تم دعم هذا العمل من قبل المركز الوطني للعلوم ، بولندا (رقم المنحة / الجائزة: 2018/31 / D / NZ2 / 03901).

1. تحضير خليط siRNA
<ol><li>قبل يوم واحد من بدء التجربة ، خلايا البذور (على سبيل المثال ، HeLa) على طبق 100 مم بحيث تصل إلى التقاء 70٪ -90٪ في اليوم التالي. ملاحظة: يجب إجراء جميع العمليات في ظل ظروف معقمة في غرفة التدفق الصفحي.</li>
	<li>تحضير الكمية المناسبة من siRNA المخفف إلى تركيز 140 نانومتر في وس?...

القياس الكمي عالي الإنتاجية لتوليف وتوزيع mtDNA

<ol>
	<li>Brown, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+respiration+and+ATP+synthesis+in+mammalian+mitochondria+and+cells.">Control of respiration and ATP synthesis in mammalian mitochondria and cells.</a> The Biochemical Journal. 284, 1-13 (1992).</li><li>Zhang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+basis+and+metabolic+interplay+of+redox+regulation).">Biochemical basis and metabolic interplay of redox regulation).</a> Redox Biology. 26, 101284 (2019).</li><li>Pizzo, P., Drago, I., Filadi, R., Pozzan, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Ca2++homeostasis:+Mechanism,+role,+and+tissue+specificities.">Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities.</a> Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).</li><li>Shadel, G. S., Horvath, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+ROS+signaling+in+organismal+homeostasis.">Mitochondrial ROS signaling in organismal homeostasis.</a> Cell. 163 (3), 560-569 (2015).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+TCA+cycle+metabolites+control+physiology+and+disease.">Mitochondrial TCA cycle metabolites control physiology and disease.</a> Nature Communications. 11 (1), 102 (2020).</li><li>Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+control+of+cellular+life,+stress,+and+death.">Mitochondrial control of cellular life, stress, and death.</a> Circulation Research. 111 (9), 1198-1207 (2012).</li><li>Rone, M. B., Fan, J., Papadopoulos, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholesterol+transport+in+steroid+biosynthesis:+role+of+protein-protein+interactions+and+implications+in+disease+states.">Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states.</a> Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).</li><li>Swenson, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+synthesis+to+utilization:+The+ins+and+outs+of+mitochondrial+heme.">From synthesis to utilization: The ins and outs of mitochondrial heme.</a> Cells. 9 (3), 579 (2020).</li><li>West, A. P., Shadel, G. S., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+in+innate+immune+responses.">Mitochondria in innate immune responses.</a> Nature Reviews. Immunology. 11 (6), 389-402 (2011).</li><li>Nunnari, J., Suomalainen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria:+In+sickness+and+in+health.">Mitochondria: In sickness and in health.</a> Cell. 148 (6), 1145-1159 (2012).</li><li>Pohjoism&#228;ki, J. L. O., Goffart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+circles,+forks+and+humanity:+Topological+organisation+and+replication+of+mammalian+mitochondrial+DNA.">Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA.</a> BioEssays. 33 (4), 290-299 (2011).</li><li>Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+and+expression+of+mammalian+mitochondrial+DNA.">Maintenance and expression of mammalian mitochondrial DNA.</a> Annual Review of Biochemistry. 85, 133-160 (2016).</li><li>Nicholls, T. J., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separating+and+segregating+the+human+mitochondrial+genome.">Separating and segregating the human mitochondrial genome.</a> Trends in Biochemical Sciences. 43 (11), 869-881 (2018).</li><li>Gratzner, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+to+5-bromo-+and+5-iododeoxyuridine:+A+new+reagent+for+detection+of+DNA+replication.">Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication.</a> Science. 218 (4571), 474-475 (1982).</li><li>Stirling, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler+4:+Improvements+in+speed,+utility+and+usability.">CellProfiler 4: Improvements in speed, utility and usability.</a> BMC Bioinformatics. 22 (1), 433 (2021).</li><li>R Core Team. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R:+A+Language+and+Environment+for+Statistical+Computing.">R: A Language and Environment for Statistical Computing.</a> R Foundation for Statistical Computing. , (2021).</li><li>. dplyr: A Grammar of Data Manipulation Available from: <a target="_blank" href="https://CRAN.R-project.org/package=dplyr">https://CRAN.R-project.org/package=dplyr</a> (2021)</li><li>. data.table: Extension of `data.frame Available from: <a target="_blank" href="https://CRAN.R-project.org/package=data.table">https://CRAN.R-project.org/package=data.table</a> (2020)</li><li>. ggplot2: Elegant graphics for data analysis Available from: <a target="_blank" href="https://ggplot2.tidyverse.org">https://ggplot2.tidyverse.org</a> (2016)</li><li>. ggpubr: &amp;#34;ggplot2&amp;#34; based publication ready plots Available from: <a target="_blank" href="https://CRAN.R-project.org/package=ggpubr">https://CRAN.R-project.org/package=ggpubr</a> (2020)</li><li>Hashiguchi, K., Zhang-Akiyama, Q. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+lines+lacking+mitochondrial+DNA.">Establishment of human cell lines lacking mitochondrial DNA.</a> Methods in Molecular Biology. 554, 383-391 (2009).</li><li>Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+mitochondrial+genome+responses+in+HeLa+cells+treated+with+inhibitors+of+mitochondrial+DNA+expression.">Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.</a> Acta Biochimica Polonica. 53 (3), 485-495 (2006).</li><li>Spelbrink, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+mitochondrial+DNA+deletions+associated+with+mutations+in+the+gene+encoding+Twinkle,+a+phage+T7+gene+4-like+protein+localized+in+mitochondria.">Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.</a> Nature Genetics. 28 (3), 223-231 (2001).</li><li>Campbell, C. T., Kolesar, J. E., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+transcription+factor+A+regulates+mitochondrial+transcription+initiation,+DNA+packaging,+and+genome+copy+number.">Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number.</a> Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).</li><li>Krasich, R., Copeland, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerases+in+the+mitochondria:+A+critical+review+of+the+evidence.">DNA polymerases in the mitochondria: A critical review of the evidence.</a> Frontiers in Bioscience. 22 (4), 692-709 (2017).</li><li>Kotrys, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteomics+revealed+C6orf203/MTRES1+as+a+factor+preventing+stress-induced+transcription+deficiency+in+human+mitochondria.">Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria.</a> Nucleic Acids Research. 47 (14), 7502-7517 (2019).</li><li>Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribonucleic+acid+replication+in+single+cells+and+chromosomes+by+immunologic+techniques.">Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques.</a> Journal of Histochemistry &amp; Cytochemistry. 24 (1), 34-39 (1976).</li><li>Leif, R. C., Stein, J. H., Zucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+short+history+of+the+initial+application+of+anti-5-BrdU+to+the+detection+and+measurement+of+S+phase.">A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase.</a> Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).</li><li>Lentz, S. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+(mtDNA)+biogenesis:+visualization+and+duel+incorporation+of+BrdU+and+EdU+into+newly+synthesized+mtDNA+in+vitro.">Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro.</a> The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-omic+measurements+of+heterogeneity+in+HeLa+cells+across+laboratories.">Multi-omic measurements of heterogeneity in HeLa cells across laboratories.</a> Nature Biotechnology. 37 (3), 314-322 (2019).</li></ol>

تاريخيا ، تم استخدام وضع علامات الحمض النووي عن طريق دمج BrdU والكشف عن الأجسام المضادة في تكرار الحمض النووي النووي وأبحاث دورة الخلية14،27،28. حتى الآن ، تضمنت جميع بروتوكولات الكشف عن الحمض النووي المسمى BrdU خطوة تمسخ الحمض النووي (حمضي أو ح...

بالنسبة لمعظم الخلايا حقيقية النواة، تعتبر الميتوكوندريا عضيات أساسية؛ لأنها تلعب دورا مهما في العديد من العمليات الخلوية. أولا وقبل كل شيء ، الميتوكوندريا هي موردي الطاقة الرئيسيين للخلايا1. تشارك الميتوكوندريا أيضا في تنظيم التوازن الخلوي (على سبيل المثال ، الأكسدة والاختزال داخل الخلايا2 وتوازن الكالسيوم3) ، وإشارات الخلية4,5 ، وموت الخلايا المبرمج6 ، وتوليف المركبات الكيميائية الحيوية المختلفة 7,8 ، والاستجابة المناعية الفطرية9. يرتبط ضعف الميتوكوندريا بحالات مرضية مختلفة وأمراض بشرية10.
يعتمد عمل الميتوكوندريا على المعلومات الوراثية الموجودة في جينومين منفصلين: الجينوم النووي والميتوكوندريا. يشفر جينوم الميتوكوندريا عددا صغيرا من الجينات مقارنة بالجينوم النووي ، لكن جميع الجينات المشفرة بالحمض النووي mtDNA ضرورية لحياة الإنسان. يتم ترميز آلية بروتين الميتوكوندريا اللازمة للحفاظ على mtDNA بواسطة nDNA. تم بالفعل تحديد المكونات الأساسية لرد الميتوكوندريا ، وكذلك بعض عوامل التكوين الحيوي للميتوكوندريا (تمت مراجعتها في البحث السابق11،12). ومع ذلك ، لا تزال آليات تكرار الحمض النووي للميتوكوندريا وصيانتها بعيدة عن الفهم. على عكس nDNA ، يوجد جينوم الميتوكوندريا في نسخ متعددة ، مما يوفر طبقة إضافية لتنظيم التعبير الجيني للميتوكوندريا. لا يعرف الكثير حاليا عن توزيع وفصل mtDNA داخل العضيات ، إلى أي مدى يتم تنظيم هذه العمليات ، وإذا كانت كذلك ، فما هي البروتينات المشاركة13. يعد نمط الفصل أمرا بالغ الأهمية عندما تحتوي الخلايا على مجموعة مختلطة من الحمض النووي mtDNA من النوع البري والمتحول. قد يؤدي توزيعها غير المتكافئ إلى توليد خلايا تحتوي على كمية ضارة من mtDNA المتحور.
حتى الآن ، تم تحديد عوامل البروتين اللازمة لصيانة mtDNA بشكل أساسي عن طريق الطرق الكيميائية الحيوية أو التحليلات المعلوماتية الحيوية أو من خلال الدراسات المرتبطة بالمرض. في هذا العمل ، من أجل ضمان فرصة كبيرة لتحديد العوامل التي نجت من تحديد الهوية سابقا ، يتم وصف استراتيجية مختلفة. تعتمد الطريقة على وضع العلامات على mtDNA أثناء النسخ المتماثل أو الإصلاح باستخدام 5-bromo-2'-deoxyuridine (BrdU) ، وهو نظير نيوكليوزيد للثيميدين. يتم دمج BrdU بسهولة في خيوط الحمض النووي الوليدة أثناء تخليق الحمض النووي ، وبشكل عام ، يستخدم لمراقبة تكرار الحمض النوويالنووي 14. ومع ذلك ، فقد تم تحسين الإجراء الذي تم تطويره هنا للكشف عن BrdU المدمج في mtDNA باستخدام التألق المناعي للأجسام المضادة ل BrdU.
يسمح هذا النهج بالقياس الكمي عالي الإنتاجية لتخليق mtDNA وتوزيعه في الخلايا البشرية المزروعة في المختبر. من الضروري وجود استراتيجية عالية الإنتاجية لإجراء الاختبارات في ظل ظروف تجريبية مختلفة في وقت قصير نسبيا ؛ لذلك ، يقترح في البروتوكول استخدام تنسيق متعدد الآبار لزراعة الخلايا والمجهر الفلوري الآلي للتصوير. يتضمن البروتوكول نقل خلايا هيلا البشرية مع مكتبة siRNA والمراقبة اللاحقة لتكرار mtDNA أو إصلاحه باستخدام وضع العلامات الأيضية للحمض النووي المركب حديثا مع BrdU. يتم الجمع بين هذا النهج مع التلوين المناعي للحمض النووي بمساعدة الأجسام المضادة للحمض النووي. يتم تحليل كلتا المعلمتين باستخدام المجهر الفلوري الكمي. بالإضافة إلى ذلك ، يتم تصور الميتوكوندريا بصبغة معينة. لإثبات خصوصية البروتوكول ، تم اختبار تلطيخ BrdU على خلايا خالية من mtDNA (خلايا rho0) ، وعلى خلايا HeLa عند إسكات عوامل صيانة mtDNA المعروفة ، وعلى خلايا HeLa بعد العلاج بمثبط تكرار mtDNA. تم قياس مستويات mtDNA أيضا بطريقة مستقلة ، وهي qPCR.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2&#8242;,3&#8242;-Dideoxycytidine (ddC)</td>
			<td>Sigma-Aldrich</td>
			<td>D5782</td>
			<td></td>
		</tr>
		<tr>
			<td>384&#160; Well Cell Culture Microplates, black</td>
			<td>Greiner Bio-One</td>
			<td>#781946</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-2&#8242;-deoxyuridine (BrdU)</td>
			<td>Sigma-Aldrich</td>
			<td>B5002-1G</td>
			<td>Dissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 &#181;M BrdU solution for labeling.</td>
		</tr>
		<tr>
			<td>Adhesive sealing film</td>
			<td>Nerbe Plus</td>
			<td>04-095-0060</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 goat anti-mouse IgG1 secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21121</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 555 goat anti-mouse IgM secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21426</td>
			<td></td>
		</tr>
		<tr>
			<td>BioTek 405 LS microplate washer</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Sigma-Aldrich</td>
			<td>A4503</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell counting chamber Thoma</td>
			<td>Heinz Herenz</td>
			<td>REF:1080339</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Cytiva</td>
			<td>SH30243.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Thermo Fisher Scientific</td>
			<td>41965-062</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde solution</td>
			<td>Sigma-Aldrich</td>
			<td>F1635</td>
			<td>Formaldehyde is toxic; please read the safety data sheet carefully.</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td></td>
		</tr>
		<tr>
			<td>IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323</td>
			<td></td>
		</tr>
		<tr>
			<td>IgM mouse monoclonal anti-DNA (AC-30-10) primary antibody</td>
			<td>Progen</td>
			<td>#61014</td>
			<td></td>
		</tr>
		<tr>
			<td>LightCycler 480 System</td>
			<td>Roche</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAiMAX Transfection Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>#13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>MitoTracker Deep Red FM</td>
			<td>Thermo Fisher Scientific</td>
			<td>M22426</td>
			<td>Mitochondria tracking dye&#160;</td>
		</tr>
		<tr>
			<td>Multidrop Combi Reagent Dispenser</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>51985-042</td>
			<td></td>
		</tr>
		<tr>
			<td>Orca-R2 (C10600) CCD Camera</td>
			<td>Hamamatsu</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P0781-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate buffered saline (PBS)</td>
			<td>Sigma-Aldrich</td>
			<td>P4417-100TAB</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR primer Fw B2M (reference)</td>
			<td></td>
			<td></td>
			<td>CAGGTACTCCAAAGATTCAGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>GACCTTTACTACCCAGGAGA</td>
		</tr>
		<tr>
			<td>qPCR primer Fw MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>TAGCAGAGACCAACCGAACC&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw POLG</td>
			<td></td>
			<td></td>
			<td>TGGAAGGCAGGCATGGTCAAACC</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TFAM</td>
			<td></td>
			<td></td>
			<td>GATGAGTTCTGCCTGCTTTAT</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TWNK</td>
			<td></td>
			<td></td>
			<td>GCCATGTGACACTGGTCATT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev B2M (reference)</td>
			<td></td>
			<td></td>
			<td>GTCAACTTCAATGTCGGATGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>AGTAGACAGGGCAACAAAGT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>ATGAAGAATAGGGCGAAGGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev POLG</td>
			<td></td>
			<td></td>
			<td>GGAGTCAGAACACCTGGCTTTGG</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TFAM</td>
			<td></td>
			<td></td>
			<td>GGACTTCTGCCAGCATAATA</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TWNK</td>
			<td></td>
			<td></td>
			<td>AACATTGTCTGCTTCCTGGC</td>
		</tr>
		<tr>
			<td>ScanR microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA Ctrl</td>
			<td>Dharmacon</td>
			<td>D-001810-10-5</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA POLG</td>
			<td>Invitrogen</td>
			<td>POLGHSS108223</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TFAM</td>
			<td>Invitrogen</td>
			<td>TFAMHSS144252</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TWNK</td>
			<td>Invitrogen</td>
			<td>C10orf2HSS125597</td>
			<td></td>
		</tr>
		<tr>
			<td>Suction device</td>
			<td>NeoLab</td>
			<td>2-9335</td>
			<td>Suction device for cell culture</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T9284-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Biowest</td>
			<td>L0931-500</td>
			<td></td>
		</tr>
		<tr>
			<td>UPlanSApo 20x 0.75 NA objective</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput image-based quantification of mitochondrial dna synthesis and distribution

تتطلب الغالبية العظمى من العمليات الخلوية إمدادا مستمرا بالطاقة ، والناقل الأكثر شيوعا هو جزيء ATP. تنتج الخلايا الحقيقية النواة معظم جزيئات ATP في الميتوكوندريا عن طريق الفسفرة التأكسدية. الميتوكوندريا عضيات فريدة من نوعها لأن لها جينوم خاص بها يتضاعف وينتقل إلى الجيل التالي من الخلايا. على عكس الجينوم النووي ، هناك نسخ متعددة من جينوم الميتوكوندريا في الخلية. تعد الدراسة التفصيلية للآليات المسؤولة عن تكرار وإصلاح وصيانة جينوم الميتوكوندريا ضرورية لفهم الأداء السليم للميتوكوندريا والخلايا بأكملها في ظل الظروف العادية والمرضية. هنا ، يتم تقديم طريقة تسمح بالقياس الكمي عالي الإنتاجية لتوليف وتوزيع الحمض النووي للميتوكوندريا (mtDNA) في الخلايا البشرية المزروعة في المختبر . يعتمد هذا النهج على الكشف المناعي لجزيئات الحمض النووي المركبة بنشاط والتي تم تصنيفها بواسطة دمج 5-bromo-2'-deoxyuridine (BrdU) والكشف المتزامن عن جميع جزيئات mtDNA مع الأجسام المضادة للحمض النووي. بالإضافة إلى ذلك ، يتم تصور الميتوكوندريا بأصباغ أو أجسام مضادة محددة. إن زراعة الخلايا في شكل متعدد الآبار واستخدام مجهر مضان آلي يجعل من السهل دراسة ديناميكيات mtDNA ومورفولوجيا الميتوكوندريا في ظل مجموعة متنوعة من الظروف التجريبية في وقت قصير نسبيا.

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9. Mitochondrial dysfunction is associated with various pathological states and human diseases10. 
The functioning of mitochondria depends on the genetic information located in two separate genomes: the nuclear and mitochondrial genomes. The mitochondrial genome encodes a small number of genes compared to the nuclear genome, but all the mtDNA-encoded genes are essential for human life. The mitochondrial protein machinery necessary to maintain the mtDNA is encoded by nDNA. The basic components of the mitochondrial replisome, as well as some mitochondrial biogenesis factors, have already been identified (reviewed in previous research11,12). However, mitochondrial DNA replication and maintenance mechanisms are still far from being understood. In contrast to nDNA, the mitochondrial genome exists in multiple copies, which provides an additional layer for regulating mitochondrial gene expression. Much less is currently known about the distribution and segregation of mtDNA within organelles, to what extent these processes are regulated, and if they are, which proteins are involved13. The segregation pattern is crucial when cells contain a mixed population of wild-type and mutated mtDNA. Their unequal distribution may lead to the generation of cells with a detrimental amount of mutated mtDNA.
So far, the protein factors necessary for mtDNA maintenance have been identified mainly by biochemical methods, bioinformatic analyses, or through disease-associated studies. In this work, in order to ensure a high chance of identifying factors that have previously escaped identification, a different strategy is described. The method is based on the labeling of mtDNA during replication or repair with 5-bromo-2'-deoxyuridine (BrdU), a nucleoside analog of thymidine. BrdU is readily incorporated into nascent DNA strands during DNA synthesis and, in general, is used for monitoring the replication of nuclear DNA14. However, the procedure developed here has been optimized for detecting BrdU incorporated into mtDNA using the immunofluorescence of anti-BrdU antibodies.
The approach allows for the high-throughput quantification of mtDNA synthesis and distribution in human cells cultured in vitro. A high-throughput strategy is necessary to conduct tests under different experimental conditions in a relatively short time; therefore, it is proposed in the protocol to utilize a multi-well format for cell culturing and automated fluorescence microscopy for imaging. The protocol includes the transfection of human HeLa cells with an siRNA library and the subsequent monitoring of mtDNA replication or repair using the metabolic labeling of newly synthesized DNA with BrdU. This approach is combined with immunostaining of the DNA with the help of anti-DNA antibodies. Both parameters are analyzed using quantitative fluorescence microscopy. Additionally, mitochondria are visualized with a specific dye. To demonstrate the specificity of the protocol, BrdU staining was tested on cells devoid of mtDNA (rho0 cells), on HeLa cells upon the silencing of well-known mtDNA maintenance factors, and on HeLa cells after treatment with an mtDNA replication inhibitor. The mtDNA levels were also measured by an independent method, namely qPCR.

تسليط الضوء على المؤلف: القياس الكمي عالي الإنتاجية القائم على الصور لتخليق وتوزيع الحمض النووي للميتوكوندريا  

القياس الكمي عالي الإنتاجية القائم على الصور لتخليق وتوزيع الحمض النووي للميتوكوندريا

The protocol aims to identify proteins with dysfunction leads to changes in the number of mitochondrial DNA molecules. This research may also reveal the factors involving the distribution of mitochondrial DNA within the mitochondria. Mitochondrial replication and maintenance mechanisms are still not fully understood.Much less is known about regulating the distribution of mitochondrial genomes within organoids and the proteins involved in it. As a result, identifying and characterizing some new players will be of great importance. The main advantage of the technique is its high-throughput and high content protocol.We can simultaneously test many experimental conditions and measure various parameters during a single experiment. In genome-wide studies, the proposed protocol provides an opportunity to outline a global picture of how nuclear encoded genetic information regulates its mitochondrial counterpart. Additionally, it has the potential to identify proteins whose dysfunction causes mitochondrial DNA stress and activates the interferon response pathway.

يظهر مخطط لإجراء الدراسة عالية الإنتاجية لديناميكيات تخليق وتوزيع mtDNA في الشكل 1. يتيح استخدام تنسيق لوحة متعددة الآبار التحليل المتزامن للعديد من الظروف التجريبية المختلفة ، مثل إسكات الجينات المختلفة باستخدام مكتبة siRNA. تسمح الظروف المستخدمة لوضع العلامات على جزيئات ال...

Watch this Scientific Journal Video about High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution at JoVE.com

تم وصف إجراء لدراسة ديناميكيات استقلاب الحمض النووي للميتوكوندريا (mtDNA) في الخلايا باستخدام تنسيق لوحة متعددة الآبار والتصوير المناعي الآلي للكشف عن تخليق وتوزيع mtDNA وتحديده. يمكن استخدام هذا أيضا للتحقيق في آثار مثبطات مختلفة ، والضغوط الخلوية ، وإسكات الجينات على استقلاب mtDNA.

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

يهدف البروتوكول إلى تحديد البروتينات ذات الخلل الوظيفي الذي يؤدي إلى تغيرات في عدد جزيئات الحمض النووي للميتوكوندريا. قد يكشف هذا البحث أيضا عن العوامل التي تنطوي على توزيع الحمض النووي للميتوكوندريا داخل الميتوكوندريا. لا تزال آليات تكرار الميتوكوندريا وصيانتها غير مفهومة تماما.لا يعرف الكثير عن تنظيم توزيع جينومات الميتوكوندريا داخل المواد العضوية والبروتينات المشاركة فيها. ونتيجة لذلك، سيكون تحديد وتوصيف بعض اللاعبين الجدد ذا أهمية كبيرة. الميزة الرئيسية لهذه التقنية هي بروتوكول المحتوى العالي والمحتوى العالي.يمكننا اختبار العديد من الظروف التجريبية في وقت واحد وقياس المعلمات المختلفة خلال تجربة واحدة. في الدراسات على مستوى الجينوم ، يوفر البروتوكول المقترح فرصة لتحديد صورة عالمية لكيفية تنظيم المعلومات الوراثية المشفرة النووية لنظيرتها الميتوكوندريا. بالإضافة إلى ذلك ، لديه القدرة على تحديد البروتينات التي يسبب اختلالها الوظيفي إجهاد الحمض النووي للميتوكوندريا وينشط مسار استجابة الإنترفيرون.

القياس الكمي عالي الإنتاجية القائم على الصور لتخليق وتوزيع الحمض النووي للميتوكوندريا

Abstract