A subscription to JoVE is required to view this content. Sign in or start your free trial.

In This Article

  • Summary
  • Abstract
  • Introduction
  • Protocol
  • Results
  • Discussion
  • Disclosures
  • Acknowledgements
  • Materials
  • References
  • Reprints and Permissions

Summary

Here, we describe a protocol outlining how to isolate human ovarian follicles from frozen-thawed cortical tissue to perform gene expression analyses.

Abstract

The ovary is a heterogeneous organ composed of different cell types. To study the molecular mechanisms occurring during folliculogenesis, the localization of proteins and gene expression can be performed on fixed tissue. However, to properly assess gene expression levels in a human follicle, this complex and delicate structure must be isolated. Hence, an adapted protocol previously described by Woodruff's laboratory has been developed to separate follicles (the oocyte and the granulosa cells) from their surrounding environment. The ovarian cortical tissue is first manually processed to obtain small fragments using two tools: a tissue slicer and a tissue chopper. The tissue is then enzymatically digested with 0.2% collagenase and 0.02% DNase for at least 40 min. This digestion step is performed at 37 °C and 5% CO2 and is accompanied by mechanical pipetting of the medium every 10 min. After incubation, the isolated follicles are collected manually using a calibrated microcapillary pipette under microscope magnification. If follicles are still present in the pieces of tissue, the procedure is completed with manual microdissection. The follicles are collected on ice in a culture medium and are rinsed twice in droplets of phosphate-buffered saline solution. This digestion procedure must be carefully controlled to avoid follicle deterioration. As soon as the structure of the follicles appears to be compromised or after a maximum of 90 min, the reaction is stopped with a 4 °C blocking solution containing 10% fetal bovine serum. A minimum of 20 isolated follicles (sized under 75 µm) should be collected to obtain an adequate amount of total RNA after RNA extraction for real-time quantitative polymerase chain reaction (RT-qPCR). After extraction, the quantification of total RNA from 20 follicles reaches a mean value of 5 ng/µL. The total RNA is then retrotranscribed into cDNA, and the genes of interest are further analyzed using RT-qPCR.

Introduction

The ovary is a complex organ composed of functional and structural units, including the follicles within the cortex and the stroma. Folliculogenesis, the process of follicle activation, growth, and maturation from a primordial quiescent state to a mature follicle able to be fertilized and to support early embryonic development, is widely studied in research1. Unraveling the mechanisms driving this phenomenon could improve fertility care for women2. Analyses on fixed human tissue allow the assessment of protein expression and gene localization within the functional units of the ovary3,

Protocol

This project was approved by the Erasme Hospital Ethical Committee (Brussels, Belgium). The patient included in this protocol underwent ovarian tissue cryopreservation (OTC) for fertility preservation before chemotherapy exposure in 2000. The patient signed informed written consent to donate her residual frozen tissue to research at the end of the storage period.

1. Thawing of cryopreserved ovarian tissue

  1. Prepare a 6-well plate containing five thawing solutions. The first well contains 5 mL of cryoprotectant solution composed of Leibovitz-15 medium, 0.1 mol/L sucrose, 1.5 mol/L dimethyl sulfoxide (DMSO), and 1% ....

Results

Using this isolation procedure, the experimenter can retrieve follicles from the stromal environment to perform specific gene expression analyses. Based on the size and morphology of the follicles, it is possible to differentiate the different stages of folliculogenesis. The experimenter can select follicles of interest according to their size using an adapted microcapillary pipette. By using a microcapillary of maximum 75 µm, it is possible to discriminate primordial and primary follicles from secondary, antral, an.......

Discussion

The cryopreservation of ovarian tissue is a promising approach for preserving the fertility of cancer patients. In the clinic, thawed cortical tissue is grafted back into the patient after remission, allowing the resumption of ovarian function and fertility19,20. Besides clinical use, residual ovarian fragments may also be donated for research at the end of the storage period to study the mechanisms regulating folliculogenesis. Moreover, this tissue is particular.......

Disclosures

The authors declare no competing interests.

Acknowledgements

This work was supported by an Excellence of Science (EOS) grant (ID: 30443682). I.D. is an associate researcher at Fonds National de la Recherche Scientifique de Belgique (FNRS).

....

Materials

NameCompanyCatalog NumberComments
2 mm gridded Petri dishCorning430196
2100 Bioanalyzer instrumentAgilentG2939BA
2100 Expert softwareAgilentversion B.02.08.SI648
4-wells plateSigma AldrichD6789
6-wells plateCarl Roth EKX5.1
Agilent total RNA 6000 pico kitAgilent5067-1513
Ascorbic acidSigma AldrichA4403
Aspirator tube assemblies for microcapillary pipettesSigma AldrichA5177
CentrifugeEppendorf5424R
Collagenase IVLifeTechnologies17104-019
DMSOSigma AldrichD2650
DNaseSigma AldrichD4527-10kU
FBSGibco10270-106
GoScript reverse transcriptasePromegaA5003
HSACAF DCF LC4403-41-080
Leibovitz-15LifeTechnologies11415-049
L-GlutamineSigma AldrichG7513
McCoy’s 5A + bicarbonate + HepesLifeTechnologies12330-031
McIlwain tissue chopperStoelting51350
Microcapillary RI EZ-Tips 200 µmCooperSurgical7-72-2200/1
Microcapillary RI EZ-Tips 75 µmCooperSurgical7-72-2075/1
NanoDrop 2000/2000c operating softwareThermoFisherversion 1.6
NanoDrop spectrophotometerThermoFisher2000/2000c
Penicillin GSigma AldrichP3032
PowerTrack SYBR green master mixThermoFisherA46109
Primers: GDF9F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG
Primers: HPRTF: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA
Primers: Kit LigandF: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT
Real-Time qPCR Quantstudio 3ThermoFisherA33779
RNAqueous-micro total RNA isolation kitThermoFisherAM1931
SeleniumSigma AldrichS9133
Sodium pyruvateSigma AldrichS8636
StereomicroscopeNikonSMZ800
Streptomycine sulfateSigma AldrichS1277
SucroseSigma AldrichS1888
Thermo Scientific Forma Series II  water-jacketed CO2 incubatorsThermoFisher3110
Thomas Stadie-Riggs tissue slicerThomas Scientific6727C10
TransferrinRoche 10652202001

References

  1. Gougeon, A. Human ovarian follicular development: From activation of resting follicles to preovulatory maturation. Annales d'Endocrinologie. 71 (3), 132-143 (2010).
  2. Yang, D. Z., Yang, W., Li, Y., He, Z.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Explore More Articles

Gene ExpressionOvarian FolliclesStroma CellsIsolation TechniqueMechanical IsolationEnzymatic IsolationCryoprotectant SolutionLeibovitz 15 MediumTissue DissectionFollicle IsolationGerm CellsOvarian FunctionToxic AgentsDigestion MediumIncubator Protocol

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2025 MyJoVE Corporation. All rights reserved