Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

Summary

This manuscript describes the synthesis of a single-wall carbon nanotube (SWCNT)-conjugated MALAT1 antisense gapmer DNA oligonucleotide (SWCNT-anti-MALAT1), which demonstrates the reliable delivery of the SWCNT and the potent therapeutic effect of anti-MALAT1 in vitro and in vivo. Methods used for synthesis, modification, conjugation, and injection of SWCNT-anti-MALAT1 are described.

Abstract

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as proteins, oligonucleotides, and synthetic small-molecule drugs. The SWCNT has customizable dimensions, a large superficial area, and can flexibly bind with drugs through different modifications on its surface; therefore, it is an ideal system to transport drugs into cells. Long noncoding RNAs (lncRNAs) are a cluster of noncoding RNA longer than 200 nt, which cannot be translated to protein but play an important role in biological and pathophysiological processes. Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA. It was demonstrated that higher MALAT1 levels are related to the poor prognosis of various cancers, including multiple myeloma (MM). We have revealed that MALAT1 regulates DNA repair and cell death in MM; thus, MALAT1 can be considered as a therapeutic target for MM. However, the efficient delivery of the antisense oligo to inhibit/knockdown MALAT1 in vivo is still a problem. In this study, we modify the SWCNT with PEG-2000 and conjugate an anti-MALAT1 oligo to it, test the delivery of this compound in vitro, inject it intravenously into a disseminated MM mouse model, and observe a significant inhibition of MM progression, which indicates that SWCNT is an ideal delivery shuttle for anti-MALAT1 gapmer DNA.

Introduction

The SWCNT is a novel nanomaterial that can deliver various types of drugs, such as proteins, small molecules, and nucleic acids, stably and efficiently with ideal tolerability and minimum toxicity in vitro¹ and in vivo². A functionalized SWCNT has great biocompatibility and water solubility, can be used as a shuttle for smaller molecules, and can carry them to penetrate the cell membrane^3,4,5.

lncRNAs are a cluster of RNA (>200 nt) that are transcribed from the genome to mRNA but cannot be transla....

Protocol

All experiments involving animals were pre-approved by the Cleveland Clinic IACUC (Institutional Animal Care and Use Committee).

1. Synthesis of Functionalized SWCNTs

1. Mix 1 mg of SWCNTs, 5 mg of DSPE-PEG2000-Amine, and 5 mL of sterilized nuclease-free water in a glass scintillation vial (20 mL). Shake it well to dissolve all reagents completely.
2. Sonicate the vial in a water bath sonicator at a power level of 40 W for 1 h at room temperature (RT, 20 min x 3, change the water every 20 min to avoid overheating). Then, centrifuge it at 24,000 x g for 6 h and collect the supernatant solution. This functional SWCNT ....

Results

To demonstrate the inhibition effect of anti-MALAT1 gapmer DNA in MM, we knocked down the expression of MALAT1 and used it in H929 and MM.1S cells. Forty-eight hours later, cells were collected for the analysis of knock-down efficiency and the apoptosis status in cells transfected with anti-MALAT1 gapmer or control DNA. qRT-PCR results showed that anti-MALAT1 gapmer DNA knocked down the MALAT1 expression in H929 and MM.1S cells efficiently (Figure 2A<.......

Discussion

Evidence has shown that lncRNAs take part in the regulation of numerous physiological and pathophysiological procedures in cancers, including MM^7,8,9; they have the potential to be targeted for cancer treatment, which can be realized by antisense oligonucleotides^20,21,22. The U.S. Food and Drug Administration (FDA) has approved several .......

Materials

Name	Company	Catalog Number	Comments
SWCNTs	Millipore-Sigma	704113
DSPE-PEG2000-Amine	Avanti Polar Lipids	880128
bath sonicator	VWR	97043-992
4 mL centrifugal filter	Millipore-Sigma	Z740208-8EA
UV/VIS spectrometer	Thermo Fisher Scientific	accuSkan GO UV/Vis Microplate Spectrophotometer	extinction coefficient of 0.0465 L/mg/cm at 808 nm
Sulfo-LC-SPDP	ProteoChem	c1118
DTT solution	Millipore-Sigma	43815
NAP-5 column	GE Healthcare	17-0853-01
in vivo imaging system	PerkinElmer
NOD.CB17-Prkdcscid/J mice	Charles River lab	250
Flow cytometer	Becton Dickinso
Lipofectamine	Invitrogen	11668019	Lipofectamine2000
Fetal bovine serum (FBS)	Invitrogen	10437-028
RMPI-1640 medium	Invitrogen	11875-093
MALAT1-QF:	synthesized by IDT Company		5’- GTTCTGATCCCGCTGCTATT - 3’
MALAT1-QR:	synthesized by IDT Company		5’- TCCTCAACACTCAGCCTTTATC - 3’
GAPDH-QF:	synthesized by IDT Company		5’- CAAGAGCACAAGAGGAAGAGAG - 3’
GAPDH-QR:	synthesized by IDT Company		5’- CTACATGGCAACTGTGAGGAG - 3’
Quantitative PCR using SYBR Green PCR master mix	Thermo Fisher Scientific	A25780
RevertAid first-stand cDNA synthesis kit	Thermo Fisher Scientific	K1621
anti-MALAT1	synthesized by IDT Company		5’-mC*mG*mA*mA*mA*C*A*T*T *G*G*C*A*C*A*mC*mA*mG*mC*mA-3’
Cell Viability Assay Kit	Promega Corporation	G7570	CellTiter-GloLuminescent Cell Viability Assay Kit
accuSkan GO UV/Vis Microplate Spectrophotometer	Thermo Fisher Scientific
centrifugal filter	Millipore-Sigma	UFC910008
SPSS software	IBM	version 24.0
D-Luciferin	Millipore-Sigma	L9504