JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Immunology and Infection

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Published: August 5th, 2016

DOI:

10.3791/54263

1Focal Area Infection Biology, Biozentrum, University of Basel, 2Centre d’Immunologie de Marseille-Luminy, Université de la Méditérannée UM2, INSERM U1104 CNRS UM7280, 3Departmento de Microbiologìa and Instituto de Salud Tropical, Universidad de Navarra, 4BioDataAnalysis GmbH
* These authors contributed equally

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.

Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.

In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.

In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Brucella species are gram-negative, facultative intracellular pathogens belonging to the class of α-Proteobacteria. They cause abortions and infertility in their natural hosts such as cattle, goats, or sheep resulting in severe economic losses in endemic areas. Brucellosis is one of the most important zoonotic diseases worldwide causing over half a million new human infections annually1. Transmission to human is most commonly caused by direct contact with infected animals or by ingestion of contaminated food such as unpasteurized milk. Symptoms of the febrile disease are unspecific, which causes difficulties in the diagnosis of brucellosis. If....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Note: All work with live Brucella abortus strains must be performed inside a biosafety level 3 (BSL3) laboratory considering all required regulations and safety precautions.

1. Preparation of Screening Plates and Culturing of Bacteria and Cells

  1. Preparation of Brucella abortus Starter Cultures
    1. Streak Brucella abortus 2308 (B. abortus) from -80 °C milk stock on a Tryptic Soy Agar (TSA) plate containing 50 µg/ml kanamycin (TSA/.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Figure 1A shows an example of image analysis used to automatically identify infected cells in the endpoint assay. Nuclei of HeLa cells stained with DAPI were identified, a peri-nucleus of 8 pixels width surrounding the nucleus, and a Voronoi cell body by extension of the nucleus by 25 pixels were calculated. Since bacteria mainly proliferate in the peri-nuclear space, the GFP intensity in this area of the cell is the most robust measurement to discriminate between infecte.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Bacterial pathogens have evolved numerous strategies to manipulate eukaryotic host cells to their benefit. Pathogens causing acute infections often show rapid proliferation which is accompanied by significant alarming of the immune system and loss of viability of infected cells. In contrast, Brucella and other pathogens that cause chronic infections manage to establish long-lasting interactions within host cells. Therefore, bacteria need to fine tune host cell functions to their benefit without disrupting cellul.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This work was supported by grants 51RT 0_126008 and 51RTP0_151029 for the Research and Technology Development (RTD) project InfectX and TargetInfectX, respectively, in the frame of SystemsX.ch, the Swiss Initiative for Systems Biology. We acknowledge grant 310030B_149886 from the Swiss National Science Foundation (SNSF). Work of S.H.L and A.C. was supported by the International PhD Program "Fellowships for Excellence" of the Biozentrum. Simone Muntwiler is acknowledged for technical assistance. We would like to thank Dirk Bumann for providing pNF106 and Jean Celli for pJC43 and pJC44.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
Tryptic Soy Agar (TSA) BD 236950
Tryptic Soy Broth (TSB) Fluka 22092
Kanamycin sulfate Sigma-Aldrich 60615
Skim milk
250 ml screw cap bottle Corning 8396
DMEM Sigma-Aldrich D5796
Fetal Calf Serum (FCS) Gibco 10270 Heat-inactivated
Trypsin-EDTA (0.5%) Gibco 15400-054 10x stock solution, dilute 1:10 in PBS
Scepte 2.0 Cell Counter Merck Milipore PHCC20060 Alternative cell counting devices can be used.
Greiner CELLSTAR 384-well plate Sigma-Aldrich M2062
Peelable aluminum foil Costar 6570
Reagent dispenser: "Multidrop 384 Reagent Dispenser" Thermo Scientific 5840150 Alternative reagent dispenser can be used.
Transfection reagent: "Lipofectamine RNAiMAX Invitrogen 13778-150
Automated plate washer: "Plate washer ELx50-16" BioTek ELX5016 This plate washer contains a 16-channel manifold suitable for 384-well plates. It fits into a biosafety cabinet and has a lid covering the plate during washing which reduces the risk of aerosol production. Alternative plate washers with similar features could be used.
Gentamicin Sigma-Aldrich G1397
Anhydrotetracycline hydrochloride Sigma-Aldrich 37919 100 ug/ml solution in 100% ethanol is kept at -20°C protected from light in aluminum-foil
PBS Gibco 20012
Paraformaldehyde Sigma-Aldrich P6148 Dissolve in 0.2 M HEPES buffer, pH 7.4. Store at -20°C and thaw freshly the day before use. Caution, PFA is toxic by inhalation, in contact with skin and if swallowed.
HEPES Sigma-Aldrich H3375
Triton X-100 Sigma-Aldrich T9284
DAPI Roche 10236276001
Scrambled siRNA Dharmacon D-001810-10
Kif11 siRNA Dharmacon L-003317-00
ARPC3 siRNA Dharmacon L-005284-00
Brucella abortus 2308
pJC43 (apHT::GFP) Celli et al.12
pAC042.08 (apht::dsRed, tetO::tetR-GFP) Construction: pJC44 4 was digested with EcoRI followed by generation of blunt ends with Klenov enzyme and subsequent digestion with SalI. TetR-GFP was amplified from pNF106 using primer prAC090 and prAC092. Following digestion with SalI, the TetR-GFP product was ligated to the digested pJC44 vector.
Primer prAC090 Sigma-Aldrich TTTTTGAATTCTGGCAATTCCGACGTCTAAGAAACC
Primer prAC092 Sigma-Aldrich TTTTTGTCGACTTTGTCCTACTCAGGAGAGCGTTC
HeLa CCL-2 ATCC CCL-2
ImageXpress Micro Molecular Devices  IXM IMAGING MSCOPE Automated cellular imaging microscope equipped with a precision motorized Z-stage. Alternative systems for automated microscopy and alternative components for hard- and software specified below can be employed.
High-Speed Laser Auto-Focus Molecular Devices  1-2300-1037
CFI Super Fluor 10x objective Nikon  MRF00100 N.A 0.50, W.D 1.20mm, DIC Prism: 10x, Spring loaded
Photometrics CoolSNAP HQ Monochrome CCD Camera Molecular Devices  1-2300-1060 1392 x 1040 imaging pixels, 6.45 x 6.45-µm pixels, 12 bits digitization
MetaXpress software Molecular Devices  9500-0100
LUI-Spectra-X-7 Lumencor SPECTRA X V-XXX-YZ Light engine. The following light sources are used: violet (DAPI), cyan (GFP), green/yellow (RFP)
Single Band Exciter for DAPI Semrock FF01-377/50-25
Single Band Emitter for DAPI Semrock FF02-447/60-25
Single Band Dichroic for DAPI Semrock FF409-Di03-25x36
Single Band Exciter for GFP Semrock FF02-472/30-25
Single Band Emitter for GFP Semrock FF01-520/35-25
Single Band Dichroic for GFP Semrock FF495-Di03-25x36
Single Band Exciter for RFP Semrock FF01-562/40-25
Single Band Emitter for RFP Semrock FF01-624/40-25
Single Band Dichroic for RFP Semrock FF593-Di03-25x36

