A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

This manuscript describes the synthesis of a single-wall carbon nanotube (SWCNT)-conjugated MALAT1 antisense gapmer DNA oligonucleotide (SWCNT-anti-MALAT1), which demonstrates the reliable delivery of the SWCNT and the potent therapeutic effect of anti-MALAT1 in vitro and in vivo. Methods used for synthesis, modification, conjugation, and injection of SWCNT-anti-MALAT1 are described.

Abstract

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as proteins, oligonucleotides, and synthetic small-molecule drugs. The SWCNT has customizable dimensions, a large superficial area, and can flexibly bind with drugs through different modifications on its surface; therefore, it is an ideal system to transport drugs into cells. Long noncoding RNAs (lncRNAs) are a cluster of noncoding RNA longer than 200 nt, which cannot be translated to protein but play an important role in biological and pathophysiological processes. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA. It was demonstrated that higher MALAT1 levels are related to the poor prognosis of various cancers, including multiple myeloma (MM). We have revealed that MALAT1 regulates DNA repair and cell death in MM; thus, MALAT1 can be considered as a therapeutic target for MM. However, the efficient delivery of the antisense oligo to inhibit/knockdown MALAT1 in vivo is still a problem. In this study, we modify the SWCNT with PEG-2000 and conjugate an anti-MALAT1 oligo to it, test the delivery of this compound in vitro, inject it intravenously into a disseminated MM mouse model, and observe a significant inhibition of MM progression, which indicates that SWCNT is an ideal delivery shuttle for anti-MALAT1 gapmer DNA.

Introduction

The SWCNT is a novel nanomaterial that can deliver various types of drugs, such as proteins, small molecules, and nucleic acids, stably and efficiently with ideal tolerability and minimum toxicity in vitro1 and in vivo2. A functionalized SWCNT has great biocompatibility and water solubility, can be used as a shuttle for smaller molecules, and can carry them to penetrate the cell membrane3,4,5.

lncRNAs are a cluster of RNA (>200 nt) that are transcribed from the genome to mRNA but cannot be translated to proteins. Increasing evidence has shown that lncRNAs participate in the regulation of gene expression6 and are involved in the initiation and progression of most types of cancer, including MM7,8,9. MALAT1 is a nuclear-enriched noncoding transcript 2 (NEAT2) and a highly conserved lncRNA10. MALAT1 is initially recognized in metastatic non-small-cell lung cancer (NSCLC)11, but has been overexpressed in numerous tumors5,12,13; it is one of the most highly expressed lncRNAs and is correlated with a poor prognosis in MM8,14. The expression level of MALAT1 is significantly higher in fatal course extramedullary MM patients compared to those only diagnosed as MM15.

In a previous study, we have confirmed that anti-MALAT1 oligos robustly lead to DNA damage and apoptosis in MM16 by using gapmer DNA antisense oligonucleotides targeting MALAT1 (anti-MALAT1) in MM cells. The gapmer DNA is composed of antisense DNA and linked by 2'-OMe-RNAs, which could prompt MALAT1 cleavage by RNase H activity once bound17. The in vivo delivery efficiency of antisense oligos still limits its clinical usage.

To test the delivery effect of SWCNT for anti-MALAT1 gapmer oligos, the anti-MALAT1 gapmer DNA is conjugated to DSPE-PEG2000-amine functionalized SWCNT. The SWCNT-anti-MALAT1 is then injected intravenously into an MM disseminated mouse model; a striking inhibition is observed after four treatments.

Protocol

All experiments involving animals were pre-approved by the Cleveland Clinic IACUC (Institutional Animal Care and Use Committee).

1. Synthesis of Functionalized SWCNTs

  1. Mix 1 mg of SWCNTs, 5 mg of DSPE-PEG2000-Amine, and 5 mL of sterilized nuclease-free water in a glass scintillation vial (20 mL). Shake it well to dissolve all reagents completely.
  2. Sonicate the vial in a water bath sonicator at a power level of 40 W for 1 h at room temperature (RT, 20 min x 3, change the water every 20 min to avoid overheating). Then, centrifuge it at 24,000 x g for 6 h and collect the supernatant solution. This functional SWCNT solution can be stored at 4 °C for 2 months.
  3. Add 1 mL of SWCNT solution from step 1.2 to a 100 kDa MWCO centrifugal filter device, followed by 4 mL of sterilized nuclease-free water. Centrifuge for 10 min at 4,000 x g at RT to remove extra DSPE-PEG2000-amine. Repeat the addition of 4 mL of water and the centrifugation 5x. More than 0.5 mL of leftover SWCNT solution will be left in the filter after each centrifugation.
  4. Measure the concentration of the SWCNT solution leftover in the filter using a UV/VIS spectrometer at 808 nm after the final wash. The final concentration is typically about 50 mg/L (calculated according to the method developed by Kam et al.18).
    NOTE: Ensure that DSPE-PEG-functionalized SWCNTs are water-soluble after step 1.4 and are stable in different biological solutions without visible aggregation after a few weeks.

2. Conjugation of Anti-MALAT1 Gapmer DNA Flanked by 2'-O Modified RNAs to Functionalized SWCNT

  1. Add 0.5 mg of Sulfo-LC-SPDP into 450 µL of DSPE-PEG2000-amine functionalized SWCNT. Add 50 µL of 10x PBS and then incubate for 2 h at RT.
  2. To remove extra Sulfo-LC-SPDP, add the reaction from step 2.1 to a 100 kDa MWCO centrifugal filter device, followed by 4 mL of nuclease-free water. Centrifuge for 10 min at 4,000 x g at RT. Repeat the addition of 4 mL of water and the centrifugation 5x.
  3. Add 200 nM thiol-modified anti-MALAT1-Cy3 gapmer DNA into 1.5 mL of commercial DTT solution and incubate for 90 min at RT. Purify the product with a NAP-5 column, following the manufacturer's protocol. Elute the anti-MALAT1-Cy3 with 500 µL of sterilized nuclease-free 1x PBS.
    NOTE: The functionalized SWCNT can be stored with added DTT, which might cleave disulfide bonds formed during the storage of the thiolated anti-MALAT1 gapmer DNA. The added DTT can be removed by aNAP-5 column before conjugation with SWCNT.
  4. Collect the sulfo-LC-SPDP-treated DSPE-PEG2000-amine SWCNT solution left in the filter and dilute it with 500 µL of anti-MALAT1-Cy3 solution. Then, incubate it at 4 °C for 24 h. The conjugated SWCNT-anti-MALAT1 can be stored at 4 °C for 3 weeks. Following the same procedure, the conjugated SWCNT with scramble antisense oligo can be synthesized and used as SWCNT-control.

3. Tail Vein Injection of SWCNT-Anti-MALAT1

  1. Generate an MM disseminated mouse model.
    1. To achieve the best results of comparison, randomly arrange 14 NOD.CB17-Prkdcscid/J mice (8 weeks old) into trial or control groups (seven in each group) with the same male/female ratio.
    2. Clean the operation bench and sterilize it with 70% alcohol.
    3. Use a heating lamp to warm the mouse to help the tail vein to appear.Restrain the mouse properly with a tail injection restrainer.
    4. Inject 5 x 106 MM.1S-Luc-mCherry cells in 50 µL of PBS through the tail vein without anesthesia. Press the injection site with an alcohol swab for 30 s. Mark the injected mouse and return it to a clean cage.
  2. Start the treatment on day 7 after the MM.1S cell injection.
    1. Inject 50 µL of PBS containing SWCNT-anti-MALAT1 into the tail vein of the mouse. Use PBS containing SWCNT-control as a control.
    2. Press the injection site with an alcohol swab for 30 s.
    3. Observe the local bleeding on the tail and the general behavior of the mouse for 1 min, and then return it to a clean cage. Observe all injected mice again before returning the cage to the rack, to make sure that the injections are tolerated well.
  3. Repeat the injection every 7 days until the termination of the experiment.
    1. Terminate the experiment when the general health of the mouse degrades: when not eating or drinking, the appearance of pale paws, any subcutaneous bleeding, a shortness of breath, decreased activity, a paralysis of the lower limbs, and/or a touchable mass in the abdomen is observed.

4. Evaluation of the Disease Progression

  1. Assess the general status of the mice every day after the MM.1S-Luc-mCherry cell injection. Pay particular attention if the mice develop paralyzes of lower limbs.
  2. Evaluate the tumor growth using an in vivo imaging system 1x a week, before the SWCNT-anti-MALAT1 injection.
    1. Prepare fresh 15 mg/mL D-Luciferin with 1x PBS.
    2. Anesthetize the mice with an isoflurane vaporizer (3–5% for induction and 1–3% for maintenance, depending on the status of the mice).
    3. Inject 150 mg/kg D-Luciferin in each mouse intraperitoneally, 5 min before imaging; then, image the mice in a prone position with an spectrum imaging system.
    4. Collect sequential images of the mice every 2 min, until luminescence saturation is reached. Adjust the interval time according to the D-Luciferin uptake/signal.
  3. Use CO2 to sacrifice the mice once the termination of the experiment is reached.
  4. Since this is an MM disseminated model, process the mice as follows.
    1. Weigh the mouse before dissection.
    2. Collect peripheral blood from the heart for a complete blood count (CBC) assay performed by a blood cell counter machine. The counts of white blood cells and red blood cells, as well as the ratio of lymphocytes, are the primary indexes.
    3. Isolate the spleen and weigh it. Calculate the ratio of spleen/body weight; consider >0.5% as spleen enlargement.
    4. Collect the tissues of bone marrow, spleen, lymph node, kidney, and the tissue with visible metastasis.
    5. Collect the spine if the mouse developed a paralysis of the lower limbs.
    6. Extract RNA and protein from the bone marrow samples.
    7. Fix all remaining tissues in formalin.
    8. For decalcification, immerse the bone samples in 0.25 M EDTA solution (pH 8.0) for 5 days after 24 h of fixation.
    9. Immerse all samples in 75% alcohol for long-term storage.
  5. Compare the signal strength of luciferase at the same time points in two groups. From both groups, record the sacrifice dates of each mouse and calculate the survival curves of the two groups with software.
    NOTE: All procedures are summarized in Figure 1.

Results

To demonstrate the inhibition effect of anti-MALAT1 gapmer DNA in MM, we knocked down the expression of MALAT1 and used it in H929 and MM.1S cells. Forty-eight hours later, cells were collected for the analysis of knock-down efficiency and the apoptosis status in cells transfected with anti-MALAT1 gapmer or control DNA. qRT-PCR results showed that anti-MALAT1 gapmer DNA knocked down the MALAT1 expression in H929 and MM.1S cells efficiently (Figure 2A<...

Discussion

Evidence has shown that lncRNAs take part in the regulation of numerous physiological and pathophysiological procedures in cancers, including MM7,8,9; they have the potential to be targeted for cancer treatment, which can be realized by antisense oligonucleotides20,21,22. The U.S. Food and Drug Administration (FDA) has approved several ...

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors thank the Lerner Research Institute proteomic, genomic, and imaging cores for their assistance and support. Funding: This work was financially supported by NIH/NCI grant R00 CA172292 (to J.J.Z.) and start-up funds (to J.J.Z.) and the Clinical and Translational Science Collaborative (CTSC) of Case Western Reserve University Core Utilization Pilot Grant (to J.J.Z.). This work utilized the Leica SP8 confocal microscope that was purchased with funding from National Institutes of Health SIG grant 1S10OD019972-01.

Materials

NameCompanyCatalog NumberComments
SWCNTsMillipore-Sigma704113
DSPE-PEG2000-AmineAvanti Polar Lipids880128
bath sonicatorVWR97043-992
4 mL centrifugal filterMillipore-SigmaZ740208-8EA
UV/VIS spectrometerThermo Fisher ScientificaccuSkan GO UV/Vis Microplate Spectrophotometerextinction coefficient of 0.0465 L/mg/cm at 808 nm
Sulfo-LC-SPDPProteoChemc1118
DTT solutionMillipore-Sigma43815
NAP-5 columnGE Healthcare17-0853-01
in vivo imaging systemPerkinElmer
NOD.CB17-Prkdcscid/J miceCharles River lab250
Flow cytometerBecton Dickinso
LipofectamineInvitrogen11668019Lipofectamine2000
Fetal bovine serum (FBS)Invitrogen10437-028
RMPI-1640 mediumInvitrogen11875-093
MALAT1-QF:synthesized by IDT Company5’- GTTCTGATCCCGCTGCTATT - 3’
MALAT1-QR:synthesized by IDT Company5’- TCCTCAACACTCAGCCTTTATC - 3’
GAPDH-QF:synthesized by IDT Company5’- CAAGAGCACAAGAGGAAGAGAG - 3’
GAPDH-QR:synthesized by IDT Company5’- CTACATGGCAACTGTGAGGAG - 3’
Quantitative PCR using SYBR Green PCR master mixThermo Fisher ScientificA25780
RevertAid first-stand cDNA synthesis kitThermo Fisher ScientificK1621
anti-MALAT1synthesized by IDT Company5’-mC*mG*mA*mA*mA*C*A*T*T
*G*G*C*A*C*A*mC*mA*mG*mC*mA-3’
Cell Viability Assay KitPromega CorporationG7570CellTiter-GloLuminescent Cell Viability Assay Kit
accuSkan GO UV/Vis Microplate SpectrophotometerThermo Fisher Scientific
centrifugal filterMillipore-SigmaUFC910008
SPSS softwareIBMversion 24.0
D-LuciferinMillipore-SigmaL9504

References

  1. Jiang, X., et al. RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis. Nanoscale. 5 (16), 7256-7264 (2013).
  2. Murakami, T., et al. Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy. Nanomedicine (Lond). 3 (4), 453-463 (2008).
  3. Kam, N. W., Dai, H. Carbon nanotubes as intracellular protein transporters: generality and biological functionality. Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).
  4. Kam, N. W., Liu, Z., Dai, H. Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing. Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).
  5. Kam, N. W., Liu, Z., Dai, H. Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway. Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).
  6. Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. Emerging concepts of epigenetic dysregulation in hematological malignancies. Nature Immunology. 17 (9), 1016-1024 (2016).
  7. Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. The bright side of dark matter: lncRNAs in cancer. Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).
  8. Ronchetti, D., et al. Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma. Oncotarget. 7 (12), 14814-14830 (2016).
  9. Wong, K. Y., et al. Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma. Molecular Cancer. 14, 175 (2015).
  10. Schmidt, L. H., et al. The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).
  11. Ji, P., et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22 (39), 8031-8041 (2003).
  12. Luo, J. H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology. 44 (4), 1012-1024 (2006).
  13. Guffanti, A., et al. A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10, 163 (2009).
  14. Cho, S. F., et al. MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression. BMC Cancer. 14, 809 (2014).
  15. Handa, H., et al. Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma. British Journal of Haematology. 179 (3), 449-460 (2017).
  16. Hu, Y., et al. Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. , (2018).
  17. Lennox, K. A., Behlke, M. A. Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides. Nucleic Acids Research. 44 (2), 863-877 (2016).
  18. Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).
  19. Zeineldin, R., Al-Haik, M., Hudson, L. G. Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells. Nano Letters. 9 (2), 751-757 (2009).
  20. Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation. Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).
  21. Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. MicroRNA theragnostics for the clinical management of multiple myeloma. Leukemia. 28 (4), 732-738 (2014).
  22. Amodio, N., et al. Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia. , (2018).
  23. Highleyman, L. FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration. BETA. 5, (1998).
  24. Smith, R. J., Hiatt, W. R. Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder. JAMA Internal Medicine. 173 (16), 1491-1492 (2013).
  25. Aartsma-Rus, A. FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides. Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).
  26. Nelson, S. F., Miceli, M. C. FDA Approval of Eteplirsen for Muscular Dystrophy. The Journal of the American Medical Association. 317 (14), 1480 (2017).
  27. Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery. American Chemical Society Nano. 1 (1), 50-56 (2007).
  28. Ali-Boucetta, H., et al. Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics. Chemical communications (Cambridge). (4), 459-461 (2008).
  29. Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. Biomedical applications of functionalised carbon nanotubes. Chemical communications. (5), 571-577 (2005).
  30. Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods. International Journal of Nanomedicine. 6, 737-746 (2011).
  31. Padilla-Parra, S., et al. Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes. Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).
  32. Wu, H., Zhu, L., Torchilin, V. P. pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery. Biomaterials. 34 (4), 1213-1222 (2013).
  33. Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages. Chembiochem. 6 (4), 718-725 (2005).
  34. Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA. Biomaterials. 32 (15), 3875-3882 (2011).
  35. Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT). Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).
  36. Lelimousin, M., Sansom, M. S. Membrane perturbation by carbon nanotube insertion: pathways to internalization. Small. 9 (21), 3639-3646 (2013).
  37. Thomas, M., Enciso, M., Hilder, T. A. Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers. J Phys Chem B. 119 (15), 4929-4936 (2015).
  38. Jin, H., Heller, D. A., Strano, M. S. Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells. Nano Letters. 8 (6), 1577-1585 (2008).
  39. Jin, H., Heller, D. A., Sharma, R., Strano, M. S. Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles. American Chemical Society Nano. 3 (1), 149-158 (2009).
  40. Ruggiero, A., et al. Paradoxical glomerular filtration of carbon nanotubes. Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

Multiple MyelomaSingle wall Carbon Nanotube SWCNTMALAT1 Antisense OligoOligonucleotide DeliveryIn VivoNanoparticleDrug DeliveryTreatmentCentrifugal FiltrationSulfo LC SPDPAnti MALAT1 Cy3Mouse Model

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Contact Us

Recommend to library

JoVE NEWSLETTERS

Research

Education

Authors

Librarians

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved