Name: high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots
Uploaded: 2016-04-30T14:00:00
Description: Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

This research was supported by National Science Foundation grant IOS-1025642 (GBM). We thank Maria Harrison for providing the ARqua1 strain.

1. Guide RNA Design and Vector Construction
<ol>
	<li>Identify target sequences for the genes of interest. There are a variety of online CRISPR target-finding programs suitable for this step13,14. 
	NOTE: Here we use the GN20GG target motif, but other designs may be suitable depending on the application or vector system used.</li>
	<li>Design 60-mer gRNA oligos to include the GN19 portion of the target motifs flanked by 5&#39; and 3&#39; 20-nt sequences that are required for DNA as...

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single,...

The ability to generate targeted DNA modifications with CRISPR/Cas9 has great potential for functional genomics studies. There are two components of the CRISPR/Cas9 system; the Cas9 nuclease, derived from Staphylococcus pyogenes and an approximately 100-nt guide RNA (gRNA) molecule that directs Cas9 to the targeted DNA site(s)1. Target recognition is conferred by the first ~20-nt of the gRNA, which allows for high-throughput production of targeting vectors2,3. Most organisms that can be engineered, already have been with CRISPR/Cas9 technology4,5.
In plants, constitutive promoters, such as the CaMV 35S promoter, are commonly used to drive the expression of the Cas9 nuclease6. The gRNAs are expressed using the RNA polymerase III U6 or U3 promoters which restricts the first base of the gRNA to either a G, for U6, or A for U3, for efficient transcription. However RNA polymerase II promoters, which are free of these restrictions, have also been used7,8.
Different gRNAs induce DNA mutations with different efficiencies, and so it can be important to first validate CRISPR vectors before investing in whole-plant transformations or setting up extensive phenotypic screens. Transient expression of CRISPR constructs in plants, by using agroinfiltration for example, generally results in a lower frequency of DNA modification as compared to stable plants6, making detection of mutations difficult and phenotypic assays impractical with such approaches. So-called hairy roots are a convenient, alternative system since a large number of independent, stably transformed materials can be generated within weeks, as opposed to months for stable plants. CRISPR vectors are very effective at inducing DNA mutations in hairy roots9,10.
DNA assembly methods efficiently ligate DNA fragments containing overlapping ends11. A major advantage of some DNA assembly methods is the ability to incorporate ssDNA (i.e., oligos) into the assembled products. Since gRNAs are only ~20-nt long and new targets can be made with synthesized oligos, these DNA assembly methods are well suited to CRISPR cloning. The protocols described here are based on the p201 series of CRISPR vectors that has been successfully used in soybean10, poplar12 and now tomato. The cloning procedure presented offers several advantages over the current cloning method10. Namely, fully functional vectors can be generated in a single cloning reaction in a single day. Vector construction can also be pooled to generate multiple CRISPR vectors in parallel, further reducing hands-on time and material costs. We also present a protocol for the generation of tomato hairy roots as an efficient method to produce transgenic materials with targeted gene deletions. Hairy roots are used to validate the CRISPR vectors and provide material for subsequent experiments.

<table border="0" cellpadding="0" cellspacing="0" width="761">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:219px;">NEBuilder&#174; (HiFi DNA assembly mix)</td>
			<td style="width:139px;">New England Biolabs</td>
			<td style="width:247px;">E5520</td>
			<td style="width:157px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p201N:Cas9</td>
			<td>Addgene</td>
			<td>59175</td>
			<td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pUC gRNA Shuttle</td>
			<td>Addgene</td>
			<td>47024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SwaI</td>
			<td>New England Biolabs</td>
			<td>R0604S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SpeI</td>
			<td>New England Biolabs</td>
			<td>R0133S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo clean and concentrator-5 column purification</td>
			<td>Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 2.1</td>
			<td>New England Biolabs</td>
			<td>B7202S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB CutSmart (Buffer 4)</td>
			<td>New England Biolabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 3.1</td>
			<td>New England Biolabs</td>
			<td>B7203S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EconoSpin Mini Spin Column (plasmid prep)</td>
			<td>Epoch Life Sciences</td>
			<td>1910-050/250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EcoRV-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3195S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">StyI-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3500S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MS Salts + Gamborg Vitamins</td>
			<td>Phytotechnology Laboratories</td>
			<td>M404</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phytagel&#8482; (gellan gum)</td>
			<td>Sigma Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">GA-7 Boxes</td>
			<td>Sigma Aldrich</td>
			<td>V8505</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Micropore&#8482; surgical tape</td>
			<td>3M</td>
			<td>1535-0</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Timentin&#174; (Ticarcillin/Clavulanic acid)</td>
			<td>Various</td>
			<td>0029-6571-26</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers 5&#39; -&#62; 3&#39;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SwaI_MtU6F&#160;</td>
			<td colspan="3">GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MtU6R&#160;&#160;</td>
			<td colspan="2">AAGCCTACTGGTTCGCTTGAAG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ScaffoldF&#160;</td>
			<td colspan="2">GTTTTAGAGCTAGAAATAGCAAGTT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SpeI_Scaffold R</td>
			<td colspan="3">GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StUbi3P218R&#160;</td>
			<td colspan="2">ACATGCACCTAATTTCACTAGATGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ISceIR</td>
			<td colspan="2">GTGATCGATTACCCTGTTATCCCTAG</td>
			<td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_Scaffold R&#160;</td>
			<td colspan="2">GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_MtU6 F&#160;&#160;</td>
			<td colspan="3">CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p201R&#160;</td>
			<td colspan="2">CGCGCCGAATTCTAGTGATCG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="3" height="21" style="height:21px;">Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

