Name: method for labeling transcripts in individual escherichia coli cells for single-molecule fluorescence in situ hybridization experiments
Uploaded: 2017-12-21T13:00:00
Description: Watch this Scientific Journal Video about Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments at JoVE.com

This work was supported by an Israel Science Foundation grant 514415 (to J.S.) and a BSF-NSF (MCB) grant 2016707 (to J.S.). Support from a Siegfried and Irma Ullman Professorial Chair (to J.S.) is also acknowledged.

1. Probe Design
NOTE: This protocol uses commercially available oligonucleotide probes already tagged with fluorophores. The probes consist of a set of specific sequences complementary to a target mRNA, each probe being conjugated to a single fluorescent molecule. Alternatively, it is possible to attach fluorescent markers to probes, as described elsewhere5,16.
<ol>
	<li>Design smFISH probes using&#160;the Probe Designer<sup class="x...

<ol>
	<li>Tsimring, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noise+in+biology.">Noise in biology.</a> Reports Prog. Phys. 77 (2), 26601 (2014).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+post-transcriptional+regulation+on+phenotypic+noise+in+Escherichia+coli.">Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli.</a> Nucleic Acids Res. 41 (9), 4825-4834 (2013).</li><li>van Gijtenbeek, L. A., Robinson, A., van Oijen, A. M., Poolman, B., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+Spatial+Organization+of+mRNA,+Plasmids,+and+Ribosomes+in+a+Bacterial+Host+Overexpressing+Membrane+Proteins.">On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.</a> PLOS Genet. 12 (12), e1006523 (2016).</li><li>Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat. Methods. 5 (10), 877-879 (2008).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472 (10), (2010).</li><li>Skinner, S. O., La Sep&#250;lveda, ., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+mRNA+copy+number+in+individual+Escherichia+coli+cells+using+single-molecule+fluorescent+in+situ+hybridization.">Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization.</a> Nat. Protoc. 8 (6), 1100-1113 (2013).</li><li>Barakat, T. S., Gribnau, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+DNA-RNA+fluorescent+in+situ+hybridization+(FISH)+to+study+X+chromosome+inactivation+in+differentiated+female+mouse+embryonic+stem+cells.">Combined DNA-RNA fluorescent in situ hybridization (FISH) to study X chromosome inactivation in differentiated female mouse embryonic stem cells.</a> J. Vis. Exp. (88), e51628 (2014).</li><li>Chen, K. H., Boettiger, A. N., Moffitt, J. R., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+imaging.+Spatially+resolved,+highly+multiplexed+RNA+profiling+in+single+cells.">RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells.</a> Science. 348 (6233), aaa6090 (2015).</li><li>van Gijtenbeek, L. A., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+messengers:+An+update+and+outlook+on+RNA+visualization+in+bacteria.">Illuminating messengers: An update and outlook on RNA visualization in bacteria.</a> Front. Microbiol. 8, 1-19 (2017).</li><li>Fei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+in+vivo+target+search+kinetics+of+regulatory+noncoding+RNA.">Determination of in vivo target search kinetics of regulatory noncoding RNA.</a> Science. 347 (6228), 1371-1374 (2015).</li><li>Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+organization+shapes+the+turnover+of+a+bacterial+transcriptome.">Spatial organization shapes the turnover of a bacterial transcriptome.</a> Elife. 5, 1-22 (2016).</li><li>Ong, W. Q., Citron, Y. R., Sekine, S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+Cell+Imaging+of+Endogenous+mRNA+Using+RNA-Based+Fluorescence+"Turn-On"+Probe.">Live Cell Imaging of Endogenous mRNA Using RNA-Based Fluorescence "Turn-On" Probe.</a> ACS Chem. Biol. , (2016).</li><li>Golding, I., Paulsson, J., Zawilski, S. M., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+kinetics+of+gene+activity+in+individual+bacteria.">Real-time kinetics of gene activity in individual bacteria.</a> Cell. 123 (6), 1025-1036 (2005).</li><li>Golding, I., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+8+Spatiotemporal+Dynamics+in+Bacterial+Cells:+Real-Time+Studies+with+Single-Event+Resolution.">Chapter 8 Spatiotemporal Dynamics in Bacterial Cells: Real-Time Studies with Single-Event Resolution.</a> Methods Cell Biol. 89 (8), (2008).</li><li>So, L. H., Ghosh, A., Zong, C., Sepulveda, L. A., Segev, R., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+properties+of+transcriptional+time+series+in+Escherichia+coli.">General properties of transcriptional time series in Escherichia coli.</a> Nat. Genet. 43 (6), 554-560 (2011).</li><li>Spahn, C., Endesfelder, U., Heilemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-resolution+imaging+of+Escherichia+coli+nucleoids+reveals+highly+structured+and+asymmetric+segregation+during+fast+growth.">Super-resolution imaging of Escherichia coli nucleoids reveals highly structured and asymmetric segregation during fast growth.</a> J. Struct. Biol. 185 (3), 243-249 (2014).</li><li>Sliusarenko, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbetracker+software.">Microbetracker software.</a> Mol Microbiol. 80 (3), 612-627 (2012).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 8 (2006).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Brandt, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+two-state+stabilization-change+mechanism+for+proton-pumping+complex+I.">A two-state stabilization-change mechanism for proton-pumping complex I.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1807 (10), 1364-1369 (2011).</li></ol>

We have measured in our laboratory the transcript number of different genes in E. coli cells using the smFISH method2. In brief, this procedure consists of the following steps: cell fixation, permeabilization of membranes to allow for probe penetration, probe hybridization, and sample imaging using a standard fluorescence microscope. This procedure is based on previously published ones with some modifications6,7,<sup cl...

Stochasticity is a fundamental and unavoidable aspect of gene expression and gives rise to cell-cell heterogeneity1, both at the level of transcripts and proteins2,3. Quantifying the variability between cells under well-defined conditions offers a unique window into the basic processes that underlie gene expression and its regulation. One important source of cell-cell heterogeneity in bacteria takes place at the transcriptional level. Transcript numbers vary not only due to the stochasticity of transcription, but also to post-transcriptional processes such as regulation by small RNAs and RNAases2. One way of directly accessing this heterogeneity in a quantitative fashion is by fluorescently tagging individual transcripts of a given gene in smFISH. This methodology allows the detection and subcellular localization of particular RNA molecules in fixed, individual bacterial cells4. mRNAs are hybridized with a set of fluorescently-labeled ~20 base-long oligonucleotides that are designed to bind selectively to transcripts of interest5,6. Multiple labeling ensures detection above background fluorescence, and individual mRNA molecules appear as diffraction-limited spots under a fluorescence microscope7 (see Figure 1). There are other approaches for labeling mRNA molecules, in which the complementary oligomer probes carry conjugated haptens (e.g., biotin or digoxigenin) that are detected using secondary fluorescently-labeled reporter techniques8.
There are other methods that provide quantitative information about transcripts, in addition to smFISH. Some, such as the Northern blot or quantitative PCR, probe the bulk and thus can measure neither the number of mRNA copies nor their position in individual cells. Therefore these methods are not suitable to quantify cell-to-cell variability. A recent image-based technique that allows for the quantification of both the copy number of RNAs within cells as well as their intracellular location, called multiplexed error-robust fluorescence in situ hybridization (MERFISH) has been developed. MERFISH is based on the assignment of a unique barcode consisting of a defined combination from a fixed number of fluorescently-labeled oligonucleotide probes. These barcodes are read out in sequential rounds of smFISH measurements, with photobleaching following each round of hybridization, thereby increasing throughput by two orders of magnitude9,10. This technique necessitates an automated fluid handling system and the proper design of the probe set.
The combination of multiple fluorescence labeling of individual transcripts, together with novel super-resolution techniques such as stochastic optical reconstruction microscopy (STORM)11, enables a ten-fold increase in resolution in the subcellular localization of transcripts. In STORM, a suitable combination of fluorescent probes and imaging buffer allows for multiple cycles of fluorescence emission per probe molecule (blinking). STORM may also be used to image the E. coli transcriptome and observe genome-wide spatial organization of RNA, by labeling simultaneously all the transcripts of interest12.
All the single-cell methods reviewed above are based on imaging transcripts in fixed cells. Hence, they do not provide any information regarding the kinetic properties of transcripts within cells. To follow transcripts in live cells13, mRNAs can be labeled by the fusion of the gene of interest to an array of binding sites. These latter are then recognized by an RNA-binding protein, such as the bacteriophage MS2 coat protein, which is fused to a fluorescent protein such as the green fluorescent protein (GFP)10,14,15.
Here we describe a method for labeling individual mRNAs with a set of fluorescently-labeled DNA probes, for use in smFISH experiments, in particular in E. coli. Furthermore, we show that the same labeling scheme may be used for STORM measurements with minor modifications.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Dextran sulfate sodium salt</td>
			<td >Sigma-Aldrich</td>
			<td >D8906</td>
			<td ></td>
		</tr>
		<tr >
			<td >Pure Ethanol, 99.5%, ACS reagent, absolute</td>
			<td >Mallinckrodt Baker - Avantor</td>
			<td >8025.25</td>
			<td ></td>
		</tr>
		<tr >
			<td >Diethylpyrocarbonate (DEPC)</td>
			<td >Sigma-Aldrich</td>
			<td >D5758</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 20X SSC</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9763</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 10X PBS</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9625</td>
			<td ></td>
		</tr>
		<tr >
			<td >TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) BioUltra, for molecular biology</td>
			<td >Sigma-Aldrich</td>
			<td >93283</td>
			<td ></td>
		</tr>
		<tr >
			<td >nuclease-free water</td>
			<td >Thermo Fisher Scientific</td>
			<td >10977035</td>
			<td ></td>
		</tr>
		<tr >
			<td >Formaldehyde solution for molecular biology, 36.5-38% in water</td>
			<td >Sigma-Aldrich</td>
			<td >F8775</td>
			<td ></td>
		</tr>
		<tr >
			<td >Deionized formamide, nuclease free</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM9342</td>
			<td ></td>
		</tr>
		<tr >
			<td >E. coli tRNA (ribonucleic acid, transfer type xx from escherichia)</td>
			<td >Sigma-Aldrich</td>
			<td >R1753-500UN</td>
			<td ></td>
		</tr>
		<tr >
			<td >UltraPure BSA (50mg/ml)</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM2616</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vanadyl-ribonucleoside complex,VRC, 200 mM</td>
			<td >New England Biolab</td>
			<td >S1402S</td>
			<td ></td>
		</tr>
		<tr >
			<td >Poly-L-Lysine</td>
			<td>Sigma</td>
			<td >P4707</td>
			<td ></td>
		</tr>
		<tr >
			<td >Cysteamine and oxygen</td>
			<td >Sigma-Aldrich</td>
			<td >30070</td>
			<td ></td>
		</tr>
		<tr >
			<td >Glucose Oxidase from Aspergillus niger, Type VII, 50KU</td>
			<td >Sigma-Aldrich</td>
			<td >G2133</td>
			<td ></td>
		</tr>
		<tr >
			<td >Catalase</td>
			<td >Sigma-Aldrich</td>
			<td >C40</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-glucose</td>
			<td >Sigma-Aldrich</td>
			<td >G8270</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-fucose</td>
			<td >Sigma-Aldrich</td>
			<td >F8150</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vybrant DiO Cell-Labeling Solution</td>
			<td >Life Technologies</td>
			<td >V2286</td>
			<td ></td>
		</tr>
		<tr >
			<td >Agarose,low melting reagent</td>
			<td >Sigma-Aldrich</td>
			<td >A9414</td>
			<td ></td>
		</tr>
		<tr >
			<td >Adhesive silicone isolator 24-2mm Dia. X 1.8 mm depth JTR24R-A2-2.0</td>
			<td >Grace Bio-Labs</td>
			<td >JTR24R-A2-2.0 666208</td>
			<td ></td>
		</tr>
		<tr >
			<td >poly-D-lysine-coated glass bottom Glass Bottom Culture Dishes</td>
			<td >MatTek Corporation</td>
			<td >P35GC-1.5-14-C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Super life nitrile powder free examination gloves</td>
			<td >Supermax</td>
			<td >TC-N-9889</td>
			<td ></td>
		</tr>
		<tr >
			<td >Brand sterilization incubator tape</td>
			<td >Sigma-Aldrich</td>
			<td >BR61750</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge tubes (1.8 ml)</td>
			<td >Axygen - Corning Life Sciences</td>
			<td >MCT-175C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Falcon round-bottom polypropylene tubes (14 ml)</td>
			<td >BD Biosciences</td>
			<td >352059</td>
			<td ></td>
		</tr>
		<tr >
			<td >Conical-bottom centrifuge polypropylene tubes (50 ml)</td>
			<td >Corning</td>
			<td >430828</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 5 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4051</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 10 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4488</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 25 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4251</td>
			<td ></td>
		</tr>
		<tr >
			<td >Spectrophotometer cuvettes</td>
			<td >Sarstedt</td>
			<td >67.742</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 0.2 - 20 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT20</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 10 - 200 &#956;l</td>
			<td >Axigene/corning</td>
			<td >TF-200</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT1000</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td>Sorenson</td>
			<td >14200</td>
			<td ></td>
		</tr>
		<tr >
			<td >Syringe disposile 10 mL needle G-21</td>
			<td>Becton Dickinson, Biosciences</td>
			<td >BD-309643</td>
			<td ></td>
		</tr>
		<tr >
			<td >Minisart 0.2 um Syringe Filter</td>
			<td >Sartorius</td>
			<td >16534 K</td>
			<td ></td>
		</tr>
		<tr >
			<td >Nikon instruments microscope type A immersion oil A, 8cc</td>
			<td >Nikon</td>
			<td >MXA20233</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microscope slides 76 x26, 3&#34;x1&#34;x1mm</td>
			<td >Thermo Fisher Scientific</td>
			<td >421-004ET</td>
			<td ></td>
		</tr>
		<tr >
			<td >#0 coverslip slide 24x60</td>
			<td >Thermo Fisher Scientific/Menzel</td>
			<td >BNBB024060A0</td>
			<td ></td>
		</tr>
		<tr >
			<td >Orbital shaker</td>
			<td >M.R.C</td>
			<td >TOU-50</td>
			<td ></td>
		</tr>
		<tr >
			<td >Hot block</td>
			<td >M.R.C</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Vortex</td>
			<td >Fried Electric Company</td>
			<td >G-560-E</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge</td>
			<td >Eppendorf</td>
			<td >5427R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Centrifuge</td>
			<td >Eppendorf</td>
			<td >5810R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Portable Pipet-Aid XP2, Pipette Controller</td>
			<td >Drummond Scientific Company</td>
			<td >4-000-501-I</td>
			<td ></td>
		</tr>
		<tr >
			<td >OD600 Spectrophotometer for Bacterial Growth Rates DiluPhotometer</td>
			<td >Midsci</td>
			<td >OD600-10</td>
			<td ></td>
		</tr>
		<tr >
			<td >iXon X3 EMCCD camera</td>
			<td >Andor</td>
			<td >DU-897E-CS0-#BV</td>
			<td > </td>
		</tr>
		<tr >
			<td >Eclipse Ti microscope</td>
			<td >Nikon</td>
			<td >MEA53100</td>
			<td > </td>
		</tr>
		<tr >
			<td >CFI plan apochromat DM 100X oil objective lambda PH-3 N.A 1.45 WD 0.13</td>
			<td >Nikon</td>
			<td >MRD31905</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (TRITC/CY3): EX - ET545/30X; EM - ET620/60M; BS - T570LP</td>
			<td >Nikon</td>
			<td >49005</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (CY5): EX - ET640/30X; EM - ET690/50M; BS - T660P</td>
			<td >Nikon</td>
			<td >49009</td>
			<td > </td>
		</tr>
		<tr >
			<td >Nis-elements AR auto reaserch software</td>
			<td >Nikon</td>
			<td >MQS31000</td>
			<td > </td>
		</tr>
		<tr >
			<td >STORM microscope</td>
			<td >Vutara</td>
			<td >SR-200</td>
			<td > </td>
		</tr>
		<tr >
			<td >NA 1.2 water immersion objective </td>
			<td >Olympus</td>
			<td > </td>
			<td > </td>
		</tr>
		<tr >
			<td >SRX image acquisition and analysis software</td>
			<td >Vutara</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Evolve 512 EMCCD camera</td>
			<td >Photometrics</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with CAL Fluor&#174; Red 590 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for galK mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with Quaser Fluor&#174; Red 670 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for sodB mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
	</tbody>
</table>

method for labeling transcripts in individual escherichia coli cells for single-molecule fluorescence in situ hybridization experiments

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH allows the measurement of cell-to-cell variability in mRNA copy number of genes of interest, as well as the subcellular location of the transcripts. The main steps involved are fixation of the bacterial cell culture, permeabilization of cell membranes, and hybridization of the target transcripts with sets of commercially available short fluorescently-labeled oligonucleotide probes. smFISH can allow the imaging of the transcripts of multiple genes in the same cell, with limitations imposed by the spectral overlap between different fluorescent markers. Following completion of the protocol illustrated below, cells can be readily imaged using a microscope coupled with a camera suitable for low-intensity fluorescence. These images, together with cell contours obtained from segmentation of phase contrast frames, or from cell membrane staining, allow the calculation of the mRNA copy number distribution of a sample of cells using open-source or custom-written software. The labeling method described here can also be applied to image transcripts with stochastic optical reconstruction microscopy (STORM).

We carried out smFISH measurements of galK and sodB transcripts in E. coli cells. The transcripts were hybridized with a set of specific sequences complementary to the target sequence, each probe being conjugated to a single fluorescent molecule (see table of materials). Fluorescence and phase contrast images of MG1655 wild-type E. coli strain (WT) or a JW0740 (Keio collection)19 galK-deleted strain (&#916;galK) were exposed to 2 mM D-fuc...

Watch this Scientific Journal Video about Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments at JoVE.com

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

This manuscript describes a method for labeling individual messenger RNA (mRNA) transcripts with fluorescently-labeled DNA probes, for use in single-molecule fluorescence in situ hybridization (smFISH) experiments in E. coli. smFISH is a visualization method that allows the simultaneous detection, localization, and quantification of single mRNA molecules in fixed individual cells.

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ ...

The overall goal of this protocol is to label individual transcripts in E.Coli for fluorescently labeled DNA probes for visualization in single-molecule FiSH experiments. This method can help answer key questions in the systems biology field, such as characterizing transcripts cell to cell ability of field of interest. As well as the transcripts of cell wall localization.The main advantage of this technique is that it provides quantity of information about the statistics of transcriptional processes. To begin the protocol, grow E.Coli MG1655 in LB medium overnight in an orbital shaker, at 260 RPM and 37 degrees Celsius. The next day, dilute the overnight culture at one to 100 in fresh medium and measure its optical density in a spectrophotometer, up to a value of 0.2 to 0.4.Next, pellet the cells by centrifugation for five minutes at 4, 500 G at four degrees Celsius. Remove the supernatant from all tubes. Add one milliliter of 1XPBS to each tube and re-suspend the pellet to minimize cell to cell aggregation.Then add four milliliters of fixation buffer and gently vortex the tube. Incubate the samples in an orbital shaker. Re-suspend the pellet in order to minimize cell to cell aggregation, which may interfere with cell imaging.After incubation, pellet the cells, remove the supernatant, and add one milliliter of 1XPBS. Transfer suspensions to 1.8 milliliter conical bottom microcentrifuge tubes. Pellet the cells by centrifugation.Begin bacteria permeabilization by carefully removing the supernatant. Use small volume pipettes to remove all of the liquid outside the pellet. Next, re-suspend the pellet in 300 microliters DEPC treated water.Add 350 microliters of high grade absolute ethanol and mix the solution gently by inverting the tube. Add another 350 microliters of ethanol and mix again. Then rotate the sample with the tube rotator at 20 RPM for one hour at room temperature.Pellet the cells from the permeabilization. After centrifugation, remove the supernatant. Add one milliliter of 20%wash buffer to the samples.Leave them standing for several minutes. Next, pellet cells by centrifugation for seven minutes at 750 G and four degrees Celsius. Remove the supernatant very gently and use small volume pipettes to remove all the liquid outside the pellet.Then add the oligonucleotide probe set stock solution to the hybridization buffer aliquot so that the final oligonucleotide concentration is 250 nanomolar and vortex the tube vigorously. Suspend the samples in 50 microliters of hybridization buffer that contains the oligonucleotide probes, while avoiding the generation of bubbles. Leave the samples overnight, in the dark, on a heat block at 30 degrees Celsius.To prepare washing, obtain one new micro-centrifuge tube for each sample to image. Add one milliliter wash buffer to each tube. Add 10 to 15 microliters from the hybridized samples to the new tube that contains the wash buffer.Pellet the cells by centrifugation. Then, remove the supernatant. Wash the samples two more times.Re-suspend the pellet in 25 microliters wash buffer. Prepare an agarose gel by adding 150 milligrams of agarose to 10 milliliters of 2X SSC buffer. Microwave the solution for 10 to 15 seconds each time, until agarose fully dissolves.Then set the tube aside to cool for a few minutes. Next, place a separating, silicone frame on the slide so that the slide's center remains exposed. Place a 10 millimeter wide, one to two millimeter thick rigid ring in the center of the slide.Deposit a small amount of gel into the center for sealing and wait a few minutes for the gel to harden. Then add more gel, until a high dome shape is formed. Wait about 10 minutes for the gel to harden and remove the ring.Deposit 10 microliters of wash bacterial cells onto the gel and seal it with a number zero cover slip slide. Keep the sample in the dark to prevent photo-bleaching. smFiSH measurements of E.coli cells show the level of galK induction in response to variable extra-cellular D-fucose concentrations.The background signal is shown by a galK deleted strain, or delta galK JW0740 as a negative control. Numerous spots are seen in most cells. Corresponding to single or few galK transcripts when two millimolar D-fucose is added to the bacterial culture.Whereas, a few spots are seen in the absence of extra-cellular D-fucose. Another example for the application of this protocol is furnished by the sodB gene, with fluorescence and phase contrast images of smFiSH in a wild type or a JW1648 sodB deleted strain. Samples prepared with this protocol may also be imaged using STORM which allows accurate precisioning of transcripts in the cell.After its development, this technique paved the way for researchers in the field of systems biology to explore the statistics of transcription events in individual cells.

Research

JoVE Journal

Biology

Double Whole Mount in situ Hybridization of Early Chick Embryos

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ...

Fluorescence in situ hybridization (FISH) Protocol in Human Sperm

Fluorescence in situ hybridization FISH Protocol in Human Sperm

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

In Situ Hybridization for the Precise Localization of Transcripts in Plants

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

Detection of Viral RNA by Fluorescence in situ Hybridization (FISH)

Detection of Viral RNA by Fluorescence in situ Hybridization FISH

Viruses  that infect cells elicit specific changes to normal cell functions which serve  to divert energy and resources for viral replication. Many ...

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for ...

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

In this article we describe a method for colorimetric detection of miRNA in the kidney through in situ hybridization with digoxigenin tagged microRNA ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...