9,11. The whole technological flowchart is shown in Figure 2. After 1 h or 5 h heat shock, the cells were lysed with protein sample buffer and subjected to Western blot assay to confirm the protein expression. The results indicated that the full-length proteins, AC-P35, Ly-IAP3, Ly-IAP3-BIR, and Ly-IAP3-RING, could be detected in transfected cells at either 1 h or 5 h post-heat shock. Moreover, the protein accumulations were found at 5 h post-heat shock (Figure 3). Thus, according to the data, the protein functional assay was performed at the maximum protein expression time point (5 h post-heat shock).
Both gene-induced cell apoptosis and chemical-induced cell apoptosis could be adapted to this system for evaluating anti-apoptotic activity (Figure 2). For gene-induced cell apoptosis, two constructs (apoptosis inducer and target gene plasmid constructs) were co-transfected into sf9 cells and then heat shocked to activite gene expression. Moreover, the anti-apoptotic protein Ac-P35 (positive control) and an apoptosis-inducer protein (D-RPR) were also expressed using this heat shock transient expression system.
After heat shock, both genes began to be expressed and translated into proteins. Compared to the vector/D-RPR, the positive control (Ac-P35/D-RPR) showed high anti-apoptotic activity, which reached up to 80% of the viability rate. From the cell viability results of the other constructs, the researchers could compare the anti-apoptotic activity to each other or the positive control (Figure 4A). For chemical-induced cell apoptosis, only one construct was transfected into sf9 cells. After 5 h post-heat shock, the chemicals (ActD) were added, and cell viability was measured after 16 h (Figure 2). Compared with those of the positive control (AC-P35) or the negative control (vector), each construct showed the various effects on anti-apoptotic activity (Figure 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56693/56693fig1.jpg" /> 
Figure 1: Diagram and nucleotide sequences of ly-iap3 relative plasmid constructs based on pDHsp/V5-His vector. The start codon (ATG) is shown in bold. Underlining indicates the restriction enzyme cutting sites (HindIII in red color; BamHI in blue color); the sequence in green color indicates the Dhsp70 promoter region. <a href="https://cloudflare.jove.com/files/ftp_upload/56693/56693fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56693/56693fig2.jpg" /> 
Figure 2: The flow chart of heat shock induced protein expression system (pDHsp/V5-His/sf9 cell system). Gene-induced cell apoptosis and chemical-induced cell apoptosis treatments were indicated to the initial step (co-transfection with apoptosis inducer gene plasmid) or to the later step after heat shock (Chemical-induced apoptosis), respectively, for anti-apoptosis assay. Modified figure and legend reproduced with permission of Springer11. <a href="https://cloudflare.jove.com/files/ftp_upload/56693/56693fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56693/56693fig3.jpg" /> 
Figure 3: Overexpression of AC-P35, Ly-IAP3, Ly-IAP3-BIR and Ly-IAP3-RING using heat shock induced protein expression system (pDHsp/V5-His/sf9 cell system). At 1 h or 5 h post heat shock, the cell lysates were harvested and subjected to Western blot assay and SDS/PAGE. (A) Western blot assay with &#945;-V5 antibody and (B) SDS/PAGE&#160;stained with Coomassie blue as the loading control. <a href="https://cloudflare.jove.com/files/ftp_upload/56693/56693fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56693/56693fig4.jpg" /> 
Figure 4: Viability assays for D-rpr or Actinomycin D-induced apoptosis. (A) sf9 cells were transfected with pDHsp70/V5-His vector (Vector only) and co-transfected pDHsp70/drpr/FLAG-His with pDHsp70/V5-His vector, pDHsp70/Ac-P35/V5-His, pDHsp70/Ly-IAP3/V5-His, pDHsp70/Ly-IAP3-BIR/V5-His, pDHsp70/Ly-IAP3-RING/V5-His, respectively. The differences between vector and P35 and between vector and Ly-IAP3 are statistically significant (t-test; P &#60;0.05). (B) sf9 cells were transfected with either pDHsp70/V5-His vector or pDHsp70/Ac-P35/V5-His, pDHsp70/Ly-IAP3/V5-His, pDHsp70/Ly-IAP3-BIR/V5-His, pDHsp70/Ly-IAP3-RING/V5-His, respectively, at 5 h after heat shock, ActD was added and 16 h later, the cell viability was measured. The difference between vector and P35 is statistically significant (t-test; P &#60;0.05). Modified figure and legend reproduced with permission of Springer11. <a href="https://cloudflare.jove.com/files/ftp_upload/56693/56693fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Sequences</td>
		</tr>
		<tr>
			<td>pDHsp-IAP3-HindIII-F</td>
			<td>5&#180;- GGAAGCTTACCATGGACGACGAACGACGCAG -3&#180;</td>
		</tr>
		<tr>
			<td>pDHsp -IAP3-BamHI-R</td>
			<td>5&#180;- GCGGATCCCGGATGTAGGAACACCTTGA -3&#180;</td>
		</tr>
		<tr>
			<td>iap3-BIR-BamHI-r</td>
			<td>5&#180;- CGGGATCCCGGCAGATCGCCGCCGCGGA -3&#180;</td>
		</tr>
		<tr>
			<td>iap3-RING-HindIII-F</td>
			<td>5&#180;- GGAAGCTTACCGAGCTCATAAAAAGGCCCGT-3&#180;</td>
		</tr>
		<tr>
			<td>pDhsp70-F2</td>
			<td>5&#180;- CTGCAACTACTGAAATCAACCAAG-3&#180;</td>
		</tr>
		<tr>
			<td>Op-IE2R</td>
			<td>5&#180;- GACAATACAAACTAAGATTTAGTCAG-3&#180;</td>
		</tr>
	</tbody>
</table>
Table 1: The primer sets used for PCR-based cloning method. *The underlined DNA base pairs indicated the restriction enzyme sites. The modified primer list reproduced with permission of Springer11.

Watch this Scientific Journal Video about Transient Expression of Foreign Genes in Insect Cells sf9 for Protein Functional Assay at JoVE.com

Transient Expression of Foreign Genes in Insect Cells sf9 for Protein Functional Assay

This protocol describes a heat shock-induced protein expression system (pDHsp/V5-His/sf9 cell system), which can be used for either expressing foreign proteins or evaluating the anti-apoptotic activity of potential foreign proteins and their truncated amino acids in insect cells.

Transient Expression of Foreign Genes in Insect Cells (sf9) for Protein Functional Assay

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell ...

transient-expression-foreign-genes-insect-cells-sf9-for-protein

Nanyang Technological University

Research

JoVE Journal

Genetics

12.3K Views.  National Ilan University. This protocol describes a heat shock-induced protein expression system (pDHsp/V5-His/sf9 cell system), which can be used for either expressing foreign proteins or evaluating the anti-apoptotic activity of potential foreign proteins and their truncated amino acids in insect cells.

Video: Transient Expression of Foreign Genes in Insect Cells sf9 for Protein Functional Assay

Alphavirus Transducing System:  Tools for Visualizing Infection in Mosquito Vectors

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection. ATSs are derived from cDNA clones of mosquito-borne RNA viruses (genus Alphavirus; family Togaviridae). The Alphavirus genus contains about 30 different mosquito-borne virus species. Alphaviruses are enveloped viruses and contain single-stranded RNA genomes (~11.7 Kb). Alphaviruses transcribe a subgenomic mRNA that encodes the structural proteins of the virus required for encapsidation of the genome and maturation of the virus. Alphaviruses are usually highly lytic in vertebrate cells, but persistently infect susceptible mosquito cells with minimal cytopathology. These attributes make them excellent tools for gene expression in mosquito vectors. The most common ATSs in use are derived from Sindbis virus (SINV). The broad species tropism of SINV allows for infection of insect, avian, and mammalian cells8. However, ATSs have been derived from other alphaviruses as well9,10,20. Foreign gene expression is made possible by the insertion of an additional viral subgenomic RNA initiation site or promoter. ATSs in which an exogenous gene sequence is positioned 5' to the viral structural genes is used for stable protein expression in insects. ATSs, in which a gene sequence is positioned 3' to the structural genes, is used to trigger RNAi and silence expression of that gene in the insect.
ATSs have proven to be valuable tools for understanding vector-pathogen interactions, molecular details of viral replication and maintenance infectious cycles3,4,11,19,21. In particular, the expression of fluorescent and bioluminescent reporters has been instrumental tracking the viral infection in the vector and virus transmission5,14-16,18. Additionally, the vector immune response has been described using two strains of SINV engineered to express GFP2,9.
Here, we present a method for the production of SINV containing a fluorescent reporter (GFP) from the cDNA infectious clone. Infectious, full-length RNA is transcribed from the linearized cDNA clone. Infectious RNA is introduced into permissive target cells by electroporation. Transfected cells generate infectious virus particles expressing the GOI. Harvested virus is used to infect mosquitoes, as described here, or other host species (not shown herein). Vector competence is assessed by detecting fluorescence outside the midgut or by monitoring virus transmission7. Use of a fluorescent reporter as the GOI allows for convenient estimation of virus spread throughout a cell culture, for determination of rate of infection, dissemination in exposed mosquitoes, virus transmission from the mosquito and provides a rapid gauge of vector competence.

Methods for using alphavirus transducing systems to express fluorescent reporters in vitro and in adult mosquitoes are described. This technique may be adapted to express any protein of interest in lieu of or in addition to a reporter.

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection.  ATSs are derived from cDNA clones of ...

Immunology and Infection

Controllable Ion Channel Expression through Inducible Transient Transfection

Transfection, the delivery of foreign nucleic acids into a cell, is a powerful tool in protein research. Through this method, ion channels can be investigated through electrophysiological analysis, biochemical characterization, mutational studies, and their effects on cellular processes. Transient transfections offer a simple protocol in which the protein becomes available for analysis within a few hours to days. Although this method presents a relatively straightforward and time efficient protocol, one of the critical components is calibrating the expression of the gene of interest to physiological relevant levels or levels that are suitable for analysis. To this end, many different approaches that offer the ability to control the expression of the gene of interest have emerged. Several stable cell transfection protocols provide a way to permanently introduce a gene of interest into the cellular genome under the regulation of a tetracycline-controlled transcriptional activation. While this technique produces reliable expression levels, each gene of interest requires a few weeks of skilled work including calibration of a killing curve, selection of cell colonies, and overall more resources. Here we present a protocol that uses transient transfection of the Transient Receptor Potential cation channel subfamily V member 1 (TRPV1) gene in an inducible system as an efficient way to express a protein in a controlled manner which is essential in ion channel analysis. We demonstrate that using this technique, we are able to perform calcium imaging, whole cell, and single channel analysis with controlled channel levels required for each type of data collection with a single transfection. Overall, this provides a replicable technique that can be used to study ion channels structure and function.

Studying ion channels through a heterologously expressing system has become a core technique in biomedical research. In this manuscript, we present a time efficient method to achieve tightly controlled ion channel expression by performing transient transfection under the control of an inducible promoter.

Transfection, the delivery of foreign nucleic acids into a cell, is a powerful tool in protein research. Through this method, ion channels can be ...

Functional Characterization of Carboxylesterases in Insecticide Resistant House Flies, Musca Domestica

Carboxylesterase-mediated metabolism is thought to play a major role in insecticide resistance in various insects. Several carboxylesterase genes were found up-regulated in the resistant house fly strain, whereas their roles in conferring insecticide resistance remained to be explored. Here, we designed a protocol for the functional characterization of carboxylesterases. Three example experiments are presented: (1) expression and isolation of carboxylesterase proteins through a baculovirus-mediated insect Spodoptera frugiperda (Sf9) cell expression system; (2) a cell-based MTT (3-[4, 5-dimethykthiazol-2-yl]-2, 5-diphenyltetrazolium bromide) cytotoxicity assay to measure the tolerance of insect cells to different permethrin treatments; and (3) in vitro metabolic studies to explore the metabolic capabilities of carboxylesterases toward permethrin. The carboxylesterase gene Md&#945;E7 was cloned from a resistant house fly strain ALHF and used to construct a recombinant baculovirus for Sf9 cells infection. The cell viabilities against different permethrin treatments were measured with the MTT assay. The enhanced cell tolerance of the experimental group (Md&#945;E7-recombinant baculovirus infected cells) compared with those of the control groups (CAT-recombinant baculovirus infected cells and GFP-recombinant baculovirus infected cells) to permethrin treatments suggested the capabilities of Md&#945;E7 in metabolizing insecticides, thereby protecting cells from chemical damages. Besides that, carboxylesterase proteins were expressed in insect Sf9 cells and isolated to conduct an in vitro metabolic study. Our results indicated a significant in vitro metabolic efficiency of Md&#945;E7 toward permethrin, directly indicating the involvement of carboxylesterases in metabolizing insecticides and thus conferring insecticide resistance in house flies.

Functional Characterization of Carboxylesterases in Insecticide Resistant House Flies, Musca Domestica

Here, we present a protocol to produce house fly carboxylesterase proteins in vitro with a baculovirus mediated insect cell expression system and later functionally characterize their roles in metabolizing permethrin, thereby, conferring pyrethroid resistance by conducting cell-based MTT assay and in vitro metabolic studies.

Carboxylesterase-mediated metabolism is thought to play a major role in insecticide resistance in various insects. Several carboxylesterase genes were ...

Biochemistry

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The baculovirus-mediated insect cell expression system is one of the systems used to express recombinant eukaryotic secretory proteins with some post-translational modifications. The secretory proteins need to be routed through the secretory pathways for protein glycosylation, disulfide bonds formation, and other post-translational modifications. To improve the existing insect cell expression of secretory plant proteins, a baculovirus expression vector is modified by the addition of either a GP67 or a hemolin signal peptide sequence between the promoter and multiple-cloning sites. This newly designed modified vector system successfully produced a high yield of soluble recombinant secreted plant receptor proteins of Arabidopsis thaliana. Two of the expressed plant proteins, the extracellular domains of Arabidopsis TDR and PRK3 plasma membrane receptors, were crystallized for X-ray crystallographic studies. The modified vector system is an improved tool that can potentially be used for the expression of recombinant secretory proteins in the animal kingdom as well.

Here, we present the protocols for utilizing the insect cell and baculovirus protein expression system to produce large quantities of plant secreted proteins for protein crystallization. A baculovirus expression vector has been modified with either GP67 or insect hemolin signal peptide for plant protein secretion expression in insect cells.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

Expression of Functional Recombinant Hemagglutinin and Neuraminidase Proteins from the Novel H7N9 Influenza Virus Using the Baculovirus Expression System

The baculovirus expression system is a powerful tool for expression of recombinant proteins. Here we use it to produce correctly folded and glycosylated versions of the influenza A virus surface glycoproteins - the hemagglutinin (HA) and the neuraminidase (NA). As an example, we chose the HA and NA proteins expressed by the novel H7N9 virus that recently emerged in China. However the protocol can be easily adapted for HA and NA proteins expressed by any other influenza A and B virus strains. Recombinant HA (rHA) and NA (rNA) proteins are important reagents for immunological assays such as ELISPOT and ELISA, and are also in wide use for vaccine standardization, antibody discovery, isolation and characterization. Furthermore, recombinant NA molecules can be used to screen for small molecule inhibitors and are useful for characterization of the enzymatic function of the NA, as well as its sensitivity to antivirals. Recombinant HA proteins are also being tested as experimental vaccines in animal models, and a vaccine based on recombinant HA was recently licensed by the FDA for use in humans. The method we describe here to produce these molecules is straight forward and can facilitate research in influenza laboratories, since it allows for production of large amounts of proteins fast and at a low cost. Although here we focus on influenza virus surface glycoproteins, this method can also be used to produce other viral and cellular surface proteins.

Here we describe a way to express correctly folded and functional influenza virus surface antigens derived from the novel Chinese H7N9 virus in insect cells. The technique can be adapted to express ectodomains of any viral or cellular surface proteins.

The baculovirus expression system is a powerful tool for expression of  recombinant proteins. Here we use it to produce correctly folded and  glycosylated ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

Single-Molecule Analysis of Sf9 Purified Superprocessive Kinesin-3 Family Motors

A complex cellular environment poses challenges for single-molecule motility analysis. However, advancement in imaging techniques have improved single-molecule studies and has gained immense popularity in detecting and understanding the dynamic behavior of fluorescent-tagged molecules. Here, we describe a detailed method for&#160;in vitro single-molecule studies of kinesin-3 family motors using Total Internal Reflection Fluorescence (TIRF) microscopy. Kinesin-3 is a large family that plays critical roles in cellular and physiological functions ranging from intracellular cargo transport to cell division to development. We have shown previously that constitutively active dimeric kinesin-3 motors exhibit fast and superprocessive motility with high microtubule affinity at the single-molecule level using cell lysates prepared by expressing motor in mammalian cells. Our lab studies kinesin-3 motors and their regulatory mechanisms using cellular, biochemical and biophysical approaches, and such studies demand purified proteins at a large scale. Expression and purification of these motors using mammalian cells would be expensive and time-consuming, whereas expression in a prokaryotic expression system resulted in significantly aggregated and&#160;inactive protein. To overcome the limitations posed by bacterial purification systems and mammalian cell lysate, we have established a robust Sf9-baculovirus expression system to express and purify these motors. The kinesin-3 motors are C-terminally tagged with 3-tandem fluorescent proteins (3xmCitirine or 3xmCit) that provide enhanced signals and decreased photobleaching. In vitro single-molecule and multi-motor gliding analysis of Sf9 purified proteins demonstrate that kinesin-3 motors are fast and superprocessive akin to our previous studies using mammalian cell lysates. Other applications using these assays include detailed knowledge of oligomer conditions of motors, specific binding partners paralleling biochemical studies, and their kinetic state.

This study details purification of KIF1A(1-393LZ), a member of kinesin-3 family, using Sf9-baculovirus expression system. In vitro single-molecule and multi-motor gliding analysis of these purified motors exhibited robust motility properties comparable to motors from mammalian cell lysate. Thus, Sf9-baculovirus system is amenable to express and purify motor protein of interest.

A complex cellular environment poses challenges for single-molecule motility analysis. However, advancement in imaging techniques have improved ...

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the flexible, low-cost production of high-quality, bioactive products.
In this study, we compared the expression of a target human recombinant protein in traditional fermenter-based cell cultures (bacterial and insect) with plant-based expression systems, both transient and stable.
For each platform, we described the set-up, optimization and length of the production process, the final product quality and the yields and we evaluated provisional production costs, specific for the selected target recombinant protein.
Overall, our results indicate that bacteria are unsuitable for the production of the target protein due to its accumulation within insoluble inclusion bodies. On the other hand, plant-based systems are versatile platforms that allow the production of the selected protein at lower-costs than Baculovirus/insect cell system. In particular, stable transgenic lines displayed the highest-yield of the final product and transient expressing plants the fastest process development. However, not all recombinant proteins may benefit from plant-based systems but the best production platform should be determined empirically with a case-by-case approach, as described here.

In this study the expression of a target human recombinant protein in different production platforms was compared. We focused on traditional fermenter-based cultures and on plants, describing the set-up of each system and highlighting, on the basis of the reported results, the inherent limits and advantages for each platform.

Plant-based systems are considered a valuable platform for the production of recombinant proteins as a result of their well-documented potential for the ...

Biology

High Yield Expression of Recombinant Human Proteins with the Transient Transfection of HEK293 Cells in Suspension

The art of producing recombinant proteins with complex post-translational modifications represents a major challenge for studies of structure and function. The rapid establishment and high recovery from transiently-transfected mammalian cell lines addresses this barrier and is an effective means of expressing proteins that are naturally channeled through the ER and Golgi-mediated secretory pathway. Here is one protocol for protein expression using the human HEK293F and HEK293S cell lines transfected with a mammalian expression vector designed for high protein yields. The applicability of this system is demonstrated using three representative glycoproteins that expressed with yields between 95-120 mg of purified protein recovered per liter of culture. These proteins are the human Fc&#947;RIIIa and the rat &#945;2-6 sialyltransferase, ST6GalI, both expressed with an N-terminal GFP fusion, as well as the unmodified human immunoglobulin G1 Fc. This robust system utilizes a serum-free medium that is adaptable for expression of isotopically enriched proteins and carbohydrates for structural studies using mass spectrometry and nuclear magnetic resonance spectroscopy. Furthermore, the composition of the N-glycan can be tuned by adding a small molecule to prevent certain glycan modifications in a manner that does not reduce yield.

Laboratory-scale production of eukaryotic proteins with appropriate post-translational modification represents a significant barrier. Here is a robust protocol with rapid establishment and turnaround for protein expression using a mammalian expression system. This system supports selective amino acid, selective labeling of proteins and small molecule modulators of glycan composition.

The art of producing recombinant proteins with complex post-translational modifications represents a major challenge for studies of structure and ...

Transient Expression and Cellular Localization of Recombinant Proteins in Cultured Insect Cells

Heterologous protein expression systems are used for the production of recombinant proteins, the interpretation of cellular trafficking/localization, and the determination of the biochemical function of proteins at the sub-organismal level. Although baculovirus expression systems are increasingly used for protein production in numerous biotechnological, pharmaceutical, and industrial applications, nonlytic systems that do not involve viral infection have clear benefits but are often overlooked and underutilized. Here, we describe a method for generating nonlytic expression vectors and transient recombinant protein expression. This protocol allows for the efficient cellular localization of recombinant proteins and can be used to rapidly discern protein trafficking within the cell. We show the expression of four&#160;recombinant proteins in a commercially available insect cell line, including two aquaporin proteins from the insect Bemisia tabaci, as well as subcellular marker proteins specific for the cell plasma membrane and for intracellular lysosomes. All recombinant proteins were produced as chimeras with fluorescent protein markers at their carboxyl termini, which allows for the direct detection of the recombinant proteins. The double transfection of cells with plasmids harboring constructs for the genes of interest and a known subcellular marker allows for live cell imaging and improved validation of cellular protein localization.

Nonlytic insect cell expression systems are underutilized for production, cellular trafficking/localization, and recombinant protein functional analysis. Here, we describe methods to generate expression vectors and subsequent transient protein expression in commercially available lepidopteran cell lines. The co-localization of Bemisia tabaci aquaporins with subcellular fluorescent marker proteins is also presented.

Heterologous protein expression systems are used for the production of recombinant proteins, the interpretation of cellular trafficking/localization, and ...

Transient Expression of Foreign Genes in Insect Cells (sf9) for Protein Functional Assay

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Alphavirus Transducing System: Tools for Visualizing Infection in Mosquito Vectors

Controllable Ion Channel Expression through Inducible Transient Transfection

Functional Characterization of Carboxylesterases in Insecticide Resistant House Flies, Musca Domestica

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Expression of Functional Recombinant Hemagglutinin and Neuraminidase Proteins from the Novel H7N9 Influenza Virus Using the Baculovirus Expression System

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Single-Molecule Analysis of Sf9 Purified Superprocessive Kinesin-3 Family Motors

A Comparative Analysis of Recombinant Protein Expression in Different Biofactories: Bacteria, Insect Cells and Plant Systems

High Yield Expression of Recombinant Human Proteins with the Transient Transfection of HEK293 Cells in Suspension

Transient Expression and Cellular Localization of Recombinant Proteins in Cultured Insect Cells