JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Biochemistry

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

Published: May 5th, 2023

DOI:

10.3791/65236

1Faculty of Biology, Institute of Genetics and Biotechnology, University of Warsaw, 2Institute of Biochemistry and Biophysics, Polish Academy of Sciences, 3International Institute of Molecular and Cell Biology in Warsaw

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Preparation of the siRNA mixture

  1. One day before the start of the experiment, seed cells (e.g., HeLa) on a 100 mm dish so that they reach 70%-90% confluence the next day.
    NOTE: All operations must be carried out under sterile conditions in a laminar flow chamber.
  2. Prepare the appropriate amount of siRNA diluted to a concentration of 140 nM in Opti-MEM medium (see Table of Materials). A 96-well plate can be used as a reservoir.
  3. Add 5 µL of the .......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

A scheme of the procedure for the high-throughput study of the dynamics of mtDNA synthesis and distribution is shown in Figure 1. The use of a multi-well plate format enables the simultaneous analysis of many different experimental conditions, such as the silencing of different genes using a siRNA library. The conditions used for the labeling of newly synthesized DNA molecules with BrdU allow for the detection of BrdU-labeled DNA in the mitochondria of HeLa cells (Figure.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Historically, DNA labeling by BrdU incorporation and antibody detection has been used in nuclear DNA replication and cell cycle research14,27,28. So far, all the protocols for detecting BrdU-labeled DNA have included a DNA denaturation step (acidic or thermal) or enzyme digestion (DNase or proteinase) to enable epitope exposure and facilitate antibody penetration. These protocols were developed for tightly packed nuclear DNA. Ho.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This work was supported by the National Science Centre, Poland (Grant/Award Number: 2018/31/D/NZ2/03901).

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

NameCompanyCatalog NumberComments
2′,3′-Dideoxycytidine (ddC)Sigma-AldrichD5782
384  Well Cell Culture Microplates, blackGreiner Bio-One#781946
5-Bromo-2′-deoxyuridine (BrdU)Sigma-AldrichB5002-1GDissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 µM BrdU solution for labeling.
Adhesive sealing filmNerbe Plus04-095-0060
Alexa Fluor 488 goat anti-mouse IgG1 secondary antibodyThermo Fisher ScientificA-21121
Alexa Fluor 555 goat anti-mouse IgM secondary antibodyThermo Fisher ScientificA-21426
BioTek 405 LS microplate washerAgilent
Bovine Serum Albumin (BSA)Sigma-AldrichA4503
Cell counting chamber ThomaHeinz HerenzREF:1080339
Dulbecco's Modified Eagle Medium (DMEM)CytivaSH30243.01
Dulbecco's Modified Eagle Medium (DMEM)Thermo Fisher Scientific41965-062
Fetal Bovine Serum (FBS)Thermo Fisher Scientific10270-106
Formaldehyde solutionSigma-AldrichF1635Formaldehyde is toxic; please read the safety data sheet carefully.
Hoechst 33342Thermo Fisher ScientificH3570
IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibodySanta Cruz Biotechnologysc-32323
IgM mouse monoclonal anti-DNA (AC-30-10) primary antibodyProgen#61014
LightCycler 480 SystemRoche
Lipofectamine RNAiMAX Transfection ReagentThermo Fisher Scientific#13778150
MitoTracker Deep Red FMThermo Fisher ScientificM22426Mitochondria tracking dye 
Multidrop Combi Reagent DispenserThermo Fisher Scientific
Opti-MEMThermo Fisher Scientific51985-042
Orca-R2 (C10600) CCD CameraHamamatsu
Penicillin-Streptomycin Sigma-AldrichP0781-100ML
Phosphate buffered saline (PBS)Sigma-AldrichP4417-100TAB
PowerUp SYBR Green Master MixThermo Fisher ScientificA25742
qPCR primer Fw B2M (reference)CAGGTACTCCAAAGATTCAGG 
qPCR primer Fw GPI (reference gene)GACCTTTACTACCCAGGAGA
qPCR primer Fw MT-ND1 TAGCAGAGACCAACCGAACC 
qPCR primer Fw POLGTGGAAGGCAGGCATGGTCAAACC
qPCR primer Fw TFAMGATGAGTTCTGCCTGCTTTAT
qPCR primer Fw TWNKGCCATGTGACACTGGTCATT
qPCR primer Rev B2M (reference)GTCAACTTCAATGTCGGATGG 
qPCR primer Rev GPI (reference gene)AGTAGACAGGGCAACAAAGT
qPCR primer Rev MT-ND1 ATGAAGAATAGGGCGAAGGG 
qPCR primer Rev POLGGGAGTCAGAACACCTGGCTTTGG
qPCR primer Rev TFAMGGACTTCTGCCAGCATAATA
qPCR primer Rev TWNKAACATTGTCTGCTTCCTGGC
ScanR microscopeOlympus
siRNA CtrlDharmaconD-001810-10-5
siRNA POLGInvitrogenPOLGHSS108223
siRNA TFAMInvitrogenTFAMHSS144252
siRNA TWNKInvitrogenC10orf2HSS125597
Suction deviceNeoLab2-9335Suction device for cell culture
Triton X-100Sigma-AldrichT9284-500ML
TrypsinBiowestL0931-500
UPlanSApo 20x 0.75 NA objectiveOlympus

  1. Brown, G. C. Control of respiration and ATP synthesis in mammalian mitochondria and cells. The Biochemical Journal. 284, 1-13 (1992).
  2. Zhang, L., et al. Biochemical basis and metabolic interplay of redox regulation). Redox Biology. 26, 101284 (2019).
  3. Pizzo, P., Drago, I., Filadi, R., Pozzan, T. Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities. Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).
  4. Shadel, G. S., Horvath, T. L. Mitochondrial ROS signaling in organismal homeostasis. Cell. 163 (3), 560-569 (2015).
  5. Martínez-Reyes, I., Chandel, N. S. Mitochondrial TCA cycle metabolites control physiology and disease. Nature Communications. 11 (1), 102 (2020).
  6. Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. Mitochondrial control of cellular life, stress, and death. Circulation Research. 111 (9), 1198-1207 (2012).
  7. Rone, M. B., Fan, J., Papadopoulos, V. Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states. Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).
  8. Swenson, S. A., et al. From synthesis to utilization: The ins and outs of mitochondrial heme. Cells. 9 (3), 579 (2020).
  9. West, A. P., Shadel, G. S., Ghosh, S. Mitochondria in innate immune responses. Nature Reviews. Immunology. 11 (6), 389-402 (2011).
  10. Nunnari, J., Suomalainen, A. Mitochondria: In sickness and in health. Cell. 148 (6), 1145-1159 (2012).
  11. Pohjoismäki, J. L. O., Goffart, S. Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA. BioEssays. 33 (4), 290-299 (2011).
  12. Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. Maintenance and expression of mammalian mitochondrial DNA. Annual Review of Biochemistry. 85, 133-160 (2016).
  13. Nicholls, T. J., Gustafsson, C. M. Separating and segregating the human mitochondrial genome. Trends in Biochemical Sciences. 43 (11), 869-881 (2018).
  14. Gratzner, H. G. Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication. Science. 218 (4571), 474-475 (1982).
  15. Stirling, D. R., et al. CellProfiler 4: Improvements in speed, utility and usability. BMC Bioinformatics. 22 (1), 433 (2021).
  16. R Core Team. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing. , (2021).
  17. . dplyr: A Grammar of Data Manipulation Available from: https://CRAN.R-project.org/package=dplyr (2021)
  18. . data.table: Extension of `data.frame Available from: https://CRAN.R-project.org/package=data.table (2020)
  19. . ggplot2: Elegant graphics for data analysis Available from: https://ggplot2.tidyverse.org (2016)
  20. . ggpubr: "ggplot2" based publication ready plots Available from: https://CRAN.R-project.org/package=ggpubr (2020)
  21. Hashiguchi, K., Zhang-Akiyama, Q. -. M. Establishment of human cell lines lacking mitochondrial DNA. Methods in Molecular Biology. 554, 383-391 (2009).
  22. Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression. Acta Biochimica Polonica. 53 (3), 485-495 (2006).
  23. Spelbrink, J. N., et al. Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria. Nature Genetics. 28 (3), 223-231 (2001).
  24. Campbell, C. T., Kolesar, J. E., Kaufman, B. A. Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number. Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).
  25. Krasich, R., Copeland, W. C. DNA polymerases in the mitochondria: A critical review of the evidence. Frontiers in Bioscience. 22 (4), 692-709 (2017).
  26. Kotrys, A. V., et al. Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria. Nucleic Acids Research. 47 (14), 7502-7517 (2019).
  27. Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques. Journal of Histochemistry & Cytochemistry. 24 (1), 34-39 (1976).
  28. Leif, R. C., Stein, J. H., Zucker, R. M. A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase. Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).
  29. Lentz, S. I., et al. Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro. The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).
  30. Liu, Y., et al. Multi-omic measurements of heterogeneity in HeLa cells across laboratories. Nature Biotechnology. 37 (3), 314-322 (2019).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved