Establishing 3D Endometrial Organoids from the Mouse Uterus

Summary

This protocol describes methodologies to establish mouse endometrial epithelial organoids for gene expression and histological analyses.

Abstract

Endometrial tissue lines the inner cavity of the uterus and is under the cyclical control of estrogen and progesterone. It is a tissue that is composed of luminal and glandular epithelium, a stromal compartment, a vascular network, and a complex immune cell population. Mouse models have been a powerful tool to study the endometrium, revealing critical mechanisms that control implantation, placentation, and cancer. The recent development of 3D endometrial organoid cultures presents a state-of-the-art model to dissect the signaling pathways that underlie endometrial biology. Establishing endometrial organoids from genetically engineered mouse models, analyzing their transcriptomes, and visualizing their morphology at a single-cell resolution are crucial tools for the study of endometrial diseases. This paper outlines methods to establish 3D cultures of endometrial epithelium from mice and describes techniques to quantify gene expression and analyze the histology of the organoids. The goal is to provide a resource that can be used to establish, culture, and study the gene expression and morphological characteristics of endometrial epithelial organoids.

Introduction

The endometrium - the inner lining mucosal tissue of the uterine cavity - is a unique and highly dynamic tissue that plays critical roles in a woman's reproductive health. During the reproductive lifespan, the endometrium holds the potential to undergo hundreds of cycles of proliferation, differentiation, and breakdown, coordinated by the concerted action of the ovarian hormones - estrogen and progesterone. Studies of genetically engineered mice have uncovered basic biological mechanisms underpinning the endometrial response to hormones and control of embryo implantation, stromal cell decidualization, and pregnancy¹. In vitro studi....

Protocol

Mouse handling and experimental studies were performed under protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Baylor College of Medicine and guidelines established by the NIH Guide for the Care and Use of Laboratory Animals.

1. Isolation of uterine epithelium from mice using enzymatic and mechanical methods

NOTE: This section describes the steps required to establish, passage, freeze, and thaw epithelial endometrial org.......

Discussion

Here, we describe methods to generate endometrial epithelial organoids from mouse endometrium and the protocols routinely used for their downstream analysis. Endometrial organoids are a powerful tool to study the mechanisms that control endometrial-related diseases, such as endometriosis, endometrial cancer, and implantation failure. Landmark studies published in 2017 reported the conditions to culture long-term and renewable cultures of endometrial organoids from mouse and human epithelium^4,.......

Materials

Name	Company	Catalog Number	Comments
Organoid Media Formulation
Name	Company	Catalog Number	Final concentration
Corning Matrigel Growth Factor Reduced (GFR) Basement Membrane Matrix, *LDEV-free	Corning	354230	100%
Trypsin from Bovine Pancreas	Sigma Aldrich	T1426-1G	1%
Advanced DMEM/F12	Life Technologies	12634010	1X
N2 supplement	Life Technologies	17502048	1X
B-27™ Supplement (50X), minus vitamin A	Life Technologies	12587010	1X
Primocin	Invivogen	ant-pm-1	100 µg/mL
N-Acetyl-L-cysteine	Sigma Aldrich	A9165-5G	1.25 mM
L-glutamine	Life Technologies	25030024	2 mM
Nicotinamide	Sigma Aldrich	N0636-100G	10 nM
ALK-4, -5, -7 inhibitor, A83-01	Tocris	2939	500 nM
Recombinant human EGF	Peprotech	AF-100-15	50 ng/mL
Recombinant human Noggin	Peprotech	120-10C	100 ng/mL
Recombinant human Rspondin-1	Peprotech	120-38	500 ng/mL
Recombinant human FGF-10	Peprotech	100-26	100 ng/mL
Recombinant human HGF	Peprotech	100-39	50 ng/mL
WNT3a	R&D systems	5036-WN	200 ng/mL
Other supplies and reagents
Name	Company	Catalog Number	Final concentration
Collagenase from Clostridium histolyticum	Sigma Aldrich	C0130-1G	5 mg/mL
Deoxyribonuclease I from bovine pancreas	Sigma Aldrich	DN25-100MG	2 mg/mL
DPBS, no calcium, no magnesium	ThermoFisher	14190-250	1X
HBSS, no calcium, no magnesium	ThermoFisher	14170112	1X
Falcon Polystyrene Microplates (24-Well)	Fisher Scientific	#08-772-51
Falcon Polystyrene Microplates (12-Well)	Fisher Scientific	#0877229
Falcon Cell Strainers, 40 µm	Fisher Scientific	#08-771-1
Direct-zol RNA MiniPrep (50 µg)	Genesee Scientific	11-331
Trizol reagent	Invitrogen	15596026
DMEM/F-12, HEPES, no phenol red	ThermoFisher	11039021
Fetal Bovine Serum, Charcoal stripped	Sigma Aldrich	F6765-500ML	2%
Estratiol (E2)	Sigma Aldrich	E1024-1G	10 nM
Formaldehyde 16% in aqueous solution, EM Grade	VWR	15710	4%
Epredia Cassette 1 Slotted Tissue Cassettes	Fisher Scientific	1000961
Epredia Stainless-Steel Embedding Base Molds	Fisher Scientific	64-010-15
Ethanol, 200 proof (100%)	Fisher Scientific	22-032-601
Histoclear	Fisher Scientific	50-899-90147
Permount Mounting Medium	Fisher Scientific	50-277-97
Epredia Nylon Biopsy Bags	Fisher Scientific	6774010
HistoGel Specimen Processing Gel	VWR	83009-992
Hematoxylin solution Premium	VWR	95057-844
Eosin Y (yellowish) solution Premium	VWR	95057-848
TBS Buffer, 20X, pH 7.4	GenDEPORT	T8054	1X
TBST (10X), pH 7.4	GenDEPORT	T8056	1X
Citric acid	Sigma Aldrich	C0759-1KG
Sodium citrate tribasic dihydrate	Sigma Aldrich	S4641-500G
Tween20	Fisher Scientific	BP337-500
Bovine Serum Albumin (BSA)	Sigma Aldrich	A2153-100G	3%
DAPI Solution (1 mg/mL)	ThermoFisher	62248	1:1000 dilution
VECTASHIELD Antifade Mounting Medium	Vector Labs	H-1000-10
Clear Nail Polish	Fisher Scientific	NC1849418
Fisherbrand Superfrost Plus Microscope Slides	Fisher Scientific	22037246
VWR Micro Cover Glasses	VWR	48393-106
SuperScript VILO Master Mix	ThermoFisher	11755050
SYBR Green PCR Master Mix	ThermoFisher	4364346
Krt8 Antibody (TROMA-I)	DSHB	TROMA-I	1:50 dilution
Vimentin Antobody	Cell Signaling	5741S	1:200 dilution
Donkey anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594	ThermoFisher	A-21209	1:250 dilution
Donkey anti-Rabbin IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	ThermoFisher	A-21206	1:250 dilution
ZEISS Stemi 508 Stereo Microscope	ZEISS
ZEISS Axio Vert.A1 Inverted Routine Microscope with digital camera	ZEISS
Primer Sequence	Forward (5'-3')	Reverse (5'-3')	_
Lipocalin 2 (Lcn2)	GCAGGTGGTACGTTGTGGG	CTCTTGTAGCTCATAGATGGTGC
Lactoferrin (Ltf)	TGAGGCCCTTGGACTCTGT	ACCCACTTTTCTCATCTCGTTC
Progesterone (Pgr)	CCCACAGGAGTTTGTCAAGCTC	TAACTTCAGACATCATTTCCGG
Glyceraldehyde 3 phosphate dehydrogenase (Gapdh)	CAATGTGTCCGTCGTGGATCT	GCCTGCTTCACCACCTTCTT