A subscription to JoVE is required to view this content. Sign in or start your free trial.
Here, we describe a protocol outlining how to isolate human ovarian follicles from frozen-thawed cortical tissue to perform gene expression analyses.
The ovary is a heterogeneous organ composed of different cell types. To study the molecular mechanisms occurring during folliculogenesis, the localization of proteins and gene expression can be performed on fixed tissue. However, to properly assess gene expression levels in a human follicle, this complex and delicate structure must be isolated. Hence, an adapted protocol previously described by Woodruff's laboratory has been developed to separate follicles (the oocyte and the granulosa cells) from their surrounding environment. The ovarian cortical tissue is first manually processed to obtain small fragments using two tools: a tissue slicer and a tissue chopper. The tissue is then enzymatically digested with 0.2% collagenase and 0.02% DNase for at least 40 min. This digestion step is performed at 37 °C and 5% CO2 and is accompanied by mechanical pipetting of the medium every 10 min. After incubation, the isolated follicles are collected manually using a calibrated microcapillary pipette under microscope magnification. If follicles are still present in the pieces of tissue, the procedure is completed with manual microdissection. The follicles are collected on ice in a culture medium and are rinsed twice in droplets of phosphate-buffered saline solution. This digestion procedure must be carefully controlled to avoid follicle deterioration. As soon as the structure of the follicles appears to be compromised or after a maximum of 90 min, the reaction is stopped with a 4 °C blocking solution containing 10% fetal bovine serum. A minimum of 20 isolated follicles (sized under 75 µm) should be collected to obtain an adequate amount of total RNA after RNA extraction for real-time quantitative polymerase chain reaction (RT-qPCR). After extraction, the quantification of total RNA from 20 follicles reaches a mean value of 5 ng/µL. The total RNA is then retrotranscribed into cDNA, and the genes of interest are further analyzed using RT-qPCR.
The ovary is a complex organ composed of functional and structural units, including the follicles within the cortex and the stroma. Folliculogenesis, the process of follicle activation, growth, and maturation from a primordial quiescent state to a mature follicle able to be fertilized and to support early embryonic development, is widely studied in research1. Unraveling the mechanisms driving this phenomenon could improve fertility care for women2. Analyses on fixed human tissue allow the assessment of protein expression and gene localization within the functional units of the ovary3,
This project was approved by the Erasme Hospital Ethical Committee (Brussels, Belgium). The patient included in this protocol underwent ovarian tissue cryopreservation (OTC) for fertility preservation before chemotherapy exposure in 2000. The patient signed informed written consent to donate her residual frozen tissue to research at the end of the storage period.
1. Thawing of cryopreserved ovarian tissue
Using this isolation procedure, the experimenter can retrieve follicles from the stromal environment to perform specific gene expression analyses. Based on the size and morphology of the follicles, it is possible to differentiate the different stages of folliculogenesis. The experimenter can select follicles of interest according to their size using an adapted microcapillary pipette. By using a microcapillary of maximum 75 µm, it is possible to discriminate primordial and primary follicles from secondary, antral, an.......
The cryopreservation of ovarian tissue is a promising approach for preserving the fertility of cancer patients. In the clinic, thawed cortical tissue is grafted back into the patient after remission, allowing the resumption of ovarian function and fertility19,20. Besides clinical use, residual ovarian fragments may also be donated for research at the end of the storage period to study the mechanisms regulating folliculogenesis. Moreover, this tissue is particular.......
The authors declare no competing interests.
This work was supported by an Excellence of Science (EOS) grant (ID: 30443682). I.D. is an associate researcher at Fonds National de la Recherche Scientifique de Belgique (FNRS).
....Name | Company | Catalog Number | Comments |
2 mm gridded Petri dish | Corning | 430196 | |
2100 Bioanalyzer instrument | Agilent | G2939BA | |
2100 Expert software | Agilent | version B.02.08.SI648 | |
4-wells plate | Sigma Aldrich | D6789 | |
6-wells plate | Carl Roth | EKX5.1 | |
Agilent total RNA 6000 pico kit | Agilent | 5067-1513 | |
Ascorbic acid | Sigma Aldrich | A4403 | |
Aspirator tube assemblies for microcapillary pipettes | Sigma Aldrich | A5177 | |
Centrifuge | Eppendorf | 5424R | |
Collagenase IV | LifeTechnologies | 17104-019 | |
DMSO | Sigma Aldrich | D2650 | |
DNase | Sigma Aldrich | D4527-10kU | |
FBS | Gibco | 10270-106 | |
GoScript reverse transcriptase | Promega | A5003 | |
HSA | CAF DCF | LC4403-41-080 | |
Leibovitz-15 | LifeTechnologies | 11415-049 | |
L-Glutamine | Sigma Aldrich | G7513 | |
McCoy’s 5A + bicarbonate + Hepes | LifeTechnologies | 12330-031 | |
McIlwain tissue chopper | Stoelting | 51350 | |
Microcapillary RI EZ-Tips 200 µm | CooperSurgical | 7-72-2200/1 | |
Microcapillary RI EZ-Tips 75 µm | CooperSurgical | 7-72-2075/1 | |
NanoDrop 2000/2000c operating software | ThermoFisher | version 1.6 | |
NanoDrop spectrophotometer | ThermoFisher | 2000/2000c | |
Penicillin G | Sigma Aldrich | P3032 | |
PowerTrack SYBR green master mix | ThermoFisher | A46109 | |
Primers: GDF9 | F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG | ||
Primers: HPRT | F: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA | ||
Primers: Kit Ligand | F: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT | ||
Real-Time qPCR Quantstudio 3 | ThermoFisher | A33779 | |
RNAqueous-micro total RNA isolation kit | ThermoFisher | AM1931 | |
Selenium | Sigma Aldrich | S9133 | |
Sodium pyruvate | Sigma Aldrich | S8636 | |
Stereomicroscope | Nikon | SMZ800 | |
Streptomycine sulfate | Sigma Aldrich | S1277 | |
Sucrose | Sigma Aldrich | S1888 | |
Thermo Scientific Forma Series II water-jacketed CO2 incubators | ThermoFisher | 3110 | |
Thomas Stadie-Riggs tissue slicer | Thomas Scientific | 6727C10 | |
Transferrin | Roche | 10652202001 |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved