Screening Sperm for the Rapid Isolation of Germline Edits in Zebrafish

Summary

CRISPR-Cas technologies have revolutionized the field of genome editing. However, finding and isolating the desired germline edit remains a major bottleneck. Therefore, this protocol describes a robust method for quickly screening F0 CRISPR-injected zebrafish sperm for germline edits using standard PCR, restriction digest, and gel electrophoresis techniques.

Abstract

The advent of targeted CRISPR-Cas nuclease technologies has revolutionized the ability to perform precise genome editing in both established and emerging model systems. CRISPR-Cas genome editing systems use a synthetic guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to specific genomic DNA loci, where the Cas endonuclease generates a double-strand break. The repair of double-strand breaks by intrinsic error-prone mechanisms leads to insertions and/or deletions, disrupting the locus. Alternatively, the inclusion of double-stranded DNA donors or single-stranded DNA oligonucleotides in this process can elicit the inclusion of precise genome edits ranging from single nucleotide polymorphisms to small immunological tags or even large fluorescent protein constructs. However, a major bottleneck in this procedure can be finding and isolating the desired edit in the germline. This protocol outlines a robust method for screening and isolating germline mutations at specific loci in Danio rerio (zebrafish); however, these principles may be adaptable in any model where in vivo sperm collection is possible.

Introduction

The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas system is a powerful tool to perform loci-specific mutagenesis and precise genome editing in the Danio rerio (zebrafish) model system^1,2,3,4. The Cas-ribonucleoprotein (RNP) is comprised of two main components: a Cas endonuclease (commonly Cas9 or Cas12a) and a locus-specific synthetic guide RNA (sgRNA)⁵. Together, the Cas-RNP generates a double-stranded break (DSB) in the desired locus that can be repaired by one of two intrinsic repa....

Protocol

This study was carried out in line with the guidelines in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the University of Texas at Austin Animal Care and Use Committee (AUP-2021-00254).

1. Designing the sgRNA for CRISPR mutagenesis

1. Obtain the exon sequence containing the targeted loci.
2. Design a synthetic guide RNA (sgRNA) with a protospacer adjacent motif (PAM) site that is specific.......

Discussion

This protocol describes a method for rapidly characterizing putative genome edits or targeted mutations using CRISPR-Cas technology by focused analysis on F0 male sperm genomes. This protocol should be amenable to other animal models where sperm is readily available for sampling without euthanasia. This method will increase the throughput of screening for desired edits and is especially useful for identifying rare HDR-mediated knock-in events. This approach also serves to reduce the number of experimental animals used to.......

Materials

Name	Company	Catalog Number	Comments
Agarose powder	Fisher BioReagents	BP1356-100
Breeding tanks	Carolina Biological	161937
BstNI Restriction Enzyme	NEB	R0168S
Cas9 Endonuclease	IDT	1081060
DNA Ladder, 100 bp	Thermo Scientific	FERSM0241
dnah10 donor construct	Sigma-Aldrich	DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry. Phosphorothioate bond on the donor at the first three phosphate bonds on both the 5’ and 3’ ends (5'-CCTCTCTCCCTTTCAGAAGCTTC TGCTCATCCGCTGCTTCTGCCT GGACCGAGTGTACCGTGCCGTC AGTGATTACGTCACGC-3')
dnah10 forward primer	Sigma-Aldrich	DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (5'-CATGGAACTCTTTCCTAATGAGT TTGGC-3')
dnah10 reverse primer	Sigma-Aldrich	DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry ('5-AGTAGAGATCACACATCAACAGA ATACAGC-3')
dnah10 synthetic sgRNA	Synthego	Synthetic sgRNA, target sequence: 5'-GCTCATCCGCTGCTTCAGGC-3'
Electrophoresis power supply	Thermo Scientific	105ECA-115
Filter forceps	Millipore	XX6200006P
Fish (system) water	Generic	n/a
Gel electrophoresis system (including casting frame, comb, and electrophoresis chamber)	Thermo Scientific	B2
Gel imaging light box	Azure Biosystems	AZI200-01
Gel stain, 10000X	Invitrogen	S33102
Glass bowl, 250 mL	Generic	n/a
Isolation tanks, 0.8 L	Aquaneering	ZT080
Microcap capillary tube with bulb, 20 µL	Drummond	1-000-0020/CA
Minicentrifuge	Bio-Rad	12011919EDU
Micropipettes, various with appropriate tips	Generic	n/a
Microwave	Generic	n/a
Nuclease free water	Promega	P119-C
Paper towels	Generic	n/a
PCR tubes, 0.2 mL	Bioexpress	T-3196-1
Plastic spoon, with drilled holes/slots	Generic	n/a
KCl solution, 0.2 M RNAse Free	Sigma-Aldrich	P9333
p2ry12 forward primer	Sigma-Aldrich	DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (5'-CCCAAATGTAATCCTGACCAGT -3')
p2ry12 reverse primer	Sigma-Aldrich	DNA Oligo in Tube; 0.025 nM, standard desalt purification, dry (5'-CCAGGAACACATTAACCTGGAT -3')
p2ry12 synthetic sgRNA	Synthego	Synthetic sgRNA, target sequence: 5'-GGCCGCACGAGGTCTCCGCG-3'
Restriction Enzyme 10X Buffer	NEB	B6003SVIAL
NaOH solution, 50 mM	Thermo Scientific	S318; 424330010
Sponge, 1-inch x 1-inch cut with small oval divot	Generic	n/a
Stereomicroscope	Zeiss	Stemi 508
Taq polymerase master mix, 2X	Promega	M7122
TBE Buffer Concentrate, 10X	VWR	E442
Thermal Cycler	Bio-Rad	1861096
Tissue paper	Fisher Scientific	06-666
Tricaine-methanesulfonate solution (Syncaine, MS-222), 0.016% in fish water (pH 7.0±0.2)	Syndel	200-266
Tris Base, 1M (Buffered with HCl to ph 8.0)	Promega	H5131