Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

Summary

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

Abstract

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 10⁶ to 1 x 10⁷ plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

Introduction

Human RSV is the leading cause of hospitalization for acute respiratory tract infection in infants worldwide¹. In addition, RSV is associated with a substantial disease burden in adults comparable to influenza, with most of the hospitalization and mortality burden in the elderly². There are no vaccines or specific antivirals available yet against RSV, but promising new drugs are in development^3,4. The complexity and the heaviness of the techniques of quantification of RSV multiplication impede the search for antivirals or vaccines despite current considerable eff....

Protocol

1. Material Preparation

1. Purchase cell media (reduced serum media, minimum essential media [MEM], 10x MEM, and Dulbecco’s modified Eagle’s medium [DMEM]), transfection reagent, and microcrystalline cellulose (see Table of Materials).
2. Obtain the following vectors for reverse genetics: the genomic vector(s) and the expression vectors encoding the N protein and the polymerase complex proteins. The genomic vectors contain the full cDNA genome of RSV-GFP (p-RSV-GFP) and of RSV.......

Discussion

Here we present a method of rescue of recombinant RSVs from five plasmids, and their amplification. The ability to manipulate the genome of viruses has revolutionized virology research to test mutations and express an additional gene or a tagged viral protein. The RSV we have described and used as an example in this article is a virus expressing a reporter gene, the RSV-GFP (unpublished), and expresses an M2-1 protein fused to a GFP tag¹². RSV rescue is challenging and requires practice. The trans.......

Materials

Name	Company	Catalog Number	Comments
35mm µ dish for live cell imaging	Ibidi	81156
A549	ATCC	ATCC CCL-185
Avicel RC-591	FMC BioPolymer	Avicel RC-591	Technical and other information on Avicels is available at http://www.fmcbiopolymer.com. Store at room temperature. Protocol in step 4 is optimized for this reagent.
BSRT7/5		not commercially available	See ref 22. Buchholz et al, 1999
Crystal violet solution	Sigma	HT90132
Fluorescence microscope for observations	Olympus	IX73 Olympus microscope
Fluorescence microscope for videomicroscopy	Olympus	ScanR Olympus microscope
HEp-2	ATCC	ATCC CCL-23
HEPES ≥99.5%	Sigma	H3375
L-Glutamine (200 mM)	ThermoFisher Scientific	25030024
LIPOFECTAMINE 2000 REAGENT	ThermoFisher Scientific	11668019	Protocol in step 2.3. is optimized for this reagent.
MEM (10X), no glutamine	ThermoFisher Scientific	11430030
MEM, GlutaMAX Supplement	ThermoFisher Scientific	41090-028
MgSO4 ReagentPlus, ≥99.5%	Sigma	M7506
Opti-MEM I Reduced Serum Medium	ThermoFisher Scientific	51985-026
Paraformaldehyde Aqueous Solution, 32%, EM Grade	Electron Microscopy Sciences	15714
Penicillin-Streptomycin (10,000 U/mL)	ThermoFisher Scientific	15140122
Plasmids		not commercially available	see ref 21. Rameix-Welti et al, 2014
See Saw Rocker	VWR	444-0341
Si RNA GAPDH	Dharmacon	ON-TARGETplus siRNA D-001810-10-05	SMARTpool and 3 of 4 individual siRNAs designed by Dharmacon.
Si RNA IMPDH2	Dharmacon	ON-TARGETplus siRNA IMPDH2 Pool- Human L-004330-00-0005	SMARTpool of 4 individual siRNAs designed by Dharmacon. Individual references and sequences J-004330-06: GGAAAGUUGCCCAUUGUAA; J-004330-07: GCACGGCGCUUUGGUGUUC; J-004330-08: AAGGGUCAAUCCACAAAUU; J-004330-09: GGUAUGGGUUCUCUCGAUG;
Si RNA RSV N	Dharmacon	ON-TARGETplus custom siRNA	UUCAGAAGAACUAGAGGCUAU and UUUCAUAAAUUCACUGGGUUA
SiRNA NT	Dharmacon	ON-TARGETplus Non-targeting Pool
SiRNA transfection reagent	Dharmacon	DharmaFECT 1 Ref: T-2001-03	Protocol in steps 5.1.and 5.1.2 are optimized for this reagent.
Sodium Bicarbonate 7.5% solution	ThermoFisher Scientific	25080094
Spectrofluorometer	Tecan	Tecan infinite M200PRO