This work was supported by the new faculty startup funds from North Carolina State University for Guozhou Xu.

NOTE: An insect cell/baculovirus system with modified expression vectors for secretory plant protein expression and crystallization is used.
1. Modification of a Baculovirus Expression Vector with the GP67 Signal Peptide for Plant Protein Secretion Expression
<ol>
	<li>Synthesize a DNA fragment containing a 5&#39; BglII cutting site13, the GP67 secretion signal sequence, and a multi-cloning site with NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI, and XhoI (Figure 1A). 
	NOTE: Since both BglII and BamHI digested DNA resulted in the same adhesive ends, the linearized vector can ligate to the digested DNA fragment while both the BglII and BamHI sites in the annealed ligation sequence will be mutated to a sequence that is not cleavable by either BglII or BamHI14.</li>
	<li>Digest 4 &#181;g of the DNA with BglII and XhoI, and 4 &#181;g of an expression vector DNA with BamHI and XhoI14. Mix 10 units of each restriction enzyme with the DNA in a 1x concentration reaction buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, and 100 &#181;g/mL BSA, pH 7.9 at 25 &#176;C) and incubate the mixture at 37 &#176;C for 4 h.
	<ol>
		<li>Purify the excised DNA fragment and the linearized vector DNA by a DNA gel extraction kit15.</li>
	</ol>
	</li>
	<li>Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-&#181;L ligation reaction mixture containing 1x T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, and 10 mM DTT, pH 7.5 at 25 &#176;C) and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 &#176;C for 16 h.</li>
	<li>Transform 5 &#181;L of the ligation mixture into 100 &#181;L of DH5&#945; competent cells following a standard transformation protocol and select the resulting colonies on an ampicillin-LB agar plate16. Pick up 5 - 10 colonies and grow each colony in 2 mL of LB medium containing 100 &#181;g/mL ampicillin at 220 rpm and 37 &#176;C in a shaking incubator for 16 h.</li>
	<li>Extract each plasmid DNA with a DNA miniprep kit17 and confirm the clones by DNA sequencing with a primer AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-amplify the A. thaliana TDR gene fragment encoding residues 30 - 642 from a synthetic TDR gene construct (forward primer: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, reverse primer: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplify the DNA for 30 cycles in a DNA polymerase reaction buffer containing a 0.5 mM dNTP mix, 0.2 &#181;M primers, 0.1 &#181;g of template DNA, 0.4 mM MgCl2, and 1 reaction unit of the DNA polymerase.
	<ol>
		<li>For the PCR cycle steps, set the initial denaturation at 95 &#176;C for 30 s, and then 30 cycles of denaturation at 95 &#176;C for 30 s, annealing at 55 &#176;C for 30 s, and extension at 72 &#176;C for 1 min, with a final extension at 72 &#176;C for 5 min.</li>
	</ol>
	</li>
	<li>Digest both the PCR fragment and the modified vector with NotI and BamHI restriction endonuclease enzymes. Ligate the gene fragment with the linearized vector. Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-&#181;L ligation reaction mixture containing T4 DNA ligase reaction buffer and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 &#176;C for 16 h.</li>
	<li>Transform 5 &#181;L of the ligation mixture into 100 &#181;L of DH5&#945; competent cells following a standard transformation protocol and select the resulting colonies on an ampicillin-LB agar plate16. Confirm the correct clones by DNA sequencing.</li>
</ol>
2. Modification of a Baculovirus Expression Vector with the Insect Hemolin Signal Peptide for Plant Protein Secretion Expression
<ol>
	<li>Synthesize a DNA fragment containing a 5&#39; BglII cutting site13, the insect hemolin secretion signal sequence, and a multi-cloning site with NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI, and XhoI (Figure 1B).</li>
	<li>Digest 4 &#181;g of the DNA with BglII and XhoI, and 4 &#181;g of an expression vector DNA with BamHI and XhoI14. Mix 10 units of each restriction enzyme with the DNA in a 1x concentration reaction buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, and 100 &#181;g/mL BSA, pH 7.9 at 25 &#176;C) and incubate the mixture at 37 &#176;C for 4 h.
	<ol>
		<li>Purify the excised DNA fragment and the linearized vector DNA by a DNA gel extraction kit15.</li>
	</ol>
	</li>
	<li>Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-&#181;L ligation reaction mixture containing 1x T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, and 10 mM DTT, pH 7.5 at 25 &#176;C) and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 &#176;C for 16 h.</li>
	<li>Transform 5 &#181;L of the ligation mixture into 100 &#181;L of DH5&#945; competent cells and select the colonies on an ampicillin-LB agar plate. Pick up 5 - 10 colonies and grow each colony in a 2-mL LB medium containing 100 &#181;g/mL of ampicillin at 220 rpm and 37 &#176;C in a shaking incubator for 16 h.</li>
	<li>Extract plasmid DNA with a DNA miniprep kit17 and confirm the clones by DNA sequencing with a primer AGTATTTTACTGTTTTCGTAACAG.</li>
	<li>PCR-amplify A. thaliana Pollen Receptor Kinase 3 (PRK3) gene fragment encoding residues 20 - 237 from a synthetic PRK3 gene construct (forward primer: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, reverse primer: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplify the DNA for 30 cycles in a DNA polymerase reaction buffer containing a 0.5 mM dNTP mix, 0.2 &#181;M primers, 0.1 &#181;g of template DNA, 0.4 mM MgCl2, and 1 reaction unit of the DNA polymerase.
	<ol>
		<li>For the PCR cycle steps, set the initial denaturation at 95 &#176;C for 30 s, and then 30 cycles of denaturation at 95 &#176;C for 30 s, annealing at 55 &#176;C for 30 s, and extension at 72 &#176;C for 30 s within each cycle, and the final extension at 72 &#176;C for 5 min.</li>
	</ol>
	</li>
	<li>Digest both the PCR fragment and the modified vector with NotI and BamHI restriction endonuclease enzymes. Ligate the gene fragment with the linearized vector. Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-&#181;L ligation reaction mixture containing T4 DNA ligase reaction buffer and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 &#176;C for 16 h.</li>
	<li>Transform 5 &#181;L of the ligation mixture into 100 &#181;L of DH5&#945; competent cells following a standard transformation protocol and select the resulting colonies on an ampicillin-LB agar plate16. Confirm the correct clones by DNA sequencing.</li>
</ol>
3. Production and Amplification of Baculovirus Constructs Harboring the Recombinant Protein Expression Cassette
<ol>
	<li>Use 100 ng of the construct plasmid to transform 40 &#181;L of DH10Bac competent cells following the protocol of the baculovirus expression system1. Incubate the transformation plates at 37 &#176;C for 48 h.</li>
	<li>Pick up two white colonies from each transformation plate, inoculate each colony into 2 mL of LB medium containing 50 &#181;g/mL kanamycin, 7 &#181;g/mL gentamicin, and 10 &#181;g/mL tetracycline. Follow the protocol of the baculovirus expression system1 to extract and verify the bacmid DNA. Aliquot each DNA in two tubes with 20 &#181;L each, and store the tubes at -20 &#176;C. 
	NOTE: The following steps require an aseptic operation.</li>
	<li>Grow a monolayer of Sf9 cells in the culture media with 10% fetal bovine serum (FBS) and 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics at 27 &#176;C to 80% confluence in a 6-well plate. Estimate the percentage of confluence based on the percentage of covered area on the tissue culture plate.</li>
	<li>Prepare the following solutions in two sterile 1.5-mL centrifuge tubes.
	<ol>
		<li>Tube 1: For each transfection, dilute 20 &#181;L of bacmid DNA into 100 &#181;L of unsupplemented Sf9 cell culture medium without antibiotics. Mix the dilution gently by flicking the side of the tube.</li>
		<li>Tube 2: For each transfection, dilute 8 &#181;L of lipid transfection reagent into 100 &#181;L of unsupplemented Sf9 cell culture medium without antibiotics. Mix the dilution thoroughly by pipetting up and down for 6x.</li>
	</ol>
	</li>
	<li>Combine the two solutions, mix them gently by pipetting slowly up and down for 3x, and incubate them for 20 - 40 min at room temperature.</li>
	<li>Wash each well of the Sf9 monolayer cells 2x with 3 mL of unsupplemented Sf9 cell culture medium without antibiotics. For each transfection, add 0.8 mL of unsupplemented Sf9 cell culture medium without antibiotics to each tube containing the lipid-DNA mixture. Mix the contents of the tubes gently by pipetting slowly up and down for 3x. Aspirate the wash media from the plates and overlay the samples with the transfection mixture.</li>
	<li>After the addition of the transfection mixture, incubate the transfected plate for 5 h at 27 &#176;C. Replace the transfection media with the complete Sf9 cell culture medium containing 10% FBS and 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics. Incubate the transfected plate at 27 &#176;C for 4 d.</li>
	<li>Harvest and amplify the recombinant baculovirus.
	<ol>
		<li>Collect the supernatant of the infected plate in a sterile 15-mL conical tube after 4 d of incubation. Spin the supernatant at 1010 x g for 5 min to remove the cell debris. Discard the pellet and decant the supernatant to a clean tube and store it at 4 &#176;C for up to 1 year. 
		NOTE: This is the P0 virus. It can be aliquoted and stored at -80 &#176;C for a longer period of time.</li>
		<li>To amplify each recombinant virus, grow a monolayer of Sf9 cells on a 150-mm plate to 80% confluence. Aspirate the media from the plate, add 2 mL of the P0 virus to the cells adherent to the plate and incubate the plate for 1 h in a 27 &#176;C incubator. Rock the plate every 15 min to mix the medium with the cells.
		<ol>
			<li>Add 25 mL of complete Grace&#39;s media containing 10% FBS and 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics. Incubate the plate for 3 d in a 27 &#176;C incubator to obtain the P1 passage virus.</li>
		</ol>
		</li>
		<li>Collect the supernatant of the infected plate in a sterile 50-mL conical tube and spin at 1010 x g for 5 min to remove the cell debris. Decant the supernatant to a clean tube and store it at 4 &#176;C for up to 1 year. 
		NOTE: The P1 virus can be aliquoted and stored at -80 &#176;C for a longer period of time.</li>
		<li>To amplify the virus from P1 to P2 passage, grow a monolayer of Sf9 cells on a 150-mm plate to 90% confluence, aspirate the media of the plate, add 2 mL of the P1 virus to the plate, and incubate it for 1 h in a 27 &#176;C incubator.</li>
		<li>Repeat steps 3.8.2 and 3.8.3 to obtain the P2 and P3 passages of the viruses. Do not store the P3 virus for more than 2 months.</li>
	</ol>
	</li>
</ol>
4. Protein Expression, Purification with NiNTA, and Crystallization
<ol>
	<li>Culture 1 L of Hi5 insect cells in the culture media with 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics to a density of 2 x 106 at 100 rpm in a 27 &#176;C incubator shaker. Spin down the cells at 570 x g for 5 min, decant the supernatant, resuspend the cells in 20 mL of the freshly produced P3 virus, and keep it at room temperature for 1 h. Gently shake the spin bottle to resuspend the cells 1x every 15 min.</li>
	<li>Transfer the cells to 1 L of culture media with 100 &#181;g/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics, culture the cells at 100 rpm in a 27 &#176;C incubator shaker for 72 h. Spin down the cells at 1,010 x g for 5 min and collect the supernatant.</li>
	<li>Use pH indicator strips to adjust the pH of the supernatant to 8.0 by adding either 0.1 M HCl or 0.1 M NaOH and add binding buffer at a final concentration, containing 20 mM Tris buffer at pH 8.0, 100 mM NaCl, and 5 mM imidazole. Add a certain amount of NiNTA resin (10 - 40 mL) based on the estimated yield of the expressed His-tagged recombinant protein.
	<ol>
		<li>Mix the solution on a magnetic stir with low speed at 4 &#176;C for 1 h. Wash the resin and elute the bound protein following the standard NiNTA purification protocol18.</li>
	</ol>
	</li>
	<li>Subject the purified protein to ion exchange and gel filtration chromatography, as well as other protein purification methods, to yield a homogeneous sample. 
	NOTE: For the TDR ectodomain, 20 mM Tris, pH 8, 100 mM NaCl were used as gel filtration buffer. For the PRK3 ectodomain, 20 mM bis-Tris, pH 6, 100 mM NaCl were used as the preferred gel filtration buffer.</li>
</ol>

<ol>
	<li>Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+using+the+baculovirus-insect+cell+expression+system.">Protein production using the baculovirus-insect cell expression system.</a> Biotechnology Progress. 30, 1-18 (2014).</li><li>Khan, S., Ng, M. L., Tan, Y. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+the+severe+acute+respiratory+syndrome+coronavirus+3a+protein+and+the+assembly+of+coronavirus-like+particles+in+the+baculovirus+expression+system.">Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system.</a> Methods in Molecular Biology. 379, 35-50 (2007).</li><li>Possee, R. D., King, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+Transfer+Vectors.">Baculovirus Transfer Vectors.</a> Methods in Molecular Biology. 1350, 51-71 (2016).</li><li>Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+establishment+of+two+cell+lines+from+the+insect+Spodoptera+frugiperda+(Lepidoptera;+Noctuidae).">The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae).</a> In Vitro. 13, 213-217 (1977).</li><li>Hink, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Established+insect+cell+line+from+the+cabbage+looper,+Trichoplusia+ni.">Established insect cell line from the cabbage looper, Trichoplusia ni.</a> Nature. 226, 466-467 (1970).</li><li>Davis, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+recombinant+protein+production+of+eight+insect+cell+lines.">Comparative recombinant protein production of eight insect cell lines.</a> In Vitro Cellular &amp; Development Biology - Animal. 29A, 388-390 (1993).</li><li>Wickham, T. J., Nemerow, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+growth+methods+and+recombinant+protein+production+in+BTI-Tn-5B1-4+insect+cells+using+the+baculovirus+expression+system.">Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system.</a> Biotechnology Progress. 9, 25-30 (1993).</li><li>Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Baculovirus+expression+of+alkaline+phosphatase+as+a+reporter+gene+for+evaluation+of+production,+glycosylation+and+secretion.">Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion.</a> Nature Biotechnology. 10, 1148-1150 (1992).</li><li>Murphy, C. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+expression,+secretion,+and+large-scale+purification+of+recombinant+HIV-1+gp120+in+insect+cell+using+the+baculovirus+egt+and+p67+signal+peptides.">Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides.</a> Protein Expression and Purification. 4, 349-357 (1993).</li><li>Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemolin:+an+insect-immune+protein+belonging+to+the+immunoglobulin+superfamily.">Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily.</a> Science. 250, 1729-1732 (1990).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+CLE+peptide+perception+by+plant+receptors+implicated+from+structural+and+functional+analyses+of+TDIF-TDR+interactions.">Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions.</a> PLoS One. 12, e0175317 (2017).</li><li>Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Extracellular+Domain+of+Pollen+Receptor+Kinase+3+is+structurally+similar+to+the+SERK+family+of+co-receptors.">The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors.</a> Scientific Reports. 8, 2796 (2018).</li><li>Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Total+synthesis+of+a+gene.">Total synthesis of a gene.</a> Science. 203, 614-625 (1979).</li><li>Bahl, C. P., Marians, K. J., Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+for+inserting+specific+DNA+sequences+into+cloning+vehicles.">A general method for inserting specific DNA sequences into cloning vehicles.</a> Gene. 1, 81-92 (1976).</li><li>Xu, W., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+Characterization+of+Vaccine-Derived+Polioviruses,+Relevance+for+the+Global+Polio+Eradication+Initiative.">Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative.</a> Methods in Molecular Biology. 1387, 213-226 (2016).</li><li>Hanahan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+transformation+of+Escherichia+coli+with+plasmids.">Studies on transformation of Escherichia coli with plasmids.</a> Journal of Molecular Biology. 166, 557-580 (1983).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Reddy, B. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+the+alpha+subunit+of+the+epithelial+sodium+channel,+ENaC.">Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC.</a> Protein Expression and Purification. 117, 67-75 (2016).</li><li>Harris, T. J., Emtage, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+heterologous+genes+in+E.+coli.">Expression of heterologous genes in E. coli.</a> Microbiological Sciences. 3, 28-31 (1986).</li><li>Kaur, J., Kumar, A., Kaur, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+optimization+of+heterologous+protein+expression+in+E.+coli:+Roadblocks+and+reinforcements.">Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements.</a> International Journal of BIological Macromolecules. 106, 803-822 (2018).</li><li>Guo, Y., Yang, F., Tang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+of+Protein+Secretion+in+Yeast+and+Animal+Cells.">An Overview of Protein Secretion in Yeast and Animal Cells.</a> Methods in Molecular Biology. 1662, 1-17 (2017).</li><li>Blight, M. A., Chervaux, C., Holland, I. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+pathway+in+Escherichia+coli.">Protein secretion pathway in Escherichia coli.</a> Current Opinion in Biotechnology. 5, 468-474 (1994).</li><li>Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+protein+secretion+in+yeast:+strategies+and+impact+on+protein+production.">Engineering of protein secretion in yeast: strategies and impact on protein production.</a> Applied Microbiology and Biotechnology. 86, 403-417 (2010).</li><li>Wormald, M. R., Dwek, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycoproteins:+glycan+presentation+and+protein-fold+stability.">Glycoproteins: glycan presentation and protein-fold stability.</a> Structure. 7, R155-R160 (1999).</li><li>Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Overview+and+History+of+Glyco-Engineering+in+Insect+Expression+Systems.">An Overview and History of Glyco-Engineering in Insect Expression Systems.</a> Methods in Molecular Biology. 1321, 131-152 (2015).</li><li>Li, Z., Chakraborty, S., Xu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-ray+crystallographic+studies+of+the+extracellular+domain+of+the+first+plant+ATP+receptor,+DORN1,+and+the+orthologous+protein+from+Camelina+sativa.">X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa.</a> Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).</li><li>Aricescu, A. R., Owens, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+recombinant+glycoproteins+in+mammalian+cells:+towards+an+integrative+approach+to+structural+biology.">Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology.</a> Current Opinion in Structural Biology. 23, 345-356 (2013).</li><li>Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scale-up+of+hydrophobin-assisted+recombinant+protein+production+in+tobacco+BY-2+suspension+cells.">Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells.</a> Plant Biotechnology Journal. 12, 402-410 (2014).</li><li>Dohi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+virus-mediated+expression+of+a+foreign+protein+in+suspension-cultured+plant+cells.">Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells.</a> Archives of Virology. 151, 1075-1084 (2006).</li></ol>

The authors have nothing to disclose.

Given the diversity in size and stability of the thousands of proteins present in the biological systems, it is often empirical for a research laboratory to decide which heterologous expression system has to be chosen for the expression of a specific protein. The E. coli expression system is often the first choice for protein expression due to the short life cycle of the bacteria, low cost of the culture media, and relative ease to scale up19. For the expression of large eukaryotic protei...

It is imperative for a research laboratory to be capable of producing large quantities of homogeneous recombinant proteins for biochemical and biophysical characterizations, especially for X-ray crystallographic studies. There are many well-established heterologous expression systems such as Escherichia coli, yeast, insect cells, mammalian cells, plant cells, etc. Among them, the baculovirus-mediated insect cell expression system is one of the most commonly used techniques to produce large quantities of structurally folded large-sized recombinant eukaryotic proteins for protein crystallization1.
The expression vectors of the baculovirus expression system are engineered to contain a strong polyhedrin or P10 promoter to produce a high yield of recombinant intracellular proteins2,3. To make a recombinant baculovirus, the gene of interest is cloned into an insect vector containing the polyhedrin (polh) locus of the Autographa californica multi-nucleopolyhedroviral genome. The resulting construct is then sequenced and its correct open reading frame (ORF) is verified. The correct construct is then introduced into the host insect cell through the process of transfection. The gene of interest is inserted into the viral genome by homologous recombination. This event results in the production of the recombinant viral genome, which then replicates to produce recombinant budded virus particles1.
The insect cells that are most commonly used in the expression system are Sf9 and High Five (Hi5) cells. Sf9 cells are a clonal isolate of Sf21, derived from the pupal ovarian cells of Spodoptera frugiperda, and Hi5 cells are a clonal isolate derived from the parental Trichoplusia ni ovarian cell line TN-3684,5. Co-transfections, virus amplification, and plaque assays are conducted on Sf9 cells, while Hi5 cells are typically selected to produce higher quantities of recombinant proteins6. It is worth noting that the Hi5 cells are not suitable for the generation and amplification of virus progenies because of their tendency to produce mutant viruses. Traditionally, a temperature range of 25 - 30 &#176;C is considered to be good for the cultivation of insect cells. However, it has been reported that 27 - 28 &#176;C is the optimal temperature for the insect cell growth and infection7,8.
The introduction of a strong signal sequence preceding the gene is needed for the high expression of the secreted proteins. The signal sequence would efficiently guide the translated recombinant protein into the endoplasmic reticulum for protein secretion and post-translational modifications necessary for proper folding and stabilization3. Signal peptide sequences, such as the baculovirus envelop protein GP64/67, honeybee melittin, and others, have been chosen to facilitate the expression of secretory recombinant proteins in the baculovirus-mediated expression systems3. The introduction of the signal peptide of GP67 has been shown to improve the expression yield of a secreted recombinant protein, in comparison to using the intrinsic signal peptide of the target gene9. Hemolin is a hemolymph protein of the giant silk moth Hyalophora cecropia, induced upon bacteria infection10. Due to the relatively high level of induced expression, the signal peptide sequence of the gene can be used to mediate the secretion expression of the recombinant proteins in the baculovirus-insect cell system.
The A. thaliana Tracheary Element Differentiation Inhibitory Factor Receptor (TDR) and Pollen Receptor Kinase 3 (PRK3) both belong to the plant Leucine-rich Repeat Receptor-like Kinase (LRR-RLK) family of proteins11,12. In order to study the structure and function of this family of plant receptor proteins, as well as to facilitate the structural and biochemical characterization of other plant secreted proteins, the baculovirus-insect cell expression system has been modified to improve protein quality and production yield. The extracellular domains of both TDR and PRK3 have successfully been expressed using two modified expression vectors in the baculovirus-insect cell expression system. Both the extracellular domains of TDR and PRK3 proteins have been crystallized. This article reports the expression and purification of large amounts of recombinant secreted plant proteins with two modified baculovirus expression vectors by incorporating either a GP67 or a hemolin signal sequence between the promoter and multiple cloning sites.

<table>
	<tbody>
		<tr>
			<td>Incubator shaker</td>
			<td>VWR</td>
			<td>Model Excella E25</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>VWR</td>
			<td>Model 2005</td>
			<td>27 oC</td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>BECKMAN</td>
			<td>Model J-6</td>
			<td>with a swing bucket rotor</td>
		</tr>
		<tr>
			<td>Herculase II Fusion DNA Polymerase</td>
			<td>Agilent</td>
			<td>600677-51</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>BIO-RAD</td>
			<td>Model C1000 Touch</td>
			<td>For PCR amplification of DNA</td>
		</tr>
		<tr>
			<td>Incubator shaker</td>
			<td>New Brunswick Scientific</td>
			<td>Model I 24</td>
			<td>For growing baceria culture</td>
		</tr>
		<tr>
			<td>Customer DNA synthesis</td>
			<td>GENSCRIPT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3136S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>BglII</td>
			<td>New England Biolabs</td>
			<td>R0144S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>NotI (HF)</td>
			<td>New England Biolabs</td>
			<td>R3189S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>New England Biolabs</td>
			<td>R0146S</td>
			<td>Restriction Endonuclease</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>New England Biolabs</td>
			<td>M0202T</td>
			<td>DNA ligation</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td>DNA purification from Agorase gel</td>
		</tr>
		<tr>
			<td>QIAprep Spin Miniprep Kit</td>
			<td>Qiagen</td>
			<td>27104</td>
			<td>Plasmid DNA purification from bacteria culture</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Thermo Fisher Scientific</td>
			<td>15510-019</td>
			<td>For DNA gel electropherosis</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH5&#945; competen cell</td>
			<td>Invitrogen</td>
			<td>18-258-012</td>
			<td>For transformation of DNA ligation mixture</td>
		</tr>
		<tr>
			<td>Lennox L LB Broth</td>
			<td>Research Product International Corp.</td>
			<td>L24066-5000.0</td>
			<td>For making bacteria culture</td>
		</tr>
		<tr>
			<td>Ampicillin sodium salt</td>
			<td>Thermo Fisher Scientific</td>
			<td>11593-019</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Kanamycin Sulfate</td>
			<td>Thermo Fisher Scientific</td>
			<td>15160-054</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Thermo Fisher Scientific</td>
			<td>64-75-5</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>Gentamicin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15710-064</td>
			<td>Antibiotics</td>
		</tr>
		<tr>
			<td>MAX Efficiency DH10Bac competent cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>10361-012</td>
			<td>For making bacmid DNA</td>
		</tr>
		<tr>
			<td>S.O.C. Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>15544-034</td>
			<td>For DNA transformation</td>
		</tr>
		<tr>
			<td>CellFECTIN II Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>10362-101</td>
			<td>Insect cell transfection reagent</td>
		</tr>
		<tr>
			<td>Bac-to-Bac Expression System</td>
			<td>Thermo Fisher Scientific</td>
			<td>10359-016</td>
			<td>Baculovirus-insect cells expression kit</td>
		</tr>
		<tr>
			<td>Bluo-gal</td>
			<td>Thermo Fisher Scientific</td>
			<td>15519-028</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Thermo Fisher Scientific</td>
			<td>15529-019</td>
			<td>For isolation of recominant Bacmid DNA</td>
		</tr>
		<tr>
			<td>pFastBac1</td>
			<td>Thermo Fisher Scientific</td>
			<td>10360014</td>
			<td>Baculorirus expression vector</td>
		</tr>
		<tr>
			<td>Sf9 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>11496015</td>
			<td>Sf9 monolayer cells</td>
		</tr>
		<tr>
			<td>Hi5 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>B85502</td>
			<td>High Five insect cells</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, unsupplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11595030</td>
			<td>Sf9 cell transfection minimum medium</td>
		</tr>
		<tr>
			<td>Grace&#8217;s insect medium, supplemented</td>
			<td>Thermo Fisher Scientific</td>
			<td>11605102</td>
			<td>Sf9 monolayer cell culture complete medium</td>
		</tr>
		<tr>
			<td>Sf-900 II SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10902104</td>
			<td>Sf9 suspension cell culture medium without FBS</td>
		</tr>
		<tr>
			<td>Express Five SFM</td>
			<td>Thermo Fisher Scientific</td>
			<td>10486025</td>
			<td>Hi5 cell culture medium</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td>100 ml (10,000 I.U./ml)</td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>25030081</td>
			<td>100 ml</td>
		</tr>
		<tr>
			<td>FBS Certified</td>
			<td>Thermo Fisher Scientific</td>
			<td>16000-044</td>
			<td>500 ml</td>
		</tr>
		<tr>
			<td>6-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>08-772-1B</td>
			<td>Flat-bottom</td>
		</tr>
		<tr>
			<td>150 mm plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>353025</td>
			<td>100/case</td>
		</tr>
		<tr>
			<td>1.5 ml Microcentrifuge Tubes</td>
			<td>USA Scientific</td>
			<td>1415-2500</td>
			<td>500 tubes/bag</td>
		</tr>
		<tr>
			<td>15 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1475-0511</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>50 ml conical screw cap centrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1500-1211</td>
			<td>25 tubes/bag</td>
		</tr>
		<tr>
			<td>Ni-NTA Superflow</td>
			<td>Qiagen</td>
			<td>30430</td>
			<td>NiNTA resin</td>
		</tr>
		<tr>
			<td>pH-indicator strips</td>
			<td>EMD Millipore Corporation</td>
			<td>1.09535.0001</td>
			<td>pH 0 - 14</td>
		</tr>
	</tbody>
</table>

modifying baculovirus expression vectors to produce secreted plant proteins in insect cells

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The baculovirus-mediated insect cell expression system is one of the systems used to express recombinant eukaryotic secretory proteins with some post-translational modifications. The secretory proteins need to be routed through the secretory pathways for protein glycosylation, disulfide bonds formation, and other post-translational modifications. To improve the existing insect cell expression of secretory plant proteins, a baculovirus expression vector is modified by the addition of either a GP67 or a hemolin signal peptide sequence between the promoter and multiple-cloning sites. This newly designed modified vector system successfully produced a high yield of soluble recombinant secreted plant receptor proteins of Arabidopsis thaliana. Two of the expressed plant proteins, the extracellular domains of Arabidopsis TDR and PRK3 plasma membrane receptors, were crystallized for X-ray crystallographic studies. The modified vector system is an improved tool that can potentially be used for the expression of recombinant secretory proteins in the animal kingdom as well.

As shown in Figure 1, two modified pFastBac1 baculovirus expression vectors were used to express the secreted proteins with either the GP67 or the hemolin signal sequence to replace the intrinsic signal sequence of the target gene. The viral GP67 and the insect hemolin genes have been demonstrated to have high secretion expression levels in the cells. Fusion proteins with either of these two signal sequences are expected to have greatly improved secretion exp...

Watch this Scientific Journal Video about Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells at JoVE.com

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Here, we present the protocols for utilizing the insect cell and baculovirus protein expression system to produce large quantities of plant secreted proteins for protein crystallization. A baculovirus expression vector has been modified with either GP67 or insect hemolin signal peptide for plant protein secretion expression in insect cells.

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The ...

modifying-baculovirus-expression-vectors-to-produce-secreted-plant

Research

JoVE Journal

Biochemistry

11.4K Views.  North Carolina State University. Here, we present the protocols for utilizing the insect cell and baculovirus protein expression system to produce large quantities of plant secreted proteins for protein crystallization. A baculovirus expression vector has been modified with either GP67 or insect hemolin signal peptide for plant protein secretion expression in insect cells.

Video: Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Dissipative Microgravimetry to Study the Binding Dynamics of the Phospholipid Binding Protein Annexin A2 to Solid-supported Lipid Bilayers Using a Quartz Resonator

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic properties of the absorbed/immobilized mass on sensor surfaces, allowing the measurements of the interaction of proteins with solid-supported surfaces, such as lipid bilayers, in real-time and with a high sensitivity. Annexins are a highly conserved group of phospholipid-binding proteins that interact reversibly with the negatively charged headgroups via the coordination of calcium ions. Here, we describe a protocol that was employed to quantitatively analyze the binding of annexin A2 (AnxA2) to planar lipid bilayers prepared on the surface of a quartz sensor. This protocol is optimized to obtain robust and reproducible data and includes a detailed step-by-step description. The method can be applied to other membrane-binding proteins and bilayer compositions.

Here, we present an experimental protocol that can be employed to determine the binding affinities and mode of interaction of label-free phospholipid-binding protein annexin A2 with immobilized solid-supported bilayers (SLB) by simultaneously measuring the mass uptake and the viscoelastic properties of the protein annexin A2.

The dissipative quartz crystal microbalance technique is a simple and label-free approach to measure simultaneously the mass uptake and viscoelastic ...

How to Quantify the Fraction of Photoactivated Fluorescent Proteins in Bulk and in Live Cells

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells and protein ensembles. Thus far, no method has been available to quantify in bulk and in live cells how many of the PA-FPs expressed are photoactivated to fluoresce.
Here, we present a protocol involving internal rulers, i.e., genetically coupled spectrally distinct (photoactivatable) fluorescent proteins, to ratiometrically quantify the fraction of all PA-FPs expressed in a cell that are switched on to be fluorescent. Using this protocol, we show that different modes of photoactivation yielded different photoactivation efficiencies. Short high-power photoactivation with a confocal laser scanning microscope (CLSM) resulted in up to four times lower photoactivation efficiency than hundreds of low-level exposures applied by CLSM or a short pulse applied by widefield illumination. While the protocol has been exemplified here for (PA-)GFP and (PA-)Cherry, it can in principle be applied to any spectrally distinct photoactivatable or photoconvertible fluorescent protein pair and any experimental set-up.

Here, we present a protocol that involves genetically coupled spectrally distinct photoactivatable and fluorescent proteins. These fluorescent protein chimeras permit quantification of the PA-FP fraction that is photoactivated to be fluorescent, i.e., the photoactivation efficiency. The protocol reveals that different modes of photoactivation yield different photoactivation efficiencies.

Photoactivatable and -convertible fluorescent proteins (PA-FPs) have been used in fluorescence live-cell microscopy for analyzing the dynamics of cells ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Obtaining High-Quality Transcriptome Data from Cereal Seeds by a Modified Method for Gene Expression Profiling

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality RNA is often hindered by high starch and sugar content. These compounds can reduce both the yield and the quality of the extracted total RNA. The deterioration in quantity and quality of total RNA can subsequently have a significant impact on the downstream transcriptomic analyses, which may not accurately reflect the spatial and/or temporal variation in the gene expression profile of the samples being tested. In this protocol, we describe an optimized method for extraction of total RNA with sufficient quantity and quality to be used for whole transcriptome analysis of cereal grains. The described method is suitable for several downstream applications used for transcriptomic profiling of developing, germinating, and mature cereal seeds. The method of transcriptome profiling using a microarray platform is shown. This method is specifically designed for gene expression profiling of cereals with described genome sequences. The detailed procedure from microarray handling to final quality control is described. This includes cDNA synthesis, cRNA labelling, microarray hybridization, slide scanning, feature extraction, and data quality validation. The data generated by this method can be used to characterize the transcriptome of cereals during germination, in various stages of grain development, or at different biotic or abiotic stress conditions. The results presented here exemplify high-quality transcriptome data amenable for downstream bioinformatics analyses, such as the determination of differentially expressed genes (DEGs), characterisation of gene regulatory networks, and conducting transcriptome-wide association study (TWAS).

A method for transcriptome profiling of cereals is presented. The microarray-based gene expression profiling starts with the isolation of high-quality total RNA from cereal grains and continues with the generation of cDNA. After cRNA labelling and microarray hybridization, recommendations are given for signal detection and quality control.

The characterization of gene expression is dependent on RNA quality. In germinating, developing and mature cereal seeds, the extraction of high-quality ...

Transverse Sectioning of Mature Rice (Oryza sativa L.) Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm phenotyping can be used to classify genotypes based on SG morphotype using scanning electron microscopic (SEM) analysis. SGs can be visualized using SEM by slicing through the kernel (pericarp, aleurone layers, and endosperm) and exposing the organellar contents. Current methods require the rice kernel to be embedded in plastic resin and sectioned using a microtome or embedded in a truncated pipette tip and sectioned by hand using a razor blade. The former method requires specialized equipment and is time-consuming, while the latter introduces a new host of problems depending on rice genotype. Chalky rice varieties, particularly, pose a problem for this type of sectioning due to the friable nature of their endosperm tissue. Presented here is a technique for preparing translucent and chalky rice kernel sections for microscopy, requiring only pipette tips and a scalpel blade. Preparing the sections within the confines of a pipette tip prevents rice kernel endosperm from shattering (for translucent or &#8216;vitreous&#8217; phenotypes) and crumbling (for chalky phenotypes). Using this technique, endosperm cell patterning and the structure of intact SGs can be observed.

Transverse Sectioning of Mature Rice Oryza sativa L. Kernels for Scanning Electron Microscopy Imaging Using Pipette Tips as Immobilization Support

This protocol allows for the preparation of transverse sections of cereal seeds (e.g., rice) for the analysis of endosperm and starch granule morphology using scanning electron microscopy.

Starch granules (SGs) exhibit different morphologies depending on the plant species, especially in the endosperm of the Poaceae family. Endosperm ...

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

PLAYLIST