CRISPR vector construction with DNA assembly typically generates tens to hundreds of independent clones. Colony screening by PCR easily identifies correct clones and can distinguish between plasmids with and without inserts (Figure 2A) which is useful for troubleshooting. Typically, all of the clones contain an insert and a user may opt to skip the colony screening steps altogether. Diagnostic digests (Figure 2B) and Sanger sequencing are used for quality...

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Using DNA assembly, multiple CRISPR vectors can be constructed in parallel in a single cloning reaction, making the construction of large numbers of CRISPR vectors a simple task. Tomato hairy roots are an excellent model system to validate CRISPR vectors and generate mutant materials.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

The overall goal of this cloning and transformation procedure is to efficiently generate CRISPR Vectors and knock out mutant tomato roots that can be used in functional genomic studies. This method is a useful tool in the field of plant genomics because it can generate a large number of knockout mutants that can be used in a variety of root processes. The main advantage of this technique is that the cloning procedure can be accomplished in a single step, entrenching that group materials can be obtained in just a matter of weeks.First, design guide RNA or gRNA oligos to include the GN19 portion of the target motifs flanked by the five prime and three prime 20 nucleotide sequences required for DNA assembly. Digest one to five micro grams of P201N caznine plasmid with the restriction enzyme Spe1 at 37 degrees Celsius for two hours. After column purifying the digest according to manufacturer's instructions, re-suspend in 15 microliters of 10 millimolar Trs HCL.Quantify the amount of DNA by UV Spectrophotometry. Perform a second digest with a restriction enzyme Swa1 at 25 degrees Celsius for two hours. Check 100 to 200 nanograms on a zero point eight percent agarose gel to confirm complete digestion.A correctly digested plasmid will have a single band at 14, 313 base pairs. To PCR amplify the medicago truncatula use six promoter and scaffold DNA's from the puck gRNA shuttle plasmid. Use the primer Swa1 and Mtu6F and MTU6R, and scaffold F in Spe1 scaffold R, in a high fidelity polymerase.Visualize three microliter aliquats of PCR products on a one percent agarose gel to confirm amplification. The MTU6 amplicon is 377 base pairs, and the scaffold amplicon is 106 base pairs. Column purify the remaining PCR products according to manufacturer's instructions.Quantify by UV Spectophotometry as before and store at negative 20 degrees Celsius. Next, re-suspend the entire tube of gRNA oligos to 100 micromolar in laboratory grade water. Add one microliter of the oligos to 500 microliters of 1xNEB buffer two point one and mix well.Program a thermal cycler with a heated lid to hold at 50 degrees Celsius. Combine 100 nanograms of the linearized vector, 50 nanograms of MtU6 promoter, 12 nanograms of Scaffold, and one microliter of diluted gRNA oligo in water to a final volume of five microliters. Add five microliters of 2X high fidelity DNA Assembly Mastermix.Mix well and spin down. Incubate the reaction for 60 minutes in the 50 degree Celsius thermocycler. Following the hour at 50 degrees Celsius, place the reaction on ice and then use two microliters to transform competent E.Coli cells using standard techniques.Plate the transformation on LB Agar supplemented with 50 milligrams per milliliter Kanamycin and incubate at 37 degrees Celsius overnight. Screen the colonies using PCR with the primer StUb3p 218R and 1Sce1R. Dilute an alequat of the remaining DNA assembly reaction with water one to five, and use one microliter as a positive control for the colony screen.Also include one nanogram of circular P201N casnine plasmid as a no insert control. After PCR amplification using the parameters contained in the written portion of the protocol, visualize PCR product on a one percent agarose gel. Correct insertions have a banded 725 base pairs and vectors without inserts will have a 310 base pair band.Grow positive colonies in LB Can50 liquid cultures overnight at 37 degrees Celsius. The next day, purify plasmids using a plasmid purification kit according to manufacturer's instructions. After Sanger sequencing the purified plasmids with the StuB3P218R primer, align chromatograms to the MtU6 promoter, Target, and scaffold sequences to ensure no errors were introduced during cloning.Perform a diagnostic digest by digesting one microgram of plasmid with EcoR5 and Sti1. When visualized on a zero point eight agarose gel, this banding patter should be seen. Finally, transform the plasmids into Agrobacterium rhizogenes strain ARqua1 by adding one microliter of the plasmid prep to 50 microliters of electrocompetent cells and electroporating in a one millimiter cuvette.Add approximately 500 microliters of SOC Media and shake at 28 degrees Celsius for two hours. Then plate on LB Can50 plates and grow at 28 degrees Celsius for two days. Begin this section of the procedure by sterilizing tomato seeds in 20 percent household bleach for 15 minutes with constant mixing.Then transfer the seeds to a laminar flow hood. Remove the bleach and wash in sterile laboratory grade water three times. Plate 30 seeds in a GA7 box containing one half MS Media.Allow to germinate for around two days in the dark. Once the seeds have germinated, move the GA7 boxes into the light The day before transformation, streak out A.rhizogenes cultures on solid LB containing Can50 and grow at 28 degrees Celsius overnight. On the day of transformation, work in the laminar flow hood to add 25 microliters of Acetosyringone to 50 milliliters of one half MS and pour six milliliters into each culture tube.Use a bent 200 microliter tip to scrape A.rhizogenes cells from the plate and resuspend in the six milliliters of one half MS liquid. Vortex the tube to completely resuspend the cells. After resuspending cells from each vector, take one milliliter of cells and measure the optical density at a fixed wavelength of 600 nanometers.Add two milliliters of one half MS liquid to a petri dish with a sterile filter paper. Excise cotyledons from the seedlings and place on the moistened filter paper. Once all cotyledons have been collected, cut the most distal one centimeter off of the cotyledons, resulting in cotyledon pieces with two cut ends.Add the ex plants to A.rhizogenes solutions and mix. Incubate for 20 minutes with occasional inverting. During the A.rhizogenes incubation, add a piece of filter paper to a petri dish for each construct transform.Also, set one half MS solid media without antibiotics in the laminar flow hood to dry. Use sterile forceps to scoop cotyledons out of A.rhizogenes solution and place on dry filter paper. Cover with a petri dish lid to ensure tissues do not dry out while proceeding to the next transformation.Next, blot cotyledons on the filter paper and transfer abaxial side up to one half MS media. Wrap the plates with surgical tape and co-cultivate in the dark at room temperature for two days. After co-cultivation, transfer cotyledons abaxial side up into supplemented one half MS medium.Wrap with surgical tape. Maintain cultures under fluorescent lights at room temperature with a 16 hour photo period. After one point five to two weeks, use sterile forceps and a scalpel to excise roots at least two centimeters in length from the cotyledons and transfer to Ticarcillon/Clavulanate Acid and Kanamycin supplemented one half MS media.Transfer ten to 15 roots to a single plate. Mark the position of the root tips with a marker. Wrap with surgical tape and maintain in the culture room.After one week, transform roots are seen growing on the selective media. Harvest a subsample of transformed roots for DNA extraction using the preferred DNA extraction method. Hairy roots can be seen emerging from cotyledons 11 days after transformation.The roots are selected on Ticarcillon/Clavulanate Acid and Kanamycin supplemented one half MS Media for approximately one week. Grey bars denote the position of root tips at the time of plating. This is an example of cloning and sequencing of PCR products to determine DNA mutations with two different gene targets in four different hairy root events.The grey box denotes GN20 GG target sequence and delta indicates the type of mutation. The number of clones with the indicated mutation is shown at the right. This is an example of a polyacrylamide gel to determine DNA mutations.Large deletions and heterduplex bands indicate the presence of DNA mutations at the target sequences. Six of 12 independent events were scored as mutants as indicated by the delta symbol. WT indicates the wild type control and NT the no template control.Once mastered, tens to hundreds of CRISPR vectors can be produced in a single week and trendulate group materials can be obtained in a matter of weeks. While attempting this procedure, it's important to remove and inhibit the growth of any residual Agrobacterium. Overgrowth of Agrobacterium will inhibit and kill any root material.After watching this video, you should have a good understanding of how to generate CRISPR vectors using DNA assembly, and how to test those vectors using a hairy root model system and tomato.

Research

JoVE Journal

Biology

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Isolation, Characterization, And High Throughput Extracellular Flux Analysis of Mouse Primary Renal Tubular Epithelial Cells

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). ...