JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Immunology and Infection

A Purification and In Vitro Activity Assay for a (p)ppGpp Synthetase from Clostridium difficile

Published: November 3rd, 2018

DOI:

10.3791/58547

1Department of Chemistry and Biochemistry, Old Dominion University

Here, we describe a method for purifying histidine-tagged pyrophosphokinase enzymes and utilizing thin layer chromatography of radiolabelled substrates and products to assay for the enzymatic activity in vitro. The enzyme activity assay is broadly applicable to any kinase, nucleotide cyclase, or phosphor-transfer reaction whose mechanism includes nucleotide triphosphate hydrolysis.

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to substrates to create phosphorylated products. The use of γ-32-P labeled NTP precursors allows simultaneous monitoring of substrate utilization and product formation by radiography. Thin layer chromatography (TLC) on cellulose plates allows rapid separation and sensitive quantification of substrate and product. We present a method for utilizing the thin-layer chromatography to assay the pyrophosphokinase activity of a purified (p)ppGpp synthetase. This method has previously been used to characterize the activity of cyclic nucleotide and dinucleotide synthetases and is broadly suitable for characterizing the activity of any enzyme that hydrolyzes a nucleotide triphosphate bond or transfers a terminal phosphate from a phosphate donor to another molecule.

Kinase and pyrophosphokinase (or diphospho-kinase) enzymes transfer phosphates from nucleotide triphosphate (NTP) precursors to substrate molecules. The substrates can include other nucleotides, amino acids or proteins, carbohydrates, and lipids1. Bioinformatic analyses can sometimes predict an enzyme's cognate substrate or substrates based on the similarity to characterized enzymes, but experimental validation is still necessary. Similarly, the affinity of an enzyme for its substrate(s) and the rate at which it catalyzes the phosphor-transfer reaction, and the effects of co-factors, inhibitors, or other enzyme effectors must be determined ....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Inducible Overexpression of a Histidine-tagged Protein

  1. Amplify rsh from C. difficile R20291 genomic DNA.
    1. Use a high-fidelity polymerase and follow the manufacturer’s instructions.
    2. Amplify C. difficile rsh using primers
      rsh_F(CAGGTACCGGTTATATGCATGATAAAGAATTACAAG) and
      rsh_R(CCCTGCAGCTAATGGTGATGGTGATGGTGATTTGTCATTCTATAAATAC), which introduces a C-terminal hexahistidine tag.
      NOTE: The KpnI and PstI.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

We present a method for the affinity purification of a (p)ppGpp synthetase from Clostridium difficile and the assessment of its enzymatic activity. Figure 1 demonstrates the protein purification achieved by metal affinity chromatography. The second elution (E2) fraction from this purification was dialyzed and used for the enzymatic activity assay. Figure 2 details the necessary steps to prepare for and carry out pyrophos.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Here we report the purification of His-tagged RSH from C. difficile and present a method for activity quantification using radiolabeled thin layer chromatography. This method has previously been used to assess the activity of diguanylate cyclase enzymes from C. difficile, as well as (p)ppGpp synthetase, nucleotide cyclase, kinase and phosphodiesterase enzymes from other organisms11,12,13,

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This work was funded by NIAID 1K22AI118929-01. EBP was supported by a Summer Research Fellowship Program Grant from the Office of Research at Old Dominion University, Norfolk, Virginia, USA.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
Inducible overexpression of a histidine-tagged protein
Phusion polymerase New England Biolabs (NEB) M0530L
QIAEX II DNA Gel Extraction Kit Qiagen 20021
KpnI restriction enzyme NEB R0142S
PstI restriction enzyme NEB R0140S
T4 DNA ligase NEB M0202
NEB® 5-alpha Competent E. coli (High Efficiency) NEB C2987I
BL21 (DE3) Competent E. coli NEB C2527I
IPTG Sigma-Aldrich 10724815001
JXN-26 centrifuge with JLA 10.500 rotor Beckman Coulter Avanti -
Microcentrifuge with D3024/D3024R rotor Scilogex -
MaxQ SHKE6000 Incubator Thermo Scientific -
Ultrasonic processor Sonics VC-750
Protein purification by nickel affinity chromatography
Ni-NTA resin G Biosciences 786-940/941
Pierce Disposable Gravity columns, 10 mL Thermo Scientific 29924
1 mL Spectra/ Por float-A-lyzer G2 dialysis device (MWCO: 20-kD) Spectrum G235033
Mini-Protean Electrophoresis Cell BioRad 1658004
Protein activity assay by thin layer chromatography
Thin layer chromatograph (TLC) development tank General Glass Blowing Company 80-3
Polyethylenimine (PEI)-cellulose plates (20 cm x 20 cm, 100 um thickness) with polyester support Sigma-Aldrich Z122882-25EA
ATP, [γ-32P]- 3000 Ci/mmol 10mCi/ml lead, 100 μCi Perkin Elmer NEG002A
Adenosine 5’-triphosphate (ATP) 100 mM Bio Basic Canada AB0311
Guanosine-5’-diphosphate disodium salt (GDP) Alfa Aesar AAJ61646MC/E
Storage phosphor screen GE Healthcare Life Sciences BAS-IP TR 2040 E Tritium Screen
Storm 860 phosphorimager GE Healthcare Life Sciences -

  1. Cheek, S., Ginalski, K., Zhang, H., Grishin, N. V. A comprehensive update of the sequence and structure classification of kinases. BMC Structural Biology. 5 (1), 6 (2005).
  2. Porath, J. Immobilized metal ion affinity chromatography. Protein Expression and Purification. 3 (4), 263-281 (1992).
  3. Arnau, J., Lauritzen, C., Pedersen, J. Cloning strategy, production and purification of proteins with exopeptidase-cleavable His-tags. Nature Protocols. 1 (5), 2326-2333 (2006).
  4. Porath, J., Carlsson, J., Olsson, I., Belfrage, G. Metal chelate affinity chromatography, a new approach to protein fractionation. Nature. 258 (5536), 598-599 (1975).
  5. Smith, M. C., Furman, T. C., Ingolia, T. D., Pidgeon, C. Chelating peptide-immobilized metal ion affinity chromatography. A new concept in affinity chromatography for recombinant proteins. Journal of Biological Chemistry. 263 (15), 7211-7215 (1988).
  6. Graslund, S., et al. Protein production and purification. Nature Methods. 5 (2), 135-146 (2008).
  7. Booth, W. T., et al. Impact of an N-terminal Polyhistidine Tag on Protein Thermal Stability. ACS Omega. 3 (1), 760-768 (2018).
  8. Thielges, M. C., Chung, J. K., Axup, J. Y., Fayer, M. D. Influence of histidine tag attachment on picosecond protein dynamics. Biochemistry. 50 (25), 5799-5805 (2011).
  9. Chaga, G. S. Twenty-five years of immobilized metal ion affinity chromatography: past, present and future. Journal of Biochemical and Biophysical Methods. 49 (1-3), 313-334 (2001).
  10. Ma, H., Deacon, S., Horiuchi, K. The challenge of selecting protein kinase assays for lead discovery optimization. Expert opinion on drug discovery. 3 (6), 607-621 (2008).
  11. Tamayo, R., Tischler, A. D., Camilli, A. The EAL domain protein VieA is a cyclic diguanylate phosphodiesterase. Journal of Biological Chemistry. 280 (39), 33324-33330 (2005).
  12. Purcell, E. B., McKee, R. W., McBride, S. M., Waters, C. M., Tamayo, R. Cyclic Diguanylate Inversely Regulates Motility and Aggregation in Clostridium difficile. Journal of Bacteriology. 194 (13), 3307-3316 (2012).
  13. Purcell, E. B., Tamayo, R. Identification and characterization of cyclic nucleotide phosphodiesterases. Methods in Molecular Biology. 1016, 235-243 (2013).
  14. Ross, P., et al. Control of cellulose synthesis Acetobacter xylinum. A unique guanyl oligonucleotide is the immediate activator of the cellulose synthase. Carbohydrate Research. 149 (1), 101-117 (1986).
  15. Potrykus, K., Cashel, M. (p)ppGpp: still magical?. Annual Review of Microbiology. 62, 35-51 (2008).
  16. Boutte, C. C., Crosson, S. Bacterial lifestyle shapes stringent response activation. Trends in Microbiology. 21 (4), 174-180 (2013).
  17. Nanamiya, H., et al. Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis. Molecular Microbiology. 67 (2), 291-304 (2008).
  18. Gaca, A. O., et al. Basal Levels of (p)ppGpp in Enterococcus faecalis: the Magic beyond the Stringent Response. mBio. 4 (5), (2013).
  19. Sebaihia, M., et al. The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome. Nature Genetics. 38 (7), 779-786 (2006).
  20. Gasteiger, E., et al. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Research. 31 (13), 3784-3788 (2003).
  21. Purcell, E. B., et al. A nutrient-regulated cyclic diguanylate phosphodiesterase controls Clostridium difficile biofilm and toxin production during stationary phase. Infection and Immunity. , (2017).
  22. Mechold, U., Murphy, H., Brown, L., Cashel, M. Intramolecular Regulation of the Opposing (p)ppGpp Catalytic Activities of RelSeq, the Rel/Spo Enzyme from Streptococcus equisimilis. Journal of Bacteriology. 184 (11), 2878-2888 (2002).
  23. Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. ppGpp Conjures Bacterial Virulence. Microbiology and Molecular Biology Reviews. 74 (2), 171-199 (2010).
  24. Bartlett, J. G. Clostridium difficile: progress and challenges. Annals of the New York Academy of Sciences. 1213, 62-69 (2010).
  25. . . US Department of Health and Human Services. , (2013).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved