A subscription to JoVE is required to view this content. Sign in or start your free trial.
This protocol describes methodologies to establish mouse endometrial epithelial organoids for gene expression and histological analyses.
Endometrial tissue lines the inner cavity of the uterus and is under the cyclical control of estrogen and progesterone. It is a tissue that is composed of luminal and glandular epithelium, a stromal compartment, a vascular network, and a complex immune cell population. Mouse models have been a powerful tool to study the endometrium, revealing critical mechanisms that control implantation, placentation, and cancer. The recent development of 3D endometrial organoid cultures presents a state-of-the-art model to dissect the signaling pathways that underlie endometrial biology. Establishing endometrial organoids from genetically engineered mouse models, analyzing their transcriptomes, and visualizing their morphology at a single-cell resolution are crucial tools for the study of endometrial diseases. This paper outlines methods to establish 3D cultures of endometrial epithelium from mice and describes techniques to quantify gene expression and analyze the histology of the organoids. The goal is to provide a resource that can be used to establish, culture, and study the gene expression and morphological characteristics of endometrial epithelial organoids.
The endometrium - the inner lining mucosal tissue of the uterine cavity - is a unique and highly dynamic tissue that plays critical roles in a woman's reproductive health. During the reproductive lifespan, the endometrium holds the potential to undergo hundreds of cycles of proliferation, differentiation, and breakdown, coordinated by the concerted action of the ovarian hormones - estrogen and progesterone. Studies of genetically engineered mice have uncovered basic biological mechanisms underpinning the endometrial response to hormones and control of embryo implantation, stromal cell decidualization, and pregnancy1. In vitro studi....
Mouse handling and experimental studies were performed under protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Baylor College of Medicine and guidelines established by the NIH Guide for the Care and Use of Laboratory Animals.
1. Isolation of uterine epithelium from mice using enzymatic and mechanical methods
NOTE: This section describes the steps required to establish, passage, freeze, and thaw epithelial endometrial org.......
Phase contrast images of mouse endometrial organoids
We established organoids from WT mouse endometrial epithelium, as described in the attached protocol (see diagram in Figure 1). Following enzymatic dissociation of the mouse endometrial epithelium, epithelial sheets were mechanically separated from the uterine stromal cells and further dissociated with collagenase to generate a single-cell suspension. If performed correctly, this method of epithelial and stromal cell.......
Here, we describe methods to generate endometrial epithelial organoids from mouse endometrium and the protocols routinely used for their downstream analysis. Endometrial organoids are a powerful tool to study the mechanisms that control endometrial-related diseases, such as endometriosis, endometrial cancer, and implantation failure. Landmark studies published in 2017 reported the conditions to culture long-term and renewable cultures of endometrial organoids from mouse and human epithelium4,.......
We thank Dr. Stephanie Pangas and Dr. Martin M. Matzuk (M.M.M.) for critical reading and editing of our manuscript. Studies were supported by Eunice Kennedy Shriver National Institute of Child Health and Human Development grants R00-HD096057 (D.M.), R01-HD105800 (D.M.), R01-HD032067 (M.M.M.), and R01-HD110038 (M.M.M.), and by NCI- P30 Cancer Center Support Grant (NCI-CA125123). Diana Monsivais, Ph.D. holds a Next Gen Pregnancy Award from the Burroughs Wellcome Fund.
....Name | Company | Catalog Number | Comments |
Organoid Media Formulation | |||
Name | Company | Catalog Number | Final concentration |
Corning Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix, *LDEV-free | Corning | 354230 | 100% |
Trypsin from Bovine Pancreas | Sigma Aldrich | T1426-1G | 1% |
Advanced DMEM/F12 | Life Technologies | 12634010 | 1X |
N2 supplement | Life Technologies | 17502048 | 1X |
B-27â„¢ Supplement (50X), minus vitamin A | Life Technologies | 12587010 | 1X |
Primocin | Invivogen | ant-pm-1 | 100 µg/mL |
N-Acetyl-L-cysteine | Sigma Aldrich | A9165-5G | 1.25 mM |
L-glutamine | Life Technologies | 25030024 | 2 mM |
Nicotinamide | Sigma Aldrich | N0636-100G | 10 nM |
ALK-4, -5, -7 inhibitor, A83-01 | Tocris | 2939 | 500 nM |
Recombinant human EGF | Peprotech | AF-100-15 | 50 ng/mL |
Recombinant human Noggin | Peprotech | 120-10C | 100 ng/mL |
Recombinant human Rspondin-1 | Peprotech | 120-38 | 500 ng/mL |
Recombinant human FGF-10 | Peprotech | 100-26 | 100 ng/mL |
Recombinant human HGF | Peprotech | 100-39 | 50 ng/mL |
WNT3a | R&D systems | 5036-WN | 200 ng/mL |
Other supplies and reagents | |||
Name | Company | Catalog Number | Final concentration |
Collagenase from Clostridium histolyticum | Sigma Aldrich | C0130-1G | 5 mg/mL |
Deoxyribonuclease I from bovine pancreas | Sigma Aldrich | DN25-100MG | 2 mg/mL |
DPBS, no calcium, no magnesium | ThermoFisher | 14190-250 | 1X |
HBSS, no calcium, no magnesium | ThermoFisher | 14170112 | 1X |
Falcon Polystyrene Microplates (24-Well) | Fisher Scientific | #08-772-51 | |
Falcon Polystyrene Microplates (12-Well) | Fisher Scientific | #0877229 | |
Falcon Cell Strainers, 40 µm | Fisher Scientific | #08-771-1 | |
Direct-zol RNA MiniPrep (50 µg) | Genesee Scientific | 11-331 | |
Trizol reagent | Invitrogen | 15596026 | |
DMEM/F-12, HEPES, no phenol red | ThermoFisher | 11039021 | |
Fetal Bovine Serum, Charcoal stripped | Sigma Aldrich | F6765-500ML | 2% |
Estratiol (E2) | Sigma Aldrich | E1024-1G | 10 nM |
Formaldehyde 16% in aqueous solution, EM Grade | VWR | 15710 | 4% |
Epredia Cassette 1 Slotted Tissue Cassettes | Fisher Scientific | 1000961 | |
Epredia Stainless-Steel Embedding Base Molds | Fisher Scientific | 64-010-15Â | |
Ethanol, 200 proof (100%) | Fisher Scientific | 22-032-601Â | |
Histoclear | Fisher Scientific | 50-899-90147 | |
Permount Mounting Medium | Fisher Scientific | 50-277-97 | |
Epredia Nylon Biopsy Bags | Fisher Scientific | 6774010 | |
HistoGel Specimen Processing Gel | VWR | 83009-992 | |
Hematoxylin solution Premium | VWR | 95057-844 | |
Eosin Y (yellowish) solution Premium | VWR | 95057-848 | |
TBS Buffer, 20X, pH 7.4 | GenDEPORT | T8054 | 1X |
TBST (10X), pH 7.4 | GenDEPORT | T8056 | 1X |
Citric acid | Sigma Aldrich | C0759-1KG | |
Sodium citrate tribasic dihydrate | Sigma Aldrich | S4641-500G | |
Tween20 | Fisher Scientific | BP337-500Â | |
Bovine Serum Albumin (BSA) | Sigma Aldrich | A2153-100G | 3% |
DAPI Solution (1 mg/mL) | ThermoFisher | 62248 | 1:1000 dilution |
VECTASHIELD Antifade Mounting Medium | Vector Labs | H-1000-10 | |
Clear Nail Polish | Fisher Scientific | NC1849418 | |
Fisherbrand Superfrost Plus Microscope Slides | Fisher Scientific | 22037246 | |
VWR Micro Cover Glasses | VWR | 48393-106 | |
SuperScript VILO Master Mix | ThermoFisher | 11755050 | |
SYBR Green PCR Master Mix | ThermoFisher | 4364346 | |
Krt8 Antibody (TROMA-I)Â | DSHB | TROMA-IÂ | 1:50 dilution |
Vimentin Antobody | Cell Signaling | 5741S | 1:200 dilution |
Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | ThermoFisher | A-21209 | 1:250 dilution |
Donkey anti-Rabbin IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | ThermoFisher | A-21206 | 1:250 dilution |
ZEISS Stemi 508 Stereo Microscope | ZEISS | ||
ZEISS Axio Vert.A1 Inverted Routine Microscope with digital camera | ZEISS | ||
Primer Sequence | Forward (5'-3') | Reverse (5'-3') | _ |
Lipocalin 2 (Lcn2) | GCAGGTGGTACGTTGTGGG | CTCTTGTAGCTCATAGATGGTGC | |
Lactoferrin (Ltf) | TGAGGCCCTTGGACTCTGT | ACCCACTTTTCTCATCTCGTTC | |
Progesterone (Pgr) | CCCACAGGAGTTTGTCAAGCTC | TAACTTCAGACATCATTTCCGG | |
Glyceraldehyde 3 phosphate dehydrogenase (Gapdh) | CAATGTGTCCGTCGTGGATCT | GCCTGCTTCACCACCTTCTT |
This article has been published
Video Coming Soon
ABOUT JoVE
Copyright © 2024 MyJoVE Corporation. All rights reserved