  1. Pappas, G., Papadimitriou, P., Akritidis, N., Christou, L., Tsianos, E. V. The new global map of human brucellosis. Lancet Infect Dis. 6, 91-99 (2006).
  2. Atluri, V. L., Xavier, M. N., de Jong, M. F., den Hartigh, A. B., Tsolis, R. E. Interactions of the human pathogenic Brucella species with their hosts. Annu Rev Microbiol. 65, 523-541 (2011).
  3. Guzman-Verri, C., et al. GTPases of the Rho subfamily are required for Brucella abortus internalization in nonprofessional phagocytes: direct activation of Cdc42. J Biol Chem. 276, 44435-44443 (2001).
  4. Starr, T., Ng, T. W., Wehrly, T. D., Knodler, L. A., Celli, J. Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment. Traffic. 9, 678-694 (2008).
  5. Boschiroli, M. L., et al. The Brucella suis virB operon is induced intracellularly in macrophages. Proc Natl Acad Sci U S A. 99, 1544-1549 (2002).
  6. Celli, J., et al. Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum. J Exp Med. 198, 545-556 (2003).
  7. Porte, F., Liautard, J. P., Kohler, S. Early acidification of phagosomes containing Brucella suis is essential for intracellular survival in murine macrophages. Infect Immun. 67, 4041-4047 (1999).
  8. Anderson, T. D., Cheville, N. F. Ultrastructural morphometric analysis of Brucella abortus-infected trophoblasts in experimental placentitis. Bacterial replication occurs in rough endoplasmic reticulum. Am J Pathol. 124, 226-237 (1986).
  9. Qin, Q. M., et al. RNAi screen of endoplasmic reticulum-associated host factors reveals a role for IRE1alpha in supporting Brucella replication. PLoS Pathog. 4, e1000110 (2008).
  10. Ramo, P., et al. Simultaneous analysis of large-scale RNAi screens for pathogen entry. BMC genomics. 15, 1162 (2014).
  11. Kuhbacher, A., Gouin, E., Cossart, P., Pizarro-Cerda, J. Imaging InlC secretion to investigate cellular infection by the bacterial pathogen Listeria monocytogenes. J Vis Exp. , e51043 (2013).
  12. Kentner, D., et al. Shigella reroutes host cell central metabolism to obtain high-flux nutrient supply for vigorous intracellular growth. Proc Natl Acad Sci U S A. 111, 9929-9934 (2014).
  13. Celli, J., Salcedo, S. P., Gorvel, J. P. Brucella coopts the small GTPase Sar1 for intracellular replication. Proc Natl Acad Sci U S A. 102, 1673-1678 (2005).
  14. von Bargen, K., Gorvel, J. P., Salcedo, S. P. Internal affairs: investigating the Brucella intracellular lifestyle. FEMS microbiology reviews. 36, 533-562 (2012).
  15. Kamentsky, L., et al. Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software. Bioinformatics. 27, 1179-1180 (2011).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved