This work was carried out under the sponsor of Outstanding interdisciplinary project of West China Hospital, Sichuan University (Grant Nr: ZYJC18024) and National Natural Science Foundation of China (Grant: 81770101 and 81973540).

Animal experiments were conducted in accordance with the current ethical regulations for animal care and use in China.
NOTE: Animals were housed in a specific pathogen-free (SPF), controlled environment under 12-hour light and dark cycles at 25 &#176;C. Food was irradiated before being fed to mice. Drinking water and cages were autoclaved before use. Eight-week-old male C57BL/6J mice were used in the study following 1 week of acclimatization. They were divided into several groups based on the ...

Antibiotics used in the depletion procedure have different antibacterial properties. Vancomycin is specific for gram-positive bacteria30. Oral doxycycline can induce significant intestinal microbiota composition changes in female C57BL/6NCrl mice31. Neomycin is a broad-spectrum antibiotic that targets most gut-resident bacteria32. It does not prevent intestinal inflammation, however. Broad-spectrum antibiotic cocktails are more effective than a singl...

A diverse gut microbiota plays a major role in maintaining host homeostasis. This microbiome aids in various physiological processes ranging from digestion and absorption of nutrients from food, defense against infection of pathogens, regulation of immune system development, and immune homeostasis1. Perturbation in gut microbial composition has been linked to many diseases, including cancer2, autoimmune diseases3, inflammatory bowel disease4, neurological diseases5, and metabolic diseases6,7. Germ-free (GF) mice are powerful tools in fecal microbiota transplantation models to study the biological effects of microbiota8. However, the GF housing environment is very stringent, and performing fecal microbiota transplantation (FMT) in these mice is expensive. Moreover, GF mice have different barrier and mucosal properties, which regulate bacterial penetration, compared to conventional mice9. These factors limit the wide application of GF mice in studies. An alternative to using GF mice is to deplete the microbiota in conventional mice using an antibiotic cocktail followed by FMT. Previously reported FMT methods are not well described and inconsistent; therefore, it is necessary to establish a feasible, efficient, and reproducible protocol to perform FMT using conventional mice.
Several steps are crucial to a successful FMT. The efficiency of microbiota depletion is the first important step. For bacteria depletion, use of a single broad-spectrum antibiotic (e.g., streptomycin10) or an antibiotic cocktail (triple or quadruple-antibiotic treatment) has been reported11,12. The quadruple-antibiotic treatment including ampicillin, metronidazole, neomycin, and vancomycin, has been found to be the most effective regimen and has been used in several studies13,14,15. In addition to the type of antibiotic used, the route of administration, dosage, and duration of the antibiotic treatment affect the efficacy of bacterial depletion. Some researchers apply antibiotics in the drinking water to eliminate bacteria in the gastrointestinal tract15. However, it is hard to control the dosage of antibiotics that each mouse receives this way. Therefore, in subsequent studies, researchers have treated mice with antibiotics by oral gavage for 1&#8211;2 weeks12 to achieve satisfactory depletion. However, the long-term use of antibiotics can be problematic, as the antibiotics themselves may affect some diseases in rodent models16. Therefore, faster and more efficient methods for microbiota depletion are warranted.
Fecal fluid preparation is another key step to ensure successful FMT. In the gastrointestinal tract, pH ranges from 1 in the stomach to 7 in the proximal and distal intestine9. The microbiota in the stomach is limited due to high acidity and includes Helicobacter pylori17. The proximal intestine produces bile acid for the liver-gut circulation, and contains microbiota associated with fat, protein, and glucose digestion. The distal intestinal tract contains abundant anaerobic bacteria and exhibits high microbial diversity18. Given the spatial heterogeneity of gut microbiota, it is imperative to isolate gut contents from different regions of the intestinal tracts for fecal fluid preparation. Additionally, other factors, including the nature of the donor sample (e.g., fresh or frozen sample), transplantation frequency, and duration are crucial when performing FMT. Frozen stool is most commonly used for colonizing conventional mice with human gut microbiota19. In contrast, FMT using fresh stool from animal donors is more appropriate and commonly used in animal models20,21. FMT frequency and duration vary depending on the experimental design and models. In previous studies, FMT was either performed daily or every second day. The transplantation duration ranged from 3 days22 to 5 weeks23. In addition to the above factors, maintaining an aseptic surgical environment and the use of sterilized surgical instruments is crucial to avoid unexpected environmental bacterial contamination.
The gut microbiota has the potential to regulate the accumulation of cells that express Immunoglobulin A (IgA). IgA, a predominant antibody isotype, is critical in protecting the host from infection through neutralization and exclusion. High-affinity IgA is transcytosed into the intestinal lumen and can bind and coat offending pathogens. In contrast, coating with IgA may provide a colonization advantage for bacteria24. In contrast to pathogen-induced IgA, indigenous commensal-induced IgA has lower affinity and specificity25. The proportion of intestinal bacteria coated with IgA is reported to be significantly increased in some diseases25,26. IgA-coated bacteria can initiate a positive feedback loop of IgA production27. Therefore, the relative level of IgA-coated bacteria can predict the magnitude of the inflammatory response in the gut. In fact, this combination can be detected via flow cytometry28. Using IgA-based sorting, Floris et al.27, Palm et al.25, and Andrew et al.29 acquired IgA+ and IgA- fecal bacteria from mice and characterized taxa-specific coated-intestinal microbiota via 16S rRNA sequencing.
In this study, we describe an optimized method to efficiently deplete intestinal dominant bacteria and colonize conventional mice with fresh or frozen fecal microbiota isolated from the contents of the ileum and colon. We also demonstrate a method based on flow cytometry to detect IgA-binding bacteria in the gut.

<table border="0" cellpadding="0" cellspacing="0" style="width:755px;" width="753">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:304px;">5 mL syringe needle</td>
			<td style="width:147px;">Sheng guang biotech</td>
			<td style="width:91px;">5mL</td>
			<td style="width:213px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">70 &#181;m cell strainer</td>
			<td>BD biosciences</td>
			<td>352350</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ampicillin sodium salt</td>
			<td>AMERESCO</td>
			<td>0339</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APC Streptavidin</td>
			<td>BD biosciences</td>
			<td>554067</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Biotin anti-mouse IgA antibody</td>
			<td>Biolegend</td>
			<td>407003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bovine serum albiumin (BSA)</td>
			<td>Sigma</td>
			<td>B2064-50G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">C57BL/6J mice</td>
			<td>Chengdu Dashuo</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CO2</td>
			<td>Xiyuan biotech</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">E.Coil genome DNA</td>
			<td>TsingKe</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Eppendorf tubes</td>
			<td>Axygen</td>
			<td>MCT150-C</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fast DNA stool mini Handbook</td>
			<td>QIAGEN</td>
			<td>51604</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Metronidazole</td>
			<td>Shyuanye</td>
			<td>S17079-5g</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Neomycin sulfate</td>
			<td>SIGMA</td>
			<td>N-1876</td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Oral gavage needle</td>
			<td>Yuke biotech</td>
			<td>10#</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pClone007 Versatile simple TA vector kit</td>
			<td>TsingKe</td>
			<td>007VS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Phosphate Buffer Saline (PBS)</td>
			<td>Hyclone</td>
			<td>SH30256</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Precellys lysing kit</td>
			<td>Precellys</td>
			<td colspan="2">KT03961-1-001.2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RT PCR SYBR MIX</td>
			<td>Vazyme</td>
			<td>Q411-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SYTO BC green Fluorescent Nucleic Acid Stain</td>
			<td>Thermo fisher scientific</td>
			<td>S34855</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">V338 F primer</td>
			<td>TsingKe</td>
			<td></td>
			<td style="width:213px;">ACTCCTACGGGAGGCAGCAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">V806 R primer</td>
			<td>TsingKe</td>
			<td></td>
			<td>GGACTACHVGGGTWTCTAAT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vancomycin hydrochloride</td>
			<td>Sigma</td>
			<td>V2002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Equipments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BD FACSCalibur flow cytometer</td>
			<td>BD biosciences</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Bead beater vortx</td>
			<td>Scilogex</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BIORAD CFX Connect</td>
			<td>BIORAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Centrifuge machine</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Illumina MiSeq</td>
			<td>Illumina</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nanodrop nucleic acid measurements machine</td>
			<td colspan="2">Thermo fisher scientific</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Surgical instruments</td>
			<td>Yuke biotech</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Adobe Illustrator CC 2015</td>
			<td>Version 2015</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BIORAD CFX qPCR SOFTWARE</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FlowJo software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Graphpad prism 7</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Database</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Silva (SSU132) 16S rRNA database</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

fecal microbiota transplantation and detection of prevalence of iga-coated bacteria in the gut

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the biological function of intestinal bacteria as a whole or at the species level. Several different FMT methods have been published. Here, we present an FMT protocol that successfully depletes gut microbiota in a matter of days, followed by transplantation of fecal microbiota from fresh or frozen donor intestinal contents to conventional mice. Real time-PCR is applied to test the efficacy of bacterial depletion. Sequencing of the 16S ribosomal RNA (rRNA) is then applied to test the relative abundance and identity of gut microbiota in recipient mice. We also present a flow cytometry-based detection method of immunoglobulin A (IgA)-coated bacteria in the gut.

The FMT schedule used in this study is outlined in Figure 1. After treatment with the antibiotic cocktail, the efficiency of intestinal microbiota depletion was analyzed by sequencing the 16S rRNA region. We detected 196 species in the ileum of naive mice, whereas 3-day antibiotic treatment rapidly reduced the bacterial species to 35&#160;(Figure 2A). There were eight species detected solely in mice that underwent the antibiotic cocktail treatment (<strong class...

Read this Scientific Article Protocol about Fecal Microbiota Transplantation and Detection of Prevalence of IgA-Coated Bacteria in the Gut at JoVE.com

Fecal Microbiota Transplantation and Detection of Prevalence of IgA-Coated Bacteria in the Gut

We established an efficient way to deplete intestinal bacteria in three days, and subsequently transplant fecal microbiota via gavage of fecal fluid prepared from fresh or frozen intestinal contents in mice. We also present an optimized method to detect the frequency of IgA-coated bacteria in the gut.

Gut microbiota exert pleiotropic roles in human health and disease. Fecal microbiota transplantation (FMT) is an effective method to investigate the ...

Fecal Microbiota Transplantation and Detection of Prevalence of IgA-Coated Bacteria in the Gut

Abstract