JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Genetics

Mapping R-Loops and RNA:DNA Hybrids with S9.6-Based Immunoprecipitation Methods

Published: August 24th, 2021

DOI:

10.3791/62455

1Department of Molecular and Cellular Biology and Genome Center, University of California

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

R-loops are three-stranded nucleic acid structures that form primarily during transcription upon hybridization of the nascent RNA transcript to the template DNA strand. This results in the formation of an RNA:DNA hybrid and causes the displacement of the non-template DNA strand in a single-stranded looped state. Biochemical reconstitution1,2,3,4 and mathematical modeling5, in combination with other biophysical measurements6,7, have established that R-loops are....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The following protocol is optimized for the human Ntera-2 cell line grown in culture, but it has been successfully adapted without modification to a range of other human cell lines (HEK293, K562, HeLa, U2OS), primary cells (fibroblasts, B-cells) as well as in other organisms with small modifications (mice, flies).

1. Cell harvest and lysis

  1. Culture Ntera-2 cells to 75%-85% confluency. Ensure that the optimal cell count is 5 to 6 million cells with >90% viable counts to start any.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

DRIP as well as sDRIP can be analyzed through qPCR (Figure 2A) and/or sequencing (Figure 2B). After the immunoprecipitation step, the quality of the experiment must be first confirmed by qPCR on positive and negative control loci, as well as with RNase H-treated controls. Primers corresponding to frequently used loci in multiple human cell lines are provided in Table 2. The results from qPCR should be displayed as a percentage of input, which co.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Described here are two protocols to map R-loop structures in potentially any organism using the S9.6 antibody. DRIP-seq represents the first genome-wide R-loop mapping technique developed. It is an easy, robust, and reproducible technique that allows one to map the distribution of R-loops along any genome. The second technique, termed sDRIP-seq, is also robust and reproducible but achieves higher resolution and strand-specificity owing to the inclusion of a sonication step and a stranded sequencing library construction p.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Work in the Chedin lab is supported by a grant from the National Institutes of Health (R01 GM120607).

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
15 mL tube High density Maxtract phase lock gel Qiagen 129065
2 mL tube phase lock gel light VWR 10847-800
Agarose A/G beads ThermoFisher Scientific 20421
Agencourt AMPure XP beads Beckman Coulter A63881
AmpErase Uracil N-glycosylase ThermoFisher Scientific N8080096
Index adapters Illumina Corresponds to the TrueSeq Single indexes
Klenow fragment (3’ to 5’ exo-) New England BioLabs M0212S
NEBNext End repair module New England BioLabs E6050
PCR primers for library amplification primer 1.0 P5 (5’ AATGATACGGCGACCACCGAGA
TCTACACTCTTTCCCTACACGA 3’)
PCR primers for library amplification PCR primer 2.0 P7 (5’ CAAGCAGAAGACGGCATACG
AGAT 3’)
Phenol/Chloroform Isoamyl alcohol 25:24:1 Affymetrix 75831-400ML
Phusion Flash High-Fidelity PCR master mix ThermoFisher Scientific F548S
Quick Ligation Kit New England BioLabs M2200S
Ribonuclease H New England BioLabs M0297S
S9.6 Antibody Kerafast ENH001 These three sources are equivalent
S9.6 Antibody Millipore/Sigma MABE1095
S9.6 Antibody Abcam ab234957

  1. Reaban, M. E., Lebowitz, J., Griffin, J. A. Transcription induces the formation of a stable RNA.DNA hybrid in the immunoglobulin alpha switch region. The Journal of Biological Chemistry. 269 (34), 21850-21857 (1994).
  2. Daniels, G. A., Lieber, M. R. RNA:DNA complex formation upon transcription of immunoglobulin switch regions: implications for the mechanism and regulation of class switch recombination. Nucleic Acids Research. 23 (24), 5006-5011 (1995).
  3. Yu, K., Chedin, F., Hsieh, C. L., Wilson, T. E., Lieber, M. R. R-loops at immunoglobulin class switch regions in the chromosomes of stimulated B cells. Nature Immunology. 4 (5), 442-451 (2003).
  4. Ginno, P. A., Lott, P. L., Christensen, H. C., Korf, I., Chedin, F. R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters. Molecular Cell. 45 (6), 814-825 (2012).
  5. Stolz, R., et al. Interplay between DNA sequence and negative superhelicity drives R-loop structures. Proceedings of the National Academy of Sciences of the United States of America. 116 (13), 6260-6269 (2019).
  6. Duquette, M. L., Handa, P., Vincent, J. A., Taylor, A. F., Maizels, N. Intracellular transcription of G-rich DNAs induces formation of G-loops, novel structures containing G4 DNA. Genes & Development. 18 (13), 1618-1629 (2004).
  7. Carrasco-Salas, Y., et al. The extruded non-template strand determines the architecture of R-loops. Nucleic Acids Research. 47 (13), 6783-6795 (2019).
  8. Huppert, J. L. Thermodynamic prediction of RNA-DNA duplex-forming regions in the human genome. Molecular Biosystems. 4 (6), 686-691 (2008).
  9. Hartono, S. R., Korf, I. F., Chedin, F. GC skew is a conserved property of unmethylated CpG island promoters across vertebrates. Nucleic Acids Research. 43 (20), 9729-9741 (2015).
  10. Green, P., Ewing, B., Miller, W., Thomas, P. J., Green, E. D. Transcription-associated mutational asymmetry in mammalian evolution. Nature Genetics. 33 (4), 514-517 (2003).
  11. Polak, P., Arndt, P. F. Transcription induces strand-specific mutations at the 5' end of human genes. Genome Research. 18 (8), 1216-1223 (2008).
  12. Malig, M., Hartono, S. R., Giafaglione, J. M., Sanz, L. A., Chedin, F. Ultra-deep Coverage Single-molecule R-loop Footprinting Reveals Principles of R-loop Formation. Journal of Moleclar Biology. 432 (7), 2271-2288 (2020).
  13. Masse, E., Phoenix, P., Drolet, M. DNA topoisomerases regulate R-loop formation during transcription of the rrnB operon in Escherichia coli. The Journal of Biological Chemistry. 272 (19), 12816-12823 (1997).
  14. Drolet, M., et al. The problem of hypernegative supercoiling and R-loop formation in transcription. Frontiers in Bioscience: A Journal and Virtual Library. 8, 210-221 (2003).
  15. Chedin, F., Benham, C. J. Emerging roles for R-loop structures in the management of topological stress. The Journal of Biological Chemistry. 295 (14), 4684-4695 (2020).
  16. Ginno, P. A., Lim, Y. W., Lott, P. L., Korf, I., Chedin, F. GC skew at the 5' and 3' ends of human genes links R-loop formation to epigenetic regulation and transcription termination. Genome Research. 23 (10), 1590-1600 (2013).
  17. Sanz, L. A., et al. conserved R-Loop structures associate with specific epigenomic signatures in mammals. Molecular Cell. 63 (1), 167-178 (2016).
  18. El Hage, A., Webb, S., Kerr, A., Tollervey, D. Genome-wide distribution of RNA-DNA hybrids identifies RNase H targets in tRNA genes, retrotransposons and mitochondria. PLoS Genetics. 10 (10), 1004716 (2014).
  19. Hartono, S. R., et al. The affinity of the S9.6 Antibody for Double-Stranded RNAs impacts the accurate mapping of R-loops in fission yeast. Journal of Molecular Biology. 430 (3), 272-284 (2018).
  20. Wahba, L., Costantino, L., Tan, F. J., Zimmer, A., Koshland, D. S1-DRIP-seq identifies high expression and polyA tracts as major contributors to R-loop formation. Genes & Development. 30 (11), 1327-1338 (2016).
  21. Alecki, C., et al. RNA-DNA strand exchange by the Drosophila Polycomb complex PRC2. Nature Communications. 11 (1), 1781 (2020).
  22. Xu, W., et al. The R-loop is a common chromatin feature of the Arabidopsis genome. Nature Plants. 3 (9), 704-714 (2017).
  23. Chedin, F. Nascent connections: R-Loops and chromatin patterning. Trends in Genetics: TIG. 32 (12), 828-838 (2016).
  24. Skourti-Stathaki, K., Proudfoot, N. J., Gromak, N. Human senataxin resolves RNA/DNA hybrids formed at transcriptional pause sites to promote Xrn2-dependent termination. Molecular Cell. 42 (6), 794-805 (2011).
  25. Kreuzer, K. N., Brister, J. R. Initiation of bacteriophage T4 DNA replication and replication fork dynamics: a review in the Virology Journal series on bacteriophage T4 and its relatives. Virology Journal. 7, 358 (2010).
  26. Carles-Kinch, K., Kreuzer, K. N. RNA-DNA hybrid formation at a bacteriophage T4 replication origin. Journal of Molecular Biology. 266 (5), 915-926 (1997).
  27. Masukata, H., Tomizawa, J. A mechanism of formation of a persistent hybrid between elongating RNA and template DNA. Cell. 62 (2), 331-338 (1990).
  28. Itoh, T., Tomizawa, J. Formation of an RNA primer for initiation of replication of ColE1 DNA by ribonuclease H. Proceedings of the National Academy of Sciences of the United States of America. 77 (5), 2450-2454 (1980).
  29. Stuckey, R., Garcia-Rodriguez, N., Aguilera, A., Wellinger, R. E. Role for RNA:DNA hybrids in origin-independent replication priming in a eukaryotic system. Proceedings of the National Academy of Sciences of the United States of America. 112 (18), 5779-5784 (2015).
  30. Lee, D. Y., Clayton, D. A. Initiation of mitochondrial DNA replication by transcription and R-loop processing. The Journal of Biological Chemistry. 273 (46), 30614-30621 (1998).
  31. Xu, B., Clayton, D. A. A persistent RNA-DNA hybrid is formed during transcription at a phylogenetically conserved mitochondrial DNA sequence. Molecular and Cellular Biology. 15 (1), 580-589 (1995).
  32. Cadoret, J. C., et al. Genome-wide studies highlight indirect links between human replication origins and gene regulation. Proceedings of the National Academy of Sciences of the United States of America. 105 (41), 15837-15842 (2008).
  33. Sequeira-Mendes, J., et al. Transcription initiation activity sets replication origin efficiency in mammalian cells. PLoS Genetics. 5 (4), 1000446 (2009).
  34. Picard, F., et al. The spatiotemporal program of DNA replication is associated with specific combinations of chromatin marks in human cells. PLoS Genetics. 10 (5), 1004282 (2014).
  35. Mukhopadhyay, R., et al. Allele-specific genome-wide profiling in human primary erythroblasts reveal replication program organization. PLoS Genetics. 10 (5), 1004319 (2014).
  36. Huang, F. T., Yu, K., Hsieh, C. L., Lieber, M. R. Downstream boundary of chromosomal R-loops at murine switch regions: implications for the mechanism of class switch recombination. Proceedings of the National Academy of Sciences of the United States of America. 103 (13), 5030-5035 (2006).
  37. Huang, F. T., et al. Sequence dependence of chromosomal R-loops at the immunoglobulin heavy-chain Smu class switch region. Molecular and Cellular Biology. 27 (16), 5921-5932 (2007).
  38. Yu, K., Lieber, M. R. Current insights into the mechanism of mammalian immunoglobulin class switch recombination. Critical Reviews in Biochemistry and Molecular Biology. 54 (4), 333-351 (2019).
  39. Crossley, M. P., Bocek, M., Cimprich, K. A. R-Loops as cellular regulators and genomic threats. Molecular Cell. 73 (3), 398-411 (2019).
  40. Santos-Pereira, J. M., Aguilera, A. R loops: new modulators of genome dynamics and function. Nature Reviews. Genetics. 16 (10), 583-597 (2015).
  41. Garcia-Muse, T., Aguilera, A. R Loops: From physiological to pathological roles. Cell. 179 (3), 604-618 (2019).
  42. Skourti-Stathaki, K., Proudfoot, N. J. A double-edged sword: R loops as threats to genome integrity and powerful regulators of gene expression. Genes & Development. 28 (13), 1384-1396 (2014).
  43. Costantino, L., Koshland, D. The Yin and Yang of R-loop biology. Current Opinion in Cell Biology. 34, 39-45 (2015).
  44. Boguslawski, S. J., et al. Characterization of monoclonal antibody to DNA.RNA and its application to immunodetection of hybrids. Journal of Immunological Methods. 89 (1), 123-130 (1986).
  45. Sanz, L. A., Chedin, F. High-resolution, strand-specific R-loop mapping via S9.6-based DNA-RNA immunoprecipitation and high-throughput sequencing. Nature Protocols. 14 (6), 1734-1755 (2019).
  46. Halasz, L., et al. RNA-DNA hybrid (R-loop) immunoprecipitation mapping: an analytical workflow to evaluate inherent biases. Genome Research. 27 (6), 1063-1073 (2017).
  47. Phillips, D. D., et al. The sub-nanomolar binding of DNA-RNA hybrids by the single-chain Fv fragment of antibody S9.6. Journal of Molecular Recognition. 26 (8), 376-381 (2013).
  48. Chedin, F., Hartono, S. R., Sanz, L. A., Vanoosthuyse, V. Best practices for the visualization, mapping, and manipulation of R-loops. The EMBO Journal. 40 (4), 106394 (2021).
  49. Smolka, J. A., Sanz, L. A., Hartono, S. R., Chedin, F. Recognition of RNAs by the S9.6 antibody creates pervasive artefacts when imaging RNA:DNA hybrids. Journal of Cell Biology. 220 (6), 202004079 (2021).
  50. Chen, J. Y., Zhang, X., Fu, X. D., Chen, L. R-ChIP for genome-wide mapping of R-loops by using catalytically inactive RNASEH1. Nature Protocols. 14 (5), 1661-1685 (2019).
  51. Yan, Q., Sarma, K. MapR: A Method for Identifying native R-loops genome wide. Current Protocols in Molecular Biology. 130 (1), 113 (2020).
  52. Wang, K., et al. Genomic profiling of native R loops with a DNA-RNA hybrid recognition sensor. Science Advances. 7 (8), (2021).
  53. Crossley, M. P., Bocek, M. J., Hamperl, S., Swigut, T., Cimprich, K. A. qDRIP: a method to quantitatively assess RNA-DNA hybrid formation genome-wide. Nucleic Acids Research. 48 (14), 84 (2020).
  54. Svikovic, S., et al. R-loop formation during S phase is restricted by PrimPol-mediated repriming. The EMBO Journal. 38 (3), 99793 (2019).
  55. Yang, X., et al. m(6)A promotes R-loop formation to facilitate transcription termination. Cell Research. 29 (12), 1035-1038 (2019).
  56. Vanoosthuyse, V. Strengths and weaknesses of the current strategies to map and characterize R-Loops. Non-coding RNA. 4 (2), 9 (2018).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved