A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Representative Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

The genome is organized in the nuclear space into different structures that can be revealed through chromosome conformation capture technologies. The in-nucleus Hi-C method provides a genome-wide collection of chromatin interactions in Drosophila cell lines, which generates contact maps that can be explored at megabase resolution at restriction fragment level.

Abstract

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, the mechanisms underlying TAD formation and boundaries are still under investigation. The application of the in-nucleus Hi-C method described here helped to dissect the function of architectural protein (AP)-binding sites at TAD boundaries isolating the Notch gene. Genetic modification of domain boundaries that cause loss of APs results in TAD fusion, transcriptional defects, and long-range topological alterations. These results provided evidence demonstrating the contribution of genetic elements to domain boundary formation and gene expression control in Drosophila. Here, the in-nucleus Hi-C method has been described in detail, which provides important checkpoints to assess the quality of the experiment along with the protocol. Also shown are the required numbers of sequencing reads and valid Hi-C pairs to analyze genomic interactions at different genomic scales. CRISPR/Cas9-mediated genetic editing of regulatory elements and high-resolution profiling of genomic interactions using this in-nucleus Hi-C protocol could be a powerful combination for the investigation of the structural function of genetic elements.

Introduction

In eukaryotes, the genome is partitioned into chromosomes that occupy specific territories in the nuclear space during interphase1. The chromatin forming the chromosomes can be divided into two main states: one of accessible chromatin that is transcriptionally permissive, and the other of compact chromatin that is transcriptionally repressive. These chromatin states segregate and rarely mix in the nuclear space, forming two distinct compartments in the nucleus2. At the sub-megabase scale, boundaries separate domains of high-frequency chromatin interactions, called TADs, that mark chromosomal organization

Protocol

1. Fixation

  1. Start with 10 million Schneider's line 2 plus (S2R+) cells to prepare 17.5 mL of a cell suspension in Schneider medium containing 10% fetal bovine serum (FBS) at room temperature (RT).
  2. Add methanol-free formaldehyde to obtain a final concentration of 2%. Mix and incubate for 10 min at RT, taking care to mix every minute.
    NOTE: Formaldehyde is a hazardous chemical. Follow the appropriate health and safety regulations, and work in the fume hood.
  3. Quench the reaction by adding glycine to achieve a final concentration of 0.125 M and mix. Incubate for 5 min at RT, followed by 15 min on ice.
  4. Centrifuge for 400 ....

Representative Results

Described below are the results of a successful Hi-C protocol (see a summary of the Hi-C protocol workflow in Figure 1A). There are several quality control checkpoints during the in-nucleus Hi-C experiment. Sample aliquots were collected before (UD) and after (D) the chromatin restriction step as well as after ligation (L). Crosslinks were reversed, and DNA was purified and run on an agarose gel. A smear of 200-1000 bp was observed when restriction with Mbo I was successful (

Discussion

The in-nucleus Hi-C method presented here has allowed detailed exploration of Drosophila genome topology at high resolution, providing a view of genomic interactions at different genomic scales, from chromatin loops between regulatory elements such as promoters and enhancers to TADs and large compartment identification25. The same technology has also been efficiently applied to mammalian tissues with some modifications33. For example, when processing a tissue instead of a s.......

Disclosures

The authors declare no competing interests.

Acknowledgements

This work was supported by UNAM Technology Innovation and Research Support Program (PAPIIT) grant number IN207319 and the Science and Technology National Council (CONACyT-FORDECyT) grant number 303068. A.E.-L. is a master's student supported by the Science and Technology National Council (CONACyT) CVU number 968128.

....

Materials

NameCompanyCatalog NumberComments
16% (vol/vol) paraformaldehyde solutionAgar ScientificR1026
Biotin-14-dATPInvitrogenCA1524-016
ClaI enzymeNEBR0197S
COVARIS UltrasonicatorCovarisLE220-M220
Cut SmartNEBB72002S
Dulbecco's Modified Eagle Medium (DMEM) 1xLife Technologies41965-039
Dynabeads MyOne Streptabidin C1Invitrogen65002
Fetal bovine serum (FBS) sterile filteredSigmaF9665
Klenow Dna PolI large fragmentNEBM0210L
Klenow exo(-)NEBM0210S
Ligation BufferNEBB020S
MboI enzymeNEBR0147M
NP40-IgepalSIGMACA-420Non-ionic surfactant for addition in lysis buffer
PE adapter 1.0Illumina5'-P-GATCGGAAGAGCGGTTCAGCAG
GAATGCCGAG-3'
PE adapter 2.0Illumina5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3'
PE PCR primer 1.0Illumina5'-AATGATACGGCGACCACCGAGAT
CTACACTCTTTCCCTACACGACG
CTCTTCCGATCT-3'
PE PCR primer 2.0Illumina5'-CAAGCAGAAGACGGCATACGAG
ATCGGTCTCGGCATTCCTGCTGA
ACCGCTCTTCCGATCT-3'
Phenol: Chloroform:Isoamyl Alcohol 25:24:1SIGMAP2069
Primer 1 (known interaction, Figure 2A)Sigma5'-TCGCGGTAATTTTGCGTTTGA-3'
Primer 2 (known interactions, Figure 2A)Sigma5'-CCTCCCTGCCAAAACGTTTT-3'
Protease inhibitor cocktail tabletRoche4693132001
Proteinase KRoche3115879001
QubitThermoFisherQ33327
RNAseRoche10109142001
SPRI BeadsBeckmanB23318
T4 DNA ligaseInvitrogen15224-025
T4 DNA polymeraseNEBM0203S
T4 polynucleotide kinase (PNK) NEBM0201L
TaqPhusionNEBM0530SDNA polymerase
Triton X-100Non-ionic surfactant for quenching of SDS

References

  1. Cremer, T., Cremer, C. Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nature Review Genetics. 2, 292-301 (2001).
  2. Lieberman-Aiden, E., et al.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

Hi CChromatin ConformationGenome OrganizationChromosomal InteractionsDrosophila CellsNuclear ClumpsFormaldehyde CrosslinkingGlycine QuenchingCell LysisRestriction Enzyme DigestionSDS PermeabilizationTriton TreatmentQuality ControlSequencing

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved