Gene Expression Analyses in Human Follicles

Summary

Here, we describe a protocol outlining how to isolate human ovarian follicles from frozen-thawed cortical tissue to perform gene expression analyses.

Abstract

The ovary is a heterogeneous organ composed of different cell types. To study the molecular mechanisms occurring during folliculogenesis, the localization of proteins and gene expression can be performed on fixed tissue. However, to properly assess gene expression levels in a human follicle, this complex and delicate structure must be isolated. Hence, an adapted protocol previously described by Woodruff's laboratory has been developed to separate follicles (the oocyte and the granulosa cells) from their surrounding environment. The ovarian cortical tissue is first manually processed to obtain small fragments using two tools: a tissue slicer and a tissue chopper. The tissue is then enzymatically digested with 0.2% collagenase and 0.02% DNase for at least 40 min. This digestion step is performed at 37 °C and 5% CO₂ and is accompanied by mechanical pipetting of the medium every 10 min. After incubation, the isolated follicles are collected manually using a calibrated microcapillary pipette under microscope magnification. If follicles are still present in the pieces of tissue, the procedure is completed with manual microdissection. The follicles are collected on ice in a culture medium and are rinsed twice in droplets of phosphate-buffered saline solution. This digestion procedure must be carefully controlled to avoid follicle deterioration. As soon as the structure of the follicles appears to be compromised or after a maximum of 90 min, the reaction is stopped with a 4 °C blocking solution containing 10% fetal bovine serum. A minimum of 20 isolated follicles (sized under 75 µm) should be collected to obtain an adequate amount of total RNA after RNA extraction for real-time quantitative polymerase chain reaction (RT-qPCR). After extraction, the quantification of total RNA from 20 follicles reaches a mean value of 5 ng/µL. The total RNA is then retrotranscribed into cDNA, and the genes of interest are further analyzed using RT-qPCR.

Introduction

The ovary is a complex organ composed of functional and structural units, including the follicles within the cortex and the stroma. Folliculogenesis, the process of follicle activation, growth, and maturation from a primordial quiescent state to a mature follicle able to be fertilized and to support early embryonic development, is widely studied in research¹. Unraveling the mechanisms driving this phenomenon could improve fertility care for women². Analyses on fixed human tissue allow the assessment of protein expression and gene localization within the functional units of the ovary^3,

Protocol

This project was approved by the Erasme Hospital Ethical Committee (Brussels, Belgium). The patient included in this protocol underwent ovarian tissue cryopreservation (OTC) for fertility preservation before chemotherapy exposure in 2000. The patient signed informed written consent to donate her residual frozen tissue to research at the end of the storage period.

1. Thawing of cryopreserved ovarian tissue

1. Prepare a 6-well plate containing five thawing solutions. Th.......

Discussion

The cryopreservation of ovarian tissue is a promising approach for preserving the fertility of cancer patients. In the clinic, thawed cortical tissue is grafted back into the patient after remission, allowing the resumption of ovarian function and fertility^19,20. Besides clinical use, residual ovarian fragments may also be donated for research at the end of the storage period to study the mechanisms regulating folliculogenesis. Moreover, this tissue is particular.......

Materials

Name	Company	Catalog Number	Comments
2 mm gridded Petri dish	Corning	430196
2100 Bioanalyzer instrument	Agilent	G2939BA
2100 Expert software	Agilent	version B.02.08.SI648
4-wells plate	Sigma Aldrich	D6789
6-wells plate	Carl Roth	EKX5.1
Agilent total RNA 6000 pico kit	Agilent	5067-1513
Ascorbic acid	Sigma Aldrich	A4403
Aspirator tube assemblies for microcapillary pipettes	Sigma Aldrich	A5177
Centrifuge	Eppendorf	5424R
Collagenase IV	LifeTechnologies	17104-019
DMSO	Sigma Aldrich	D2650
DNase	Sigma Aldrich	D4527-10kU
FBS	Gibco	10270-106
GoScript reverse transcriptase	Promega	A5003
HSA	CAF DCF	LC4403-41-080
Leibovitz-15	LifeTechnologies	11415-049
L-Glutamine	Sigma Aldrich	G7513
McCoy’s 5A + bicarbonate + Hepes	LifeTechnologies	12330-031
McIlwain tissue chopper	Stoelting	51350
Microcapillary RI EZ-Tips 200 µm	CooperSurgical	7-72-2200/1
Microcapillary RI EZ-Tips 75 µm	CooperSurgical	7-72-2075/1
NanoDrop 2000/2000c operating software	ThermoFisher	version 1.6
NanoDrop spectrophotometer	ThermoFisher	2000/2000c
Penicillin G	Sigma Aldrich	P3032
PowerTrack SYBR green master mix	ThermoFisher	A46109
Primers: GDF9			F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG
Primers: HPRT			F: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA
Primers: Kit Ligand			F: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT
Real-Time qPCR Quantstudio 3	ThermoFisher	A33779
RNAqueous-micro total RNA isolation kit	ThermoFisher	AM1931
Selenium	Sigma Aldrich	S9133
Sodium pyruvate	Sigma Aldrich	S8636
Stereomicroscope	Nikon	SMZ800
Streptomycine sulfate	Sigma Aldrich	S1277
Sucrose	Sigma Aldrich	S1888
Thermo Scientific Forma Series II  water-jacketed CO2 incubators	ThermoFisher	3110
Thomas Stadie-Riggs tissue slicer	Thomas Scientific	6727C10
Transferrin	Roche	10652202001