JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Genetics

In-Nucleus Hi-C in Drosophila Cells

Published: September 15th, 2021

DOI:

10.3791/62106

1Departamento de Genética Molecular, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México

The genome is organized in the nuclear space into different structures that can be revealed through chromosome conformation capture technologies. The in-nucleus Hi-C method provides a genome-wide collection of chromatin interactions in Drosophila cell lines, which generates contact maps that can be explored at megabase resolution at restriction fragment level.

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, the mechanisms underlying TAD formation and boundaries are still under investigation. The application of the in-nucleus Hi-C method described here helped to dissect the function of architectural protein (AP)-binding sites at TAD boundaries isolating the Notch gene. Genetic modification of domain boundaries that cause loss of APs results in TAD fusion, transcriptional defects, and long-range topological alterations. These results provided evidence demonstrating the contribution of genetic elements to domain boundary formation and gene expression control in Drosophila. Here, the in-nucleus Hi-C method has been described in detail, which provides important checkpoints to assess the quality of the experiment along with the protocol. Also shown are the required numbers of sequencing reads and valid Hi-C pairs to analyze genomic interactions at different genomic scales. CRISPR/Cas9-mediated genetic editing of regulatory elements and high-resolution profiling of genomic interactions using this in-nucleus Hi-C protocol could be a powerful combination for the investigation of the structural function of genetic elements.

In eukaryotes, the genome is partitioned into chromosomes that occupy specific territories in the nuclear space during interphase1. The chromatin forming the chromosomes can be divided into two main states: one of accessible chromatin that is transcriptionally permissive, and the other of compact chromatin that is transcriptionally repressive. These chromatin states segregate and rarely mix in the nuclear space, forming two distinct compartments in the nucleus2. At the sub-megabase scale, boundaries separate domains of high-frequency chromatin interactions, called TADs, that mark chromosomal organization

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Fixation

  1. Start with 10 million Schneider's line 2 plus (S2R+) cells to prepare 17.5 mL of a cell suspension in Schneider medium containing 10% fetal bovine serum (FBS) at room temperature (RT).
  2. Add methanol-free formaldehyde to obtain a final concentration of 2%. Mix and incubate for 10 min at RT, taking care to mix every minute.
    NOTE: Formaldehyde is a hazardous chemical. Follow the appropriate health and safety regulations, and work in the fume hood.
  3. Quench the reaction by .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Described below are the results of a successful Hi-C protocol (see a summary of the Hi-C protocol workflow in Figure 1A). There are several quality control checkpoints during the in-nucleus Hi-C experiment. Sample aliquots were collected before (UD) and after (D) the chromatin restriction step as well as after ligation (L). Crosslinks were reversed, and DNA was purified and run on an agarose gel. A smear of 200-1000 bp was observed when restriction with Mbo I was successful (

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The in-nucleus Hi-C method presented here has allowed detailed exploration of Drosophila genome topology at high resolution, providing a view of genomic interactions at different genomic scales, from chromatin loops between regulatory elements such as promoters and enhancers to TADs and large compartment identification25. The same technology has also been efficiently applied to mammalian tissues with some modifications33. For example, when processing a tissue instead of a s.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This work was supported by UNAM Technology Innovation and Research Support Program (PAPIIT) grant number IN207319 and the Science and Technology National Council (CONACyT-FORDECyT) grant number 303068. A.E.-L. is a master's student supported by the Science and Technology National Council (CONACyT) CVU number 968128.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Biotin-14-dATP Invitrogen CA1524-016
ClaI enzyme NEB R0197S
COVARIS Ultrasonicator Covaris LE220-M220
Cut Smart NEB B72002S
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Dynabeads MyOne Streptabidin C1 Invitrogen 65002
Fetal bovine serum (FBS) sterile filtered Sigma F9665
Klenow Dna PolI large fragment NEB M0210L
Klenow exo(-) NEB M0210S
Ligation Buffer NEB B020S
MboI enzyme NEB R0147M
NP40-Igepal SIGMA CA-420 Non-ionic surfactant for addition in lysis buffer
PE adapter 1.0 Illumina 5'-P-GATCGGAAGAGCGGTTCAGCAG
GAATGCCGAG-3'
PE adapter 2.0 Illumina 5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3'
PE PCR primer 1.0 Illumina 5'-AATGATACGGCGACCACCGAGAT
CTACACTCTTTCCCTACACGACG
CTCTTCCGATCT-3'
PE PCR primer 2.0 Illumina 5'-CAAGCAGAAGACGGCATACGAG
ATCGGTCTCGGCATTCCTGCTGA
ACCGCTCTTCCGATCT-3'
Phenol: Chloroform:Isoamyl Alcohol 25:24:1 SIGMA P2069
Primer 1 (known interaction, Figure 2A) Sigma 5'-TCGCGGTAATTTTGCGTTTGA-3'
Primer 2 (known interactions, Figure 2A) Sigma 5'-CCTCCCTGCCAAAACGTTTT-3'
Protease inhibitor cocktail tablet Roche 4693132001
Proteinase K Roche 3115879001
Qubit ThermoFisher Q33327
RNAse Roche 10109142001
SPRI Beads Beckman B23318
T4 DNA ligase Invitrogen 15224-025
T4 DNA polymerase NEB M0203S
T4 polynucleotide kinase (PNK)  NEB M0201L
TaqPhusion NEB M0530S DNA polymerase
Triton X-100 Non-ionic surfactant for quenching of SDS

  1. Cremer, T., Cremer, C. Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nature Review Genetics. 2, 292-301 (2001).
  2. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  3. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, 376-380 (2012).
  4. Sexton, T., et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 148 (3), 458-472 (2012).
  5. Dixon, J. R., Gorkin, D. U., Ren, B. Chromatin domains: the unit of chromosome organization. Molecular Cell. 62, 668-680 (2016).
  6. Bonev, B., Cavalli, G. Organization and function of the 3D genome. Nature Reviews Genetics. 17, 661-678 (2016).
  7. Lupiáñez, D. G., Spielmann, M., Mundlos, S. Breaking TADs: how alterations of chromatin domains result in disease. Trends in Genetics. 32, 225-237 (2016).
  8. Phillips, J. E., Corces, V. G. CTCF: master weaver of the genome. Cell. 137 (7), 1194-1211 (2009).
  9. Hong, S., Kim, D. Computational characterization of chromatin domain boundary-associated genomic elements. Nucleic Acids Research. 45, 10403-10414 (2017).
  10. Zuin, J., et al. Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells. Proceedings of the National Academy of Sciences of the United States of America. 111 (3), 996-1001 (2014).
  11. Guo, Y., et al. CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function. Cell. 162, 900-910 (2015).
  12. Lupiáñez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  13. Van-Steensel, B., Furlong, E. E. M. The role of transcription in shaping the spatial organization of the genome. Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).
  14. Merkenschlager, M., Nora, E. P. CTCF and cohesin in genome folding and transcriptional gene regulation. Annual Review of Genomics and Human Genetics. 17 (1), 17-43 (2016).
  15. Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. CTCF and cohesin regulate chromatin loop stability with distinct dynamics. Elife. 6, 1-10 (2017).
  16. Van Bortle, K., et al. Insulator function and topological domain border strength scale with architectural protein occupancy. Genome Biology. 15, 82 (2014).
  17. Ramírez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. Nature Communications. 9, 189 (2018).
  18. Ulianov, S. V., et al. Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains. Genome Research. 26, 70-84 (2016).
  19. Rowley, M. J., et al. Evolutionarily conserved principles predict 3D chromatin organization. Molecular Cell. 67, 837-852 (2017).
  20. Gavrilov, A. A., Golov, A. K., Razin, S. V. Actual ligation frequencies in the chromosome conformation capture procedure. PLoS One. 8, 60403 (2013).
  21. Gavrilov, A. A., et al. Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub. Nucleic Acids Research. 41, 3563-3575 (2013).
  22. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  23. Rao, S. S. P., et al. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell. 159 (7), 1665-1680 (2014).
  24. Nagano, T., et al. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  25. Arzate-Mejía, R., et al. In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila. Nature Communications. 11, 894 (2020).
  26. Schoenfelder, S., et al. Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions. Journal of Visualized Experiments. (136), e57320 (2018).
  27. Servant, N., et al. HiC-Pro: an optimized and flexible pipeline for Hi-C processing. Genome Biology. 16, 259 (2015).
  28. Philip, E., Måns, M., Sverker, L., Max, K. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 10, 1093 (2016).
  29. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Research. 4, 1310 (2015).
  30. Imakaev, M., et al. Iterative correction of Hi-C data reveals hallmarks of chromosome organization. Nature Methods. 9 (10), 999-1003 (2012).
  31. Akdemir, K. C., Chin, L. HiCPlotter integrates genomic data with interaction matrices. Genome Biolog. 16, 198 (2015).
  32. Ramirez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. Nature Communications. 9, 189 (2018).
  33. Ando-Kuri, M., et al. The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle. bioRxiv. , (2020).
  34. Cuellar-Partida, G., et al. Epigenetic priors for identifying active transcription factor binding sites. Bioinformatics. 28 (1), 56-62 (2012).
  35. Zhang, Y., et al. Model-based analysis of ChIP-Seq (MACS). Genome Biology. 9, 137 (2008).
  36. Ong, C. -. T., et al. Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila. Cell. 155 (1), 148-159 (2013).
  37. Fresán, U., et al. The insulator protein CTCF regulates Drosophila steroidogenesis. Biology Open. 4 (7), 852-857 (2015).
  38. Quinodoz, S., et al. RNA promotes the formation of spatial compartments in the nucleus. Cell. 174, 744-757 (2018).
  39. Olivares-Chauvet, P., et al. Capturing pairwise and multi-way chromosomal conformations using chromosomal walks. Nature. 540 (7632), 296-300 (2016).
  40. Beagrie, R., et al. Complex multi-enhancer contacts captured by genome architecture mapping. Nature. 543, 519-524 (2017).
  41. Redolfi, J., et al. DamC reveals principles of chromatin folding in vivo without crosslinking and ligation. Nature Structural and Molecular Biology. 26, 471-480 (2019).
  42. Maxwell, R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  43. Gao, X., et al. C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2. Nature Methods. 15 (6), 433-436 (2018).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved