Name: induction of mesenchymal-epithelial transitions in sarcoma cells
Uploaded: 2017-04-07T15:00:00
Description: Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

JAS acknowledges support from the Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, and the Duke University Department of Orthopaedics. HL was supported by the National Science Foundation (NSF) Center for Theoretical Biological Physics (NSF PHY-1427654) and NSF DMS-1361411, and as a CPRIT (Cancer Prevention and Research Institute of Texas) Scholar in Cancer Research of the State of Texas at Rice University. KEW was supported by the NIH F32 CA192630 MKJ and HL benefited from useful discussions with Mary C. Farach-Carson, J. N. Onuchic, Samir M. Hanash, Kenneth J. Pienta, and Donald S. Coffey.

1. Preparation of Reagents
<ol>
	<li>Prepare DMEM for cell culture by adding 50 mL of fetal bovine serum (FBS) and 5 mL of penicillin-streptomycin (5,000 U/mL) to 500 mL of DMEM. This medium can be stored at 4 &#176;C for up to six months.</li>
	<li>Resuspend lyophilized primers in nuclease-free water to a final concentration of 10 &#181;M. Store re-suspended primers at -20 &#176;C.</li>
	<li>Prepare radioimmunoprecipitation assay (RIPA) buffer (150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0). Supp...

<ol>
	<li>Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition,+TGF-beta,+and+osteopontin+in+wound+healing+and+tissue+remodeling+after+injury.">Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury.</a> J Burn Care Res. 33 (3), 311-318 (2012).</li><li>Galichon, P., Finianos, S., Hertig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMT-MET+in+renal+disease:+should+we+curb+our+enthusiasm.">EMT-MET in renal disease: should we curb our enthusiasm.</a> Cancer Lett. 341 (1), 24-29 (2013).</li><li>Carew, R. M., Wang, B., Kantharidis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+EMT+in+renal+fibrosis.">The role of EMT in renal fibrosis.</a> Cell Tissue Res. 347 (1), 103-116 (2012).</li><li>Willis, B. C., Borok, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta-induced+EMT:+mechanisms+and+implications+for+fibrotic+lung+disease.">TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease.</a> Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).</li><li>Ye, X., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Plasticity:+A+Central+Regulator+of+Cancer+Progression.">Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression.</a> Trends Cell Biol. 25 (11), 675-686 (2015).</li><li>Li, L., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+human+cancer:+comprehensive+reprogramming+of+metabolism,+epigenetics,+and+differentiation.">Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation.</a> Pharmacol Ther. 150, 33-46 (2015).</li><li>Tsai, J. H., Yang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+plasticity+in+carcinoma+metastasis.">Epithelial-mesenchymal plasticity in carcinoma metastasis.</a> Genes Dev. 27 (20), 2192-2206 (2013).</li><li>Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+epithelial+plasticity+in+prostate+cancer+dissemination+and+treatment+resistance.">The role of epithelial plasticity in prostate cancer dissemination and treatment resistance.</a> Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).</li><li>Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Migration+and+Invasion+Uncoupled:+Increased+Migration+Is+Not+an+Inexorable+Consequence+of+Epithelial-to-Mesenchymal+Transition.">Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition.</a> Mol Cell Biol. 34 (18), 3486-3499 (2014).</li><li>Mathow, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeb1+affects+epithelial+cell+adhesion+by+diverting+glycosphingolipid+metabolism.">Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism.</a> EMBO Rep. 16 (3), 321-331 (2015).</li><li>Ware, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mechanism+of+resistance+to+gefitinib+mediated+by+cellular+reprogramming+and+the+acquisition+of+an+FGF2-FGFR1+autocrine+growth+loop.">A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop.</a> Oncogenesis. 2, e39 (2013).</li><li>Yauch, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+versus+mesenchymal+phenotype+determines+in+vitro+sensitivity+and+predicts+clinical+activity+of+erlotinib+in+lung+cancer+patients.">Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients.</a> Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).</li><li>Jolly, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+elucidating+the+connection+between+epithelial-mesenchymal+transitions+and+stemness.">Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.</a> J R Soc Interface. 11 (101), 20140962 (2014).</li><li>Mani, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-mesenchymal+transition+generates+cells+with+properties+of+stem+cells.">The epithelial-mesenchymal transition generates cells with properties of stem cells.</a> Cell. 133 (4), 704-715 (2008).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metastasis+is+regulated+via+microRNA-200/ZEB1+axis+control+of+tumour+cell+PD-L1+expression+and+intratumoral+immunosuppression.">Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.</a> Nat Commun. 5, 5241 (2014).</li><li>Nicolazzo, C., Gradilone, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+circulating+tumor+cells+in+soft+tissue+sarcoma.">Significance of circulating tumor cells in soft tissue sarcoma.</a> Anal Cell Pathol (Amst). , 697395 (2015).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-epithelial+transition+in+sarcomas+is+controlled+by+the+combinatorial+expression+of+miR-200s+and+GRHL2.">Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2.</a> Mol Cell Biol. , (2016).</li><li>Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Transition+Phenotype+Is+Associated+with+Clinicopathological+Factors+That+Indicate+Aggressive+Biological+Behavior+and+Poor+Clinical+Outcomes+in+Invasive+Breast+Cancer.">Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer.</a> J Breast Cancer. 18 (3), 256-263 (2015).</li><li>Humphries, B., Yang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microRNA-200+family:+small+molecules+with+novel+roles+in+cancer+development,+progression+and+therapy.">The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy.</a> Oncotarget. 6 (9), 6472-6498 (2015).</li><li>Renner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling+of+primary+high-grade+soft+tissue+sarcomas.">MicroRNA profiling of primary high-grade soft tissue sarcomas.</a> Genes Chromosomes Cancer. 51 (11), 982-996 (2012).</li><li>Petrof, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+GRHL2+result+in+an+autosomal-recessive+ectodermal+Dysplasia+syndrome.">Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome.</a> Am J Hum Genet. 95 (3), 308-314 (2014).</li><li>Werner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+the+transcription+factor+grainyhead-like+2+(GRHL2)+in+breast+cancer.">Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer.</a> J Biol Chem. 288 (32), 22993-23008 (2013).</li><li>Werth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factor+grainyhead-like+2+regulates+the+molecular+composition+of+the+epithelial+apical+junctional+complex.">The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex.</a> Development. 137 (22), 3835-3845 (2010).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-Epithelial+Transition+in+Sarcomas+Is+Controlled+by+the+Combinatorial+Expression+of+MicroRNA+200s+and+GRHL2.">Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2.</a> Mol Cell Biol. 36 (19), 2503-2513 (2016).</li><li>Varma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+Grainyhead-like+2+and+NK2-homeobox+1+form+a+regulatory+loop+that+coordinates+lung+epithelial+cell+morphogenesis+and+differentiation.">The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation.</a> J Biol Chem. 287 (44), 37282-37295 (2012).</li><li>Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+fluorescent+protein+expressing+cells+by+flow+cytometry.">Analysis of fluorescent protein expressing cells by flow cytometry.</a> Methods Mol Biol. 263, 239-258 (2004).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-content+morphological+screen+identifies+novel+microRNAs+that+regulate+neuroblastoma+cell+differentiation.">A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation.</a> Oncotarget. 5 (9), 2499-2512 (2014).</li><li>Borowicz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+soft+agar+colony+formation+assay.">The soft agar colony formation assay.</a> J Vis Exp. (92), e51998 (2014).</li><li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+proteomics+and+genomics+analysis+reveals+a+novel+mesenchymal+to+epithelial+reverting+transition+in+leiomyosarcoma+through+regulation+of+slug.">Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug.</a> Mol Cell Proteomics. 9 (11), 2405-2413 (2010).</li><li>Alba-Castellon, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snail1+expression+is+required+for+sarcomagenesis.">Snail1 expression is required for sarcomagenesis.</a> Neoplasia. 16 (5), 413-421 (2014).</li><li>Takaishi, M., Tarutani, M., Takeda, J., Sano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+to+Epithelial+Transition+Induced+by+Reprogramming+Factors+Attenuates+the+Malignancy+of+Cancer+Cells.">Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells.</a> PLoS One. 11 (6), e0156904 (2016).</li></ol>

Sarcomas are rare, but highly aggressive cancers of a mesenchymal lineage. Despite their mesenchymal lineage, a subset of sarcomas appears to undergo a phenotypic transition to a more epithelial-like state. This MET-like switch has prognostic relevance, as patients with more epithelial-like tumors are less aggressive24. Despite their clinical relevance, there are few studies addressing the molecular mechanisms driving these phenotypic transitions in sarcomas.
To examine...

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.
One of the authors&#39; names was corrected from:
Shenghan Xu
to:
Shengnan Xu

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.

Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Phenotypic plasticity refers to a reversible transition between cellular phenotypes, and is commonly divided into two types, epithelial-to-mesenchymal (EMT) transitions and mesenchymal-to-epithelial transitions (MET). This phenotypic plasticity plays an important role in normal processes of multicellular organisms, such as development and wound healing1; however, these same pathways and gene expression programs can also lead to disease, such as fibrosis (reviewed in2,3,4) and carcinoma metastasis (reviewed in references5,6,7,8). During metastasis, for example, EMT disrupts cell polarity, cell-cell interactions, and promotes invasion9,10. Together, EMT contributes to a phenotypic state that facilitates cancer cell dissemination. In addition, EMT also leads to a host of other phenotypic alterations that drive an aggressive phenotype, including deregulation of cancer cell metabolism6, development of drug resistance11,12, increased tumor-initiation ability13,14 and host immune evasion15.
Phenotypic plasticity has been well studied in carcinoma progression; however, sarcomas also exhibit phenotypic plasticity. Interestingly, it appears as if some of the same drivers of phenotypic plasticity in carcinomas also contribute to sarcoma plasticity and aggressiveness. For instance, circulating tumor cells (CTCs) from sarcoma patients have been shown to express EpCAM, a cell surface protein that is typically found on epithelial cells16. Additionally, 250 soft tissue sarcoma samples were categorized as epithelial-like or mesenchymal-like based on gene expression. Patients in the epithelial-like biomarker signature had a better prognosis than patients with the mesenchymal-like biomarker signature17. This is consistent with many carcinomas, in which patients with more epithelial-like carcinomas have better outcomes compared with patients with more mesenchymal-like tumors18.
While some sarcomas display biomarkers and gene expression pathways consistent with MET, the molecular underpinnings of this phenotypic plasticity remain poorly understood. To study the mechanisms and drivers of MET in sarcoma we developed a model of MET induction using two epithelial-specific factors, the microRNA (miR)-200 family and grainyhead-like 2 (GRHL2). The miR-200s are a family of small non-coding RNAs that regulate gene expression by binding to the 3&#39; UTRs of messenger RNA and preventing translation into protein. The miR-200 family consists of two subgroups - one containing miR-141 and miR-200a, and the other including&#160;miR-200b, miR-200c, and miR-429. Members of the miR-200 family are enriched in epithelial tissues, and the loss of miR-200s is associated with metastasis in carcinomas19. The miR-200 family is also downregulated in soft tissue sarcomas compared to normal tissue20. Similar to the miR-200s, GRHL2 is a key regulator that is important for epithelial development21. The GRHL2 transcription factor acts in two ways to upregulate epithelial genes, such as E-cadherin: 1) In epithelial cells, GRHL2 directly represses the EMT master regulator, ZEB122; and 2) GRHL2 directly activates transcription of epithelial genes23. Our previous investigations have shown that combined expression of miR-200s and GRHL2 in sarcoma cells induces an MET-like phenotype24. Here, we present a detailed protocol to create an in vitro model of MET induction in sarcoma cells using ectopic expression of miR-200s and GRHL2.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Countess automated counter</td>
			<td>Life technologies</td>
			<td>AMQAX1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Countess cell counting chamber slides</td>
			<td>Invitrogen</td>
			<td>C10283</td>
			<td></td>
		</tr>
		<tr>
			<td>SimpliAmp Thermal Cycler</td>
			<td>Thermo Fisher</td>
			<td>A24811</td>
			<td></td>
		</tr>
		<tr>
			<td>Odyssey Fc</td>
			<td>LI-COR Inc</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ViiA7 Real Time PCR System</td>
			<td>Thermo Fisher</td>
			<td>4453536</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR microplate</td>
			<td>Corning</td>
			<td>321-29-051</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA SYBR Fast Universal qPCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK4602</td>
			<td></td>
		</tr>
		<tr>
			<td>Starting Block (PBS) Blocking Buffer</td>
			<td>Thermo Fisher</td>
			<td>37538</td>
			<td>BSA-based blocking buffer</td>
		</tr>
		<tr>
			<td>Agarose General Purpose LE</td>
			<td>Genesee Scientific</td>
			<td>20-102</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Tris/Glycine/SDS Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0732</td>
			<td>Running buffer</td>
		</tr>
		<tr>
			<td>10X Tris/Glycine Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0734</td>
			<td>Transfer buffer</td>
		</tr>
		<tr>
			<td>RIPA Buffer</td>
			<td>Sigma Life Sciences</td>
			<td>SLBG8489</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham Protran 0.45 &#956;m nitrocellulose</td>
			<td>GE Healthcare Lifesciences</td>
			<td>10600012</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-RNA MiniPrep Kit</td>
			<td>Genesee Scientific</td>
			<td>11-358</td>
			<td></td>
		</tr>
		<tr>
			<td>Laemmli Sample Buffer (4X)</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1610747</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Trans-Blot Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1703930</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Tetra Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1658005EDU</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Life technologies</td>
			<td>14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAi Max</td>
			<td>Thermo Fisher</td>
			<td>13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine 2000 Ragents</td>
			<td>Thermo Fisher</td>
			<td>11668019</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin Streptomycin</td>
			<td>Life technologies</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>miRVana miRNA mimic negative control #1</td>
			<td>Thermo Fisher</td>
			<td>4464058</td>
			<td>neg miRNA</td>
		</tr>
		<tr>
			<td>hsa-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4464066</td>
			<td>miR200A</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200B</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200C</td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Life technologies</td>
			<td>11088-021</td>
			<td>serum-free media</td>
		</tr>
		<tr>
			<td>anti-Ecadherin antibody</td>
			<td>BD Bioscience</td>
			<td>610182</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-beta actin</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-69879</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-EpCam</td>
			<td>Ab Serotec</td>
			<td>MCA18706</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-ZO1</td>
			<td>Invitrogen</td>
			<td>402200</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800W</td>
			<td>LI-COR Inc</td>
			<td>925-32210</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680</td>
			<td>LI-COR Inc</td>
			<td>926-32223</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-mouse AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>A211241</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-rabbit AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>ab150075</td>
			<td></td>
		</tr>
		<tr>
			<td>Halt Protease and Phosphatesse Inhibitor</td>
			<td>Thermo Fisher</td>
			<td>1861281</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>Partec CellTrics</td>
			<td>Sysmex</td>
			<td>04-004-2326</td>
			<td>30 &#956;m filter for flow</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td>IDT</td>
			<td></td>
			<td>AGCCACATCGCTCAGACAC</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td>IDT</td>
			<td></td>
			<td>GCCCAATACGACCAAATCC</td>
		</tr>
		<tr>
			<td>Ecadherin-F</td>
			<td>IDT</td>
			<td></td>
			<td>TGGAGGAATTCTTGCTTTGC</td>
		</tr>
		<tr>
			<td>Ecadherin-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGCTCTCCTCCGAAGAAAC</td>
		</tr>
		<tr>
			<td>ZEB1-F</td>
			<td>IDT</td>
			<td></td>
			<td>GCATACAGAACCCAACTTGAACGTC</td>
		</tr>
		<tr>
			<td>ZEB1-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGATTACACCCAGACTGC</td>
		</tr>
		<tr>
			<td>NOTCH-F</td>
			<td>IDT</td>
			<td></td>
			<td>GGCAATCCGAGGACTATGAG</td>
		</tr>
		<tr>
			<td>NOTCH-R</td>
			<td>IDT</td>
			<td></td>
			<td>CTCAGAACGCACTCGTTGAT</td>
		</tr>
		<tr>
			<td>nitro blue tetrazolium&#160;</td>
			<td>Sigma</td>
			<td>N5514</td>
			<td></td>
		</tr>
		<tr>
			<td>hexadimethrine bromide</td>
			<td>Sigma</td>
			<td>H9268</td>
			<td>polybrene</td>
		</tr>
		<tr>
			<td>3 mL syringe</td>
			<td>BD Bioscience</td>
			<td>309657</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile syringe filter</td>
			<td>VWR</td>
			<td>28145-505</td>
			<td></td>
		</tr>
		<tr>
			<td>5mL polypropylene round-bottom tube</td>
			<td>352063</td>
			<td></td>
			<td>flow cytometry tubes</td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher</td>
			<td>4368814</td>
			<td>reverse transcription kit</td>
		</tr>
		<tr>
			<td>4% paraformaldyhyde</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-281612</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Sigma</td>
			<td>93443</td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A7906</td>
			<td></td>
		</tr>
	</tbody>
</table>

induction of mesenchymal-epithelial transitions in sarcoma cells

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic plasticity drives invasion, dissemination and metastasis. Indeed, while most of the studies of phenotypic plasticity have been in the context of epithelial-derived carcinomas, it turns out sarcomas, which are mesenchymal in origin, also exhibit phenotypic plasticity, with a subset of sarcomas undergoing a phenomenon that resembles a mesenchymal-epithelial transition (MET). Here, we developed a method comprising the miR-200 family and grainyhead-like 2 (GRHL2) to mimic this MET-like phenomenon observed in sarcoma patient samples.We sequentially express GRHL2 and the miR-200 family using cell transduction and transfection, respectively, to better understand the molecular underpinnings of these phenotypic transitions in sarcoma cells. Sarcoma cells expressing miR-200s and GRHL2 demonstrated enhanced epithelial characteristics in cell morphology and alteration of epithelial and mesenchymal biomarkers. Future studies using these methods can be used to better understand the phenotypic consequences of MET-like processes on sarcoma cells, such as migration, invasion, metastatic propensity, and therapy resistance.

Schema for MET induction in sarcoma cells
A general timeline for the induction of MET-like changes in sarcoma cells is shown in Figure 1. The protocol begins by transducing GRHL2 (Figure 1A), followed by transfection of the miR-200 family (Figure 1B). GRHL2 or miR-200 family members were not able to impact the appearance of RD cells when expressed alone, but ectopic expression of G...

Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

We present here a cell culture method for inducing mesenchymal-epithelial transitions (MET) in sarcoma cells based on combined ectopic expression of microRNA-200 family members and grainyhead-like 2 (GRHL2). This method is suitable for better understanding the biological impact of phenotypic plasticity on cancer aggressiveness and treatments.

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic ...

The overall goal of this procedure is to study the phenotypic consequences of mesenchymal-epithelial transitions in sarcomas. This method can help answer key questions about why epithelial-like sarcomas have superior outcomes relative to sarcomas that are more mesenchymal-like. The main advantage of this technique is that it provides an easy, reproducible means to study downstream gene regulatory networks and phenotypes associated with mesenchymal-epithelial transitions in sarcomas.By better understanding phenotypic plasticity in sarcomas, we hope to identify therapeutic interventions that will enable us to shift sarcomas toward a more indolent epithelial-like state. Demonstrating the procedure will be two undergraduates in our laboratory, Jackson Xu and Shivee Gilja. On the first day of the transduction, plate three times 10 the fifth HEK293T cells in each of two wells of a six well plate in two milliliters of supplemented DMEM.Incubate the plate at 37 degrees Celsius with 5%carbon dioxide. After culturing overnight, examine the cells under a microscope. They should be 40 to 60%confluent.Next, in separate tubes containing 200 microliters of serum free medium with 1.8 micrograms of p delta 8.9 and 0.2 micrograms of pCMV-VSV-G helper plasmids, dilute two micrograms of the empty vector and two micrograms of the vector containing GRHL2. In another tube, dilute four microliters of a lipid-based transfection reagent in 200 microliters of serum free medium per transfection. This will be eight microliters and 400 microliters for two samples.Add 200 microliters of transfection reagent mixture to each plasmid solution, and then incubate the samples for 20 minutes at room temperature. Meanwhile, use a vacuum aspirator to remove the medium from the HEK293T cells. Rinse the cells once with one milliliter of PBS and then replace the PBS with 800 microliters of serum free medium.After 20 minutes have passed, add 400 microliters of transfection reagent plasmid mixture dropwise to each well of the plated cells. Incubate the dish for two hours at 37 degrees Celsius in 5%carbon dioxide. Following the incubation, carefully remove the transfection medium via vacuum aspiration.HEK293T cells are loosely adherent, so when aspirating the medium, be careful not to remove the cells from the bottom of the dish or flask. Replace the aspirated medium with two milliliters of supplemented DMEM. Return the cells to the incubator for overnight culture.The next day, refresh the medium on the transfected HEK293T cells, then plate three times 10 to the fifth RD human rhabdomyosarcoma cells in each well of a six well plate containing two milliliters per well of supplemented DMEM. Culture both plates overnight. On the fourth day, use a pipette to collect the viral medium from HEK293T cells and transfer it into two new 15 milliliter conical tubes, one for lentivirus containing an empty vector and another for lentivirus containing the GRHL2 plasmid.Carefully replace the medium with new DMEM and place the HEK293T cells back in the incubator overnight. Next, add two microliters of 10 milligrams per milliliter polybrene per milliliter of viral medium into two new 50 milliliter conical tubes, one for the empty vector transfection and another for the GRHL2 transfection. Remove the plunger from a three milliliter syringe and attach a 0.45 micrometer polyethersulfone filter to the tip of the syringe.Add the viral medium collected earlier into the barrel of the syringe and plunge it into one of the new 50 milliliter conical tubes containing polybrene. Repeat this step with the other sample. Then remove medium from RD cells by vacuum aspiration and add the two milliliters of each of the filtered viral medium samples to separate wells of the RD plate.Incubate the RD cells at 37 degrees Celsius in a humidified incubator. The next day, repeat the viral medium collection and add the infection medium to the same wells containing the previously infected RD cells. The HEK293T cells can be discarded after the viral medium has been collected.Incubate the cells for two more days. On the seventh day, wash the RD cells with one milliliter of PBS, then add 200 microliters of 0.05%trypsin to each well. Incubate at 37 degrees Celsius for five minutes.Add two milliliters of supplemented medium and then transfer the cell suspension to new 15 milliliter conical tubes. Centrifuge the cells at 250 g's for five minutes at room temperature. After the spin, aspirate the medium and re-suspend the cells in one milliliter of DMEM supplemented with 5%FBS and 1%penicillin streptomycin.To filter the cells in preparation for flow cytometry, use a pipette to apply the one milliliter RD cell suspension through a sterile 30 micrometer tube top filter into flow cytometry tubes. Place the tubes on ice. Using a flow cytometer, sort the EGFP positive cells into 1.5 milliliter microcentrifuge tubes containing 0.5 milliliters of DMEM supplemented with 10%FBS and 1%penicillin streptomycin.Place the sorted cells back on ice. Plate the EGFP positive cells from both empty vector and GRHL2 transductions in a total of one milliliter of supplemented DMEM in separated wells of a 12 well plate. Then place the cells in the incubator for culture.The yield of EGFP positive cells after flow cytometry is usually pretty low, in the range of 50, 000 to 100, 000 cells. Because of this, the cells may need to be cultured for an extra 10 to 14 days before proceeding to the next step. In a microcentrifuge tube, add three microliters of each 50 micromolar miR-200 mimic to 300 microliters of serum free medium.In a separate tube, add nine microliters of 50 micromolar negative control micro RNA to 300 microliters of serum free medium. Next, in another microcentrifuge tube, add six microliters of siRNA specific transfection reagent to 600 microliters of serum free medium. Divide 300 microliters of this mixture into two tubes, one for each of the two miR mixtures.Combine the 300 microliters of each miR mixture with a mix of 300 microliters of transfection reagent. Incubate for 20 minutes at room temperature. While incubating, prepare a cell suspension of 600, 000 EGFP positive RD cells expressing the MD vector or GRHL2 in 2.4 milliliters with 250 cells per microliter of serum free medium per treatment.In a 24 well plate, add 100 microliters per well of the miR-200 or the negative control mix into six wells. Then add 400 microliters of each cell suspension into three wells of each miR mix. Incubate the plate at 37 degrees Celsius in 5%carbon dioxide overnight.The next day, change the medium to fully supplemented DMEM. Collect cells two days later for analysis using the appropriate buffer. Image each well every two hours with a 10X objective using an automated live cell imager.These time lapse images show mesenchymal-epithelial transition, or MET, in RD cells expressing GRHL2, EGFP and miR-200 miRNAs. The cells change from spindle shaped to cobblestone in appearance, with increased cell to cell adhesions and a more rounded morphology. MET is not observed in other treatment conditions.Instead, cells exhibit an elongated, spindle shaped morphology with few cell to cell attachments. During MET induction, the morphological change in RD cells upon GRHL2 and miR-200 overexpression was accompanied by up regulation of the epithelial marker, E-cadherin, as measured by qPCR and western blotting. Addition of miR-200s up regulated E-cadherin alone, but combined miR-200s and GRHL2 overexpression synergistically enhanced E-cadherin expression.As demonstrated by immunofluorescence microscopy, there was an increase at cell to cell junctions of epithelial adhesion molecules, EpCAM and TJP-1, indicated by the white arrows. Up regulation of epithelial proteins was accompanied by down regulation of mesenchymal genes ZEB1 and Notch1 by QRT-PCR. Induction of MET reduced the anchorage independent growth of RD cells, as measured by soft agar growth assays.The growth inhibition in soft agar was driven by miR-200s alone, as overexpression of GRHL2 led to an increase in anchorage independent growth. This is consistent with previous reports showing GRHL2 expression induces anchorage independent growth. Following this procedure, other methods, including assays to measure changes in cell migration, invasion, metastasis and response to therapy can be performed in order to elucidate the phenotypic consequences of MET in sarcomas.

Research

JoVE Journal

Developmental Biology

Direct Induction of Human Neural Stem Cells from Peripheral Blood Hematopoietic Progenitor Cells

Human disease specific neuronal cultures are essential for generating in vitro models for human neurological diseases. However, the lack of access to ...

Direct Induction of Hemogenic Endothelium and Blood by Overexpression of Transcription Factors in Human Pluripotent Stem Cells

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro ...

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Single-cell Photoconversion in Living Intact Zebrafish

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Induction and Validation of Cellular Senescence in Primary Human Cells

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a ...

Induction of Endothelial Differentiation in Cardiac Progenitor Cells Under Low Serum Conditions

Cardiac progenitor cells (CPCs) may have therapeutic potential for cardiac regeneration after injury. In the adult mammalian heart, intrinsic CPCs are